Kit for detecting fusarium verticillium resistance related molecular marker and application thereof

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to a kit for detecting fusarium verticillioides resistance related molecular markers and application of the kit. The kit comprises primers as shown in SEQ ID NO.2 and SEQ ID NO.3. The invention also relates to a kit for detecting fusarium verticillioides resistance related molecular markers and application of the kit for detecting fusarium verticillioides resistance related molecular markers. According to the invention, the direct association between the InDel marker in the promoter region of the GRMZM2G409430 gene and the resistance of the intraspecific fusarium verticillioides is determined for the first time. On the basis of the molecular marker, a molecular marker primer with high specificity and high stability is developed, and the molecular marker is taken as a target spot to carry out PCR (Polymerase Chain Reaction) so as to detect different inbred lines; the size of a PCR product of the molecular marker is used for analysis, and the resistance of the corn to fusarium verticillium and / or fusarium ear rot is judged. Based on the kit, a simple, convenient and rapid detection system is established and can be used for large-scale corn germplasm resource screening.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to a kit for detecting molecular markers related to resistance in Fusarium verticillatum and its application. Background Technology

[0002] Corn is the most widely planted grain crop in my country, with an annual planting area exceeding 40 million hectares, playing a vital role in national food security and livestock farming. In recent years, systemic diseases caused by Fusarium, such as ear rot, stalk rot, and seedling blight, have continued to spread in my country's main corn-producing areas, becoming a major biological stress affecting corn production. Among them, Fusarium verticillata (… Fusarium verticillioides As a major seed-borne pathogenic fungus in the Huang-Huai-Hai region, its latent infection characteristics pose a serious threat to seed quality and safety. This pathogen has two significant characteristics: first, its infection range is wide; field surveys show that this pathogen can be detected in over 90% of maize plants; second, latent infection is widespread, with the rate of asymptomatic grains carrying the pathogen significantly higher than the incidence of overt diseases. This covert infection pattern leads to multiple harms: it directly causes decreased seed viability and mold growth during storage, and it also becomes the primary source of infection for diseases such as root rot and stem rot in the following year, causing yield losses of 15% to 30%. More seriously, the fumonisin it produces is highly carcinogenic, posing a potential risk to human and animal health.

[0003] While current chemical control methods are effective against surface pathogens, their effectiveness against Fusarium verticillatum colonizing seed interiors is limited. Existing resistant varieties lack sufficient resistance to seed-internal pathogens, primarily due to difficulties in screening resistant germplasm resources and insufficient research on related genetic mechanisms. Current technologies for identifying resistance to Fusarium verticillatum in maize seeds mainly rely on traditional phenotypic identification methods. These methods typically require complex artificial inoculation in the field or laboratory, followed by observation of seed disease through in vitro culture after seed maturity, and then manual grading based on phenotypic indicators such as the degree of mold growth and mycelial expansion. These methods have the following significant drawbacks: lengthy identification cycle, cumbersome procedures, low throughput and high labor costs, results easily affected by environmental and subjective factors, insufficient repeatability and stability, and inability to achieve early screening, limiting it to later stages of growth or the seed stage, which fails to meet the demands of modern breeding for rapid, early screening of large-scale germplasm resources. Therefore, developing a detection technology that can rapidly and accurately identify resistance during the seedling or early developmental stages without relying on complex phenotypic identification is crucial for overcoming the bottleneck in breeding maize resistant to Fusarium wilt. Summary of the Invention

[0004] The purpose of this invention is to provide a kit for detecting molecular markers related to resistance to Fusarium verticillatum, which solves the problem of the lack of efficient and accurate molecular marker detection methods in the prior art, making it difficult to quickly screen maize germplasm resources resistant to Fusarium verticillatum.

[0005] The technical solution adopted in this invention is: The present invention provides a kit for detecting molecular markers related to resistance in Fusarium verticillatum, the kit comprising primers shown in SEQ ID NO.2 and SEQ ID NO.3.

[0006] Preferably, the kit further comprises KOD FX Neo high-fidelity polymerase.

