Molecular marker for residual feed intake in sheep, method for detecting the same and use thereof

Abstract

The application provides a molecular marker related to residual feed intake of sheep, a detection method and application thereof. The application finds that there is an A / T polymorphic site at the 180th position of an amplified fragment by performing PCR amplification and sequence analysis on a BANK1 gene of sheep, further detects the polymorphic site of 1105 Hu sheep by using KASPar primers, establishes a least square model, and performs correlation analysis on the genotype and residual feed intake (RFI), and finally determines that the amplified BANK1 gene fragment can be used as a molecular marker related to residual feed intake of sheep. The application can be used for selecting and reserving sheep with TT homozygous gene into a core group as breeding sheep by detecting the molecular marker, so as to improve the residual feed intake of sheep and help to improve economic benefits.

Description

Technical Field

[0001] This invention belongs to the technical field of molecular markers, specifically relating to the BANK1 gene fragment as a molecular marker affecting residual feed intake in sheep, its detection method, and its application. Background Technology

[0002] The B-cell scaffold protein BANK1, containing ankyrin repeat sequences, encodes a B-cell-specific scaffold protein that plays a role in B-cell receptor-induced intracellular calcium mobilization. This protein also promotes Lyn-mediated tyrosine phosphorylation of the inositol 1,4,5-triphosphate receptor, and alternative splicing results in multiple transcriptional variants. However, the relationship between this gene and residual feed intake in sheep remains unclear.

[0003] With the development of animal husbandry, the mutton industry is also developing rapidly. Improving economic efficiency is one of the most important tasks in the process of development. In the mutton sheep farming industry, feed costs alone account for more than half (65-70%) of the total breeding cost (Zhang X, Wang W, Mo F, et al. Association of residual feed intake with growth and slaughtering performance, blood metabolism, and body composition in growing lambs[J]. Scientific Reports, 2017, 7(1):12681.). Therefore, selecting sheep that can effectively convert feed into carcass growth will increase the profitability of farms, thereby reducing feed expenditure while maintaining production and lowering production costs. In addition, ruminant farming not only faces the pressure of reducing exhaust emissions and improving the environment, but also the pressure of increasing production. Therefore, selecting sheep with high feed efficiency can not only increase meat production and reduce costs, but also reduce exhaust emissions. Residual feed intake (RFI) is defined as the residual between the animal's actual feed intake and the predicted feed intake required for maintenance. Because feed efficiency (RFI) is unaffected by animal size and growth rate, it avoids individual differences and effectively assesses feed efficiency. Therefore, RFI selection may offer opportunities to improve livestock feed efficiency without compromising growth performance. Studies have shown that selecting animals with low RFI can save money without sacrificing production performance and has no impact on animal production performance or body composition, resulting in higher production efficiency. Lower RFI means higher feed efficiency, which means less feed is consumed when the same production demand is required. Reducing RFI through a series of feeding measures or farming strategies can effectively reduce farming costs and improve economic benefits. Synonymous mutations can alter mRNA stability, splicing regulatory sites, miRNA binding sites, or translation efficiency, leading to changes in protein levels or protein conformation. This invention, through sequencing and analysis of the BANK1 gene, explores the association between different genotypes and residual feed intake in sheep, aiming to provide genetic material for improving sheep feed efficiency and accelerate the breeding process of new high-feed-efficiency, high-quality meat sheep breeds with independent intellectual property rights. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a molecular marker related to sheep residual feed intake and its application. The molecular marker of this invention is amplified from the sheep BANK1 gene, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying and sequencing the DNA sequence of the sheep BANK1 gene, polymorphic sites in the BANK1 gene are identified, the correlation between different genotypes and sheep residual feed intake is analyzed, and a detection method for the molecular marker containing polymorphic sites is established. This molecular marker can be applied to the breeding of new high-quality meat sheep breeds with high feed efficiency (low residual feed intake).