[0007] The present invention also provides an application of the kit, wherein the application refers to at least one of the following: 1) To detect or assist in the detection of maize's resistance to Fusarium verticillatum; 2) To detect or assist in the detection of maize's resistance to Fusarium ear rot; 3) Marker-assisted breeding of maize.

[0008] Preferably, the Fusarium ear rot is at least one of ear rot, stem rot and seedling blight.

[0009] Preferably, the method for detecting maize's resistance to Fusarium verticillatum is as follows: Extract DNA from the corn to be tested; Using maize DNA as a template, PCR amplification was performed using the kit described above to obtain PCR products; Electrophoresis was performed on the PCR products, and the band size was used to determine whether the maize sample had resistance to Fusarium verticillatum. When the PCR product band size is 1250bp, the maize to be tested is a Fusarium verticillata resistant material; when the PCR product band size is 600bp, the maize to be tested is a Fusarium verticillata susceptible material.

[0010] Preferably, the PCR amplification system is as follows: 10 μL KOD FX Neo MIX; 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, 1 μL corn DNA, and 7 μL H2O.

[0011] Preferably, the PCR amplification procedure is as follows: Pre-denaturation at 98℃ for 3 minutes; Denaturation at 98℃ for 10 seconds, annealing at 55℃ for 5 seconds, extension at 68℃ for 10 seconds, for a total of 35 cycles; Extend the heat to 68°C for another 10 minutes.

[0012] Preferably, the corn DNA is derived from corn at the three-leaf stage.

[0013] Compared with the prior art, the beneficial effects of the present invention are: This invention provides a kit for detecting molecular markers associated with resistance to *Fusarium verticillatum*, comprising primers shown in SEQ ID NO.2 and SEQ ID NO.3. This invention is the first to clearly demonstrate the direct association between an InDel marker in the promoter region of the GRMZM2G409430 gene and intraspecific *Fusarium verticillatum* resistance. The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.4. Addressing the limitations of existing methods for identifying *Fusarium verticillatum* resistance in maize, which are time-consuming, cumbersome, have low throughput, and cannot detect resistance at an early stage, this invention is the first to discover and verify an InDel molecular marker significantly associated with intra-seed resistance, and based on this, developed specific primers and a matching detection system. This technology can rapidly and accurately determine genotypes at the three-leaf stage of maize through PCR and electrophoresis, achieving early, non-destructive, and high-throughput resistance screening. It overcomes the shortcomings of traditional methods, such as reliance on phenotypic observation, low efficiency, and strong subjectivity, providing a stable, reliable, and easily scalable solution for molecular breeding and germplasm resource identification of maize resistant to *Fusarium verticillatum*. Attached Figure Description

[0014] Figure 1 Linkage analysis identified QTLs associated with intraspecific Fusarium resistance phenotypes.

[0015] Figure 2 GWAS was used to identify SNP variants associated with intraspecific Fusarium varietal resistance phenotypes.

[0016] Figure 3 Single-gene association analysis of SNPs in the GRMZM2G409430 gene region with intraspecific resistance to Fusarium verticillatum.

[0017] Figure 4 Intraspecific resistance haplotype analysis of Fusarium verticillatum based on the GRMZM2G409430 gene with significant SNPs.

[0018] Figure 5 Intraspecific single-gene association analysis of resistance in Fusarium verticillatum with InDel variant of the GRMZM2G409430 gene promoter.

[0019] Figure 6 Intraspecific resistance haplotype analysis of *Fusarium verticillatum* with InDel variant of the GRMZM2G409430 gene promoter.

[0020] Figure 7 : Dual-fluorescence reporter system was used to identify functional variations in the InDel promoter of the GRMZM2G409430 gene.

[0021] Figure 8 Differences in expression levels of GRMZM2G409430 in different inbred lines.