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A molecular marker associated with residual feed intake in sheep, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the W at position 180 represents A or T, and the A / T mutation at position 180 in the above sequence leads to the A / T polymorphism of the sheep BANK1 gene at this site.

[0007] The primer pair for detecting the above molecular markers preferably includes the nucleotide sequences MF as shown in SEQ ID NO.2 and MR as shown in SEQ ID NO.3.

[0008] The KASPar primer pair for detecting the above molecular markers includes a forward primer A1 with a nucleotide sequence as shown in SEQ ID NO.4, a forward primer A2 with a nucleotide sequence as shown in SEQ ID NO.5, and a universal reverse primer C with a nucleotide sequence as shown in SEQ ID NO.6.

[0009] A detection kit for detecting the above-mentioned molecular markers, the detection kit comprising PCR primer pairs or KASPar primer pairs for detecting the above-mentioned molecular markers.

[0010] A method for detecting the molecular markers described above, the method comprising detecting sheep genomic DNA using the primer pairs or detection kits described above, specifically comprising the following steps:

[0011] S1. Amplify sheep genomic DNA using the above-mentioned PCR primer pairs, KASPar primer pairs, or detection kits containing the above-mentioned primer pairs;

[0012] S2. Identify the polymorphic sites in the amplification products obtained in step S1.

[0013] In step S2, the above-mentioned typing and identification methods include, but are not limited to, direct sequencing, probe method, gene chip method, and high-resolution melting curve method.

[0014] The method for detecting molecular markers related to residual feed intake rate in sheep using the above primer pairs includes the following steps:

[0015] a) Genomic DNA was extracted from sheep blood samples and amplified by high-throughput water bath PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0016] b) After amplification, fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstar instrument.

[0017] The application of the detection methods of molecular markers, primer pairs or kits described above in the detection of correlation between residual feed intake and sheep can determine the level of residual feed intake by detecting the molecular markers of the present invention in the genomic DNA of the sheep to be tested and analyzing the types of polymorphic sites, thereby screening out sheep with low residual feed intake.

[0018] The application of the molecular markers, primer pairs, or kits described above in sheep breeding involves amplifying and detecting the genomic DNA of sheep using the aforementioned primer pairs or kits to determine the genotype of the BANK1 gene in the sample to be tested, thereby enabling the selection of sheep breeds with low feed residue and high feed intake.

[0019] Finding gene variation sites and analyzing their association with traits to discover the relationship between genes and traits is an important method for studying gene function and a basis for marker-assisted selection.

[0020] This invention, through PCR amplification and sequencing of the BANK1 gene of the representative sheep breed, Hu sheep, discovered an A / T polymorphism site at position 180 of the amplified fragment. By detecting polymorphisms in 1105 Hu sheep and establishing a least-squares model, a molecular marker related to sheep feed efficiency was identified. This molecular marker can be used to breed new breeds with high feed efficiency (low residual feed intake), providing an effective genetic engineering method for the genetic improvement of sheep feed efficiency and having significant practical application value.

[0021] This invention detects the aforementioned molecular markers by designing KASPar primers required for competitive allele-specific PCR (KASP). This detection method does not require the synthesis of specific fluorescent probes for each SNP site. Instead, it is based on its unique ARM PCR principle, allowing all site detections to ultimately use universal fluorescent primers for amplification. This significantly reduces reagent costs and provides high accuracy, offering a simple, accurate, and low-cost method for detecting the molecular markers of this invention.

[0022] The beneficial effects of this invention are as follows:

[0023] This invention provides molecular markers related to residual feed intake in sheep and their A / T polymorphic sites. By determining the genotype of these polymorphisms, sheep with high feed efficiency (i.e., low residual feed intake) can be effectively identified, providing an effective detection method for breeding high-feed-efficiency sheep. Through the detection of molecular markers and polymorphic sites, this invention can be used to select sheep with homozygous TT genes for breeding, thereby improving sheep feed efficiency and contributing to increased economic benefits in sheep farming. Attached Figure Description

[0024] Figure 1 This is a gel electrophoresis image of the sheep BANK1 gene fragment used as a molecular marker in this invention.