[0022] Figure 9 This invention presents the results of genotyping different maize inbred lines using InDel molecular markers. Detailed Implementation

[0023] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0024] The inventive concept of this invention is as follows: Insertion-deletion polymorphism (InDel) is a prevalent form of genetic variation in the genome, characterized by nucleotide insertions or deletions at specific genomic loci among individuals. In maize populations, this variation exhibits high polymorphism, with obvious vacancy features observable through sequence alignment. As a representative of second-generation molecular marker technology, InDel markers are developed based on specific primers designed from conserved sequences flanking these insertion / deletion sites, generating length polymorphic fragments via PCR amplification. Rapid and accurate genotyping can be achieved using conventional agarose gel electrophoresis or capillary electrophoresis, with highly reproducible and stable genotyping results. Compared to other molecular markers, InDel markers have become an indispensable tool in modern crop genetic research due to their clear co-dominant genetic characteristics and ease of detection. In maize genetic improvement practices, InDel markers can be used not only for gene mapping of important agronomic traits and marker-assisted selection, but also for providing high-quality genotypic data for genome-wide association studies, significantly improving breeding efficiency and selection accuracy. Currently, with the development of high-throughput sequencing technology, the development of InDel markers at the whole genome level has provided a richer resource of molecular tools for maize genetic research.

[0025] To address the technical bottleneck of complex and time-consuming identification of resistance to Fusarium verticillatum within maize seeds, this invention innovatively develops a rapid early identification method based on molecular markers. The core of this method lies in the first identification and verification of a functional InDel marker that is significantly associated with intraspecific Fusarium verticillatum resistance. This marker is located in the promoter region of the GRMZM2G409430 gene, and its nucleotide sequence is shown in SEQ ID NO.1 (underlined part), consisting of 659 nucleotide pairs, located at position Chr3_196866135 in the B73 V2 reference genome.

[0026] Based on this important discovery, this invention further designed and developed a specific primer set, SEQ ID NO.2 and SEQ ID NO.3, which can specifically amplify the key region upstream of the ATG start codon of this gene. By analyzing the size difference of PCR products using conventional agarose gel electrophoresis, it is possible to quickly and accurately determine whether maize inbred lines carry this resistance marker, thereby achieving early screening of resistant germplasm resources.

[0027] The establishment of this innovative molecular marker technology overcomes the technical limitations of traditional intraspecific Fusarium resistance identification methods, which suffer from long cycles and low efficiency, providing a novel molecular tool for breeding intraspecific Fusarium resistance in maize. Compared with existing technologies, this invention has the following significant advantages:

[0028] 1) The direct association between the InDel marker in the promoter region of the GRMZM2G409430 gene and intraspecific resistance to Fusarium verticillatum was first clearly established; 2) A molecular marker primer with high specificity and stability was developed, and different inbred lines were detected using this molecular marker. The PCR products based on this molecular marker have a large size difference: the fragment containing the InDel marker is about 1250 bp, and the fragment without the InDel marker is about 600 bp. The comparison is obvious and the results are easy to judge.

[0029] 3) A simple and rapid detection system has been established, which is suitable for large-scale germplasm resource screening.

[0030] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, all reagents used in this invention are commercially available, and all methods used are conventional techniques in the art.

[0031] Example 1 The kit for detecting molecular markers related to resistance in Fusarium verticillatum and its applications are as follows: To address the complex technical challenges of identifying resistance to *Fusarium verticillatum* within maize seeds, this invention develops a molecular marker-based early screening method to significantly improve the breeding efficiency of resistant germplasm resources. To achieve this goal, this invention identifies a functional InDel marker significantly associated with *Fusarium verticillatum* resistance within maize seeds. This marker is located in the promoter region of the GRMZM2G409430 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1. The underlined portion represents the functional InDel marker significantly associated with *Fusarium verticillatum* resistance within maize seeds, consisting of 659 nucleotide pairs, specifically shown in SEQ ID NO. 4, located at position Chr3_196866135 in the B73 V2 reference genome. The development process and application scheme of this molecular marker will be described in detail below.