[0025] Figure 2 The sequencing results are for the sheep BANK1 gene mutation site in this invention.

[0026] Figure 3 This is the KASPar SNP typing result of the A>T mutation site in the sheep BANK1 gene in this invention. Detailed Implementation

[0027] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0028] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.

[0029] Example 1: Amplification of the BANK1 gene

[0030] (1) Primer design

[0031] Using sheep BANK1 gene DNA (GenBank accession number: NC_056059.1) as a template, a pair of primers, MF and MR, were designed using Oligo 7.0 software. The primer sequences are as follows:

[0032] MF(SEQ ID NO.2): 5'-CTGGCTTAATAAGGCCCAT-3'

[0033] MR(SEQ ID NO.3):5'-TACAACACATCGGTAGTGGA-3'

[0034] (2) Amplification and sequencing of the BANK1 gene

[0035] Genomic DNA extracted from sheep whole blood cells was used as a DNA template for PCR amplification. The amplification reaction system included 1.5 μL of DNA template, 17.5 μL of 2×PCR Master Mix, 1 μL of forward primer (concentration of 10 μmol / L), 1 μL of reverse primer (concentration of 10 μmol / L), and 14 μL of ddH2O, with a total volume of 35 μL.

[0036] PCR amplification procedure:

[0037] Pre-denaturation at 94℃ for 3 minutes;

[0038] 94℃ denaturation for 30s, 52℃ annealing for 30s, 72℃ extension for 30s, cycled 35 times;

[0039] Finally, extend at 72°C for 10 minutes.

[0040] The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the results revealed a specific amplified fragment of 230 bp. Sequencing of the amplified PCR fragment yielded the results shown in SEQ ID NO.1. This fragment exhibits a polymorphic site, specifically at position 180, where W is either A or T. In other words, the amplified BANK1 gene fragment (SEQ ID NO.1) displays an A / T polymorphism at position 180 (see [link to SEQ ID NO.1]). Figure 2 .

[0041] Among them, SEQ ID NO.1: CTGGCTTAATAAGGCCCATGCCCGTGCAACTGTGCTTGTAGAGCTAGTTCCTGTTAATTATGGATATATGAAAAGAGCCATTGGTCTGGATGCACAAGTCAAAGTAAGCTGATACGATCCACGATCCACGAGGATCAAAATCCTTTGTTACATGTGCTTAATGATTCATTAAAGTCTAGWAGGCCACCCACCCCGAGACAATCTAGAAACTCCACTACCGATGTGTTGTA.

[0042] DNA sequence homology retrieval and identification:

[0043] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of the sheep BANK1 gene DNA (GenBank accession number: NC_040257.1).

[0044] Example 2: Establishment of a Genotyping Detection Method

[0045] (1) Primer sequence design

[0046] KASPar primer pairs were designed targeting the A / T polymorphism site of the amplified fragment in Example 1 for the specific detection of this polymorphism site. The nucleotide sequence of the designed KASPar primer pairs is as follows:

[0047] Forward primer A1 (SEQ ID NO.4) used to detect AlleleA:

[0048] 5'-GAAGGTGACCAAGTTCATGCTCTCGGGGTGGGTGGCCTT-3';

[0049] Forward primer A2 (SEQ ID NO.5) used for detecting AlleleT:

[0050] 5'-GAAGGTCGGAGTCAACGGATTCTCGGGGTGGGTGGCCTA-3';

[0051] Universal reverse primer C (SEQ ID NO.6):

[0052] 5'-CCTTTGTTACATGTGCTTAATGATTCATTAAAG-3'.

[0053] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 (primer A1:primer A2:primer C) for later use.

[0054] (2) DNA quality control

[0055] Genomic DNA was extracted from whole blood of sheep using a DNA extraction kit. The extracted genomic DNA was then tested for quality using 1% agarose gel electrophoresis and Nanodrop 2100. The acceptable DNA requirements were: (1) Agarose gel electrophoresis showed a single DNA band without significant diffusion; (2) Nanodrop 2100 showed A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. Based on the KASPar detection technology from LGC (UK) and the conversion of genome size, the required DNA dosage was calculated to be 10–20 ng / sample. The extracted genomic DNA was then diluted to a concentration of 10–20 ng / μL as a DNA template.

[0056] (3) Genotyping

[0057] First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10–20 ng / μL) and a blank control (No template control, NTC, using sterile water) were added to 384-well reaction plates, respectively. The plates were then dried at 60°C for 30 min (drying oven, LGC Corporation) until the DNA became a dry powder for later use.

[0058] Each primer in the above KASPar primer pair was diluted to 10 μmol / L and mixed with primer A1:A2:C in a volume ratio of 12:12:30 to prepare a primer mixture for later use.

[0059] Then, using a Meridian loading station under the Kraken operating system, 1×Master mix (1536 microplate, catalog number: Part No. KBS-1016-011) and primer mixture were added to each reaction well. Immediately after mixing, the microplates were sealed sequentially using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler high-throughput water bath system. The specific procedure was as follows:

[0060] Pre-denaturation at 94℃ for 15 minutes;

[0061] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplify in touch-down order for 10 cycles, decreasing the temperature by 0.6℃ per cycle;

[0062] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0063] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3 As shown in the figure, each dot represents a sample to be tested. The red dot near the left indicates that the locus is homozygous for the genotype "TT"; the green dot near the middle indicates that the locus is heterozygous for the genotypes "AT" or "TA"; and the blue dot near the right indicates that the locus is homozygous for the genotype "AA".

[0064] 4) Application of the molecular markers of this invention in the association analysis of residual feed intake in sheep

[0065] The experiment examined the polymorphism of 1105 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and remaining feed intake.

[0066] Y ijk =μ+Genotype i +P j +S k +ε ijk

[0067] Among them, Y ijk The remaining feed intake is the observed value, μ is the population mean, and Genotype is the genotype. i For genotype effect, P j Due to the batch effect, S k Due to seasonal effects, ε ijk Assuming random error, let ε ijk They are independent of each other and follow an N(0, σ2) distribution.

[0068] The residual feed intake (RFI) of Hu sheep was calculated using linear regression, and the calculation model is shown below.

[0069] Y i =β0+β 1* MBW i +β 2* ADG i +e i ,

[0070] Where Y i MBW represents the average feed intake of individual sheep (i). i For the intermediate metabolic weight of individual sheep, ADG i e represents the average daily weight gain of individual sheep i. i Let β be the remaining feed intake of individual sheep i, β0 be the regression intercept, β1 be the regression coefficient of MBW, and β2 be the regression coefficient of ADG.

[0071] Genotyping results showed that among the 1105 individuals, there were 184 individuals with the AA genotype, 594 individuals with the AT genotype, and 327 individuals with the TT genotype. The results of the association analysis between genotype and residual feed intake (RFI, kg / d) are shown in Table 1.

[0072] Table 1. Association analysis between BANK1 gene polymorphism and feed efficiency in Hu sheep.

[0073]

[0074]

[0075] Note: RFI represents residual feed intake, in kg / d. RFI 80-100 represents residual feed intake (mean ± standard deviation) for the 80-100 day age group, and so on. Different superscript letters between data in the same row indicate significant differences (P<0.05), while the same letter or no letter indicates no significant differences (P>0.05).

[0076] The results showed that with the extension of the measurement period, the A / T mutation site at position 180, as shown in SEQ ID NO.1, was significantly correlated with the remaining feed intake of Hu sheep. Specifically, at 100-120 days of age (RFI 100-120), 80-140 days of age (RFI 80-140), 80-160 days of age (RFI 80-160), and 80-180 days of age (RFI 80-180), the remaining feed intake of Hu sheep with the TT genotype was significantly lower than that of Hu sheep with the AA genotype. This indicates that sheep carrying the TT genotype have a better remaining feed intake than sheep carrying the AA genotype (P<0.05). Therefore, the T allele is the dominant allele. This suggests that the BANK1 g.179A>T mutation site can serve as a potential molecular marker affecting the remaining feed intake of sheep (P<0.05). During breeding, the TT genotype is selected for preservation, and TT genotype sheep are used as breeding stock for crossbreeding with other sheep. In particular, artificial insemination using semen from TT genotype rams can significantly improve breeding efficiency, shorten breeding time, and produce superior sheep flocks with high feed efficiency (low RFI). Furthermore, breeding low RFI sheep not only reduces production costs and enhances livestock competitiveness but also improves the quality and flavor of the meat.

Claims

1. Use of a PCR primer pair detecting a molecular marker associated with residual feed intake in sheep in the detection of a correlation with residual feed intake in sheep, characterized in that, The PCR primer pair comprises M-F as shown in SEQ ID NO. 2 and M-R as shown in SEQ ID NO. 3, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein W at position 180 represents A or T, and the mutation results in an A / T polymorphism of the molecular marker, and the residual intake of sheep carrying TT genotype is significantly lower than that of sheep carrying AA genotype.

2. Use of a KASPar primer pair detecting a molecular marker associated with residual feed intake in sheep in the detection of residual feed intake in sheep, characterized in that, The KASPar primer pair comprises forward primer A1 as shown in SEQ ID NO. 4, forward primer A2 as shown in SEQ ID NO. 5 and universal reverse primer C as shown in SEQ ID NO. 6, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein W at position 180 represents A or T, and the mutation results in an A / T polymorphism of the molecular marker, and the residual intake of sheep carrying TT genotype is significantly lower than that of sheep carrying AA genotype.

3. Use of a detection kit for detecting a molecular marker associated with residual feed intake in sheep for detecting the association with residual feed intake in sheep, characterized in that, The PCR primer pair comprises M-F as shown in SEQ ID NO. 2 and M-R as shown in SEQ ID NO. 3, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein W at position 180 represents A or T, and the mutation results in an A / T polymorphism of the molecular marker, and the residual intake of sheep carrying TT genotype is significantly lower than that of sheep carrying AA genotype.

4. Use of a method for detecting a molecular marker related to residual intake of sheep in detection of residual intake of sheep, which comprises the following steps: S1, using the PCR primer pair comprising M-F as shown in SEQ ID NO. 2 and M-R as shown in SEQ ID NO. 3, or the KASPar primer pair comprising forward primer A1 as shown in SEQ ID NO. 4, forward primer A2 as shown in SEQ ID NO. 5 and universal reverse primer C as shown in SEQ ID NO. 6, or using a kit comprising the aforementioned primers, to amplify the genomic DNA of sheep; S2, identifying the polymorphism at position 180 shown in SEQ ID NO. 1 in the sequence of the amplification product obtained in step S1; The nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, wherein W at position 180 represents A or T, and the mutation results in an A / T polymorphism of the molecular marker, and the residual intake of sheep carrying TT genotype is significantly lower than that of sheep carrying AA genotype.

5. Use according to claim 4, characterized in that, The method for identifying the polymorphism in step S2 is sequencing, fluorescence probe, gene chip or high-resolution melting curve.

6. Use according to claim 4, characterized in that, When the KASPar primer pair is used for PCR amplification, the genotyping result is determined by detecting the fluorescence signal after the amplification is completed.

7. The use of a primer pair for detecting a molecular marker associated with residual feed intake in sheep, or a kit containing the aforementioned primer pair, or a method for detecting a molecular marker associated with residual feed intake in sheep in sheep breeding, characterized in that, The breeding purpose is to select low residual intake type sheep, the nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1, wherein W at the 180th position represents A or T, the mutation leads to A / T polymorphism of the molecular marker, and the residual intake of sheep carrying TT genotype is significantly lower than that of sheep carrying AA genotype.

Images