[0032] SEQ ID NO.1: TGCGCGCATGATATGAAACGTTTTCGTGGACGTGCAATAGCCAGTGCATGAGTTGGTGTTGGGACTGGTGTCAAACGAATACGAGGAGGAGACGTCTGCTTCTATGCCCTCTGCCGAGAATGGGGTGGCGCAGAGGTGGAGG CATGAGGGGAGAGAAAAGAAGTATAATGTCGAACGAGGTGGTGACAACTGAGGCGATGACCATCATTATCGTGCGGAGGTATAGATGGTCAAATGGACGGTGTCTAGCGAGCCGGCACGAGACACGACCCATTTAATAGT GCCTGAGCCAACCCGACATGAGTGTTGTGCGGTGTTTGGGTCGTAGCCTCAGCCTCCGACACGATTTTTTTTTTAAAAAAATCATATATATATATATATACATATATACAATTTATATTCAATATTATAAGCAACTGAGCAT GATGTTCTAGTGGTTAGACAATTTTGCCCAGTATTTTTCACCTTTCTTCCATCAGGGTTGAGTTCAAACCTCACCTGCTGCATCGGCTTTTAAATATTTACGCTTAGTTAATTTAGAAGAAATGTAGAGACTTTTTTTAAA GATGATGTAGGACGACCGCTGAACGTTGAAAC TGGTGCTTTAAGTATAGTTAAGGGCCTGTTTGTTTACCCCATGGATTATATAATCTAAATTATTTTTGGAGGATTA TATAATCTGGATTATATAATCTAGATTATATAATCTGAGTAGTCCTGTTTGTTTACCCAGATTATTTGAGTTGTTA ATAGAATTCTTTTGTATGAGGAAGACAACAATACCCTCTATATTTGTACTAGGTTGAAACTCATATATGAGATGAA CAATGTAACAAACGTTTCTGAGTATTCATAATTTATTACATAAATAATTTGAAAAAAAATAATTCAATTGATATTG GCAAATATTGCATTAGCAATATTATCACGGAAGGCATTCATGTCACCTTCTTCATCCAAGGAAAAAACGATTCAGTGGATTATAATGGCAATGGTGGGTAATTTCTAGGAAACTTGAAAGAGTAGTGGGAAAGTGGGAAAAAATAATCTGAA ATAAGCACCTTCTCACTTGCTTATGGATTATCATAATCTAAGGGGTTAGATTATATAATCTGGGCAAATAAGCTGG ACTGTTTGTTTGCCTCTTAGGATTATTTAATCTAGATTATATAATCTAGGGGGTAAACAAACAGGCCCTAAGTATA GTATAGATTTTATGAAGTC AAGATGACGAATTACAAAAGTGCGACACATTGTTTG。

[0033] SEQ ID NO.4: GATGATGTAGGACGACCGCTGAACGTTGAAACTGGTGCTTTAAGTATAGTTAAGGGCCTGTTTGTTTACCCCATGGATTATATAATCTAAATTATTTTTGGAGGATTATATAATCTGGATTATATAATCTAGATTATATAATCTGAGTAGTCCTGTTTGTTTACCCAGATTATTTGAGTTGTTAATAGAATTCTTTTGTATGAGGAAGACAACAATACCCTCTATATTTGTACTAGGTTGAAACTCATATATGAGATGAACAATGTAACAAACGTTTCTGAGTATTCATAATTTATTACATAAATAATTTGAAAAAAAATAATTCAATTGATATTGGCAAATATTGCATTAGCAATATTATCACGGAAGGCATTCATGTCACCTTCTTCATCCAAGGAAAAAACGATTCAGTGGATTATAATGGCAATGGTGGGTAATTTCTAGGAAACTTGAAAGAGTAGTGGGAAAGTGGGAAAAAATAATCTGAAATAAGCACCTTCTCACTTGCTTATGGATTATCATAATCTAAGGGGTTAGATTATATAATCTGGGCAAATAAGCTGGACTGTTTGTTTGCCTCTTAGGATTATTTAATCTAGATTATATAATCTAGGGGGTAAACAAACAGGCCCTAAGTATAGTATAGATTTTATGAAGTC。

[0034] 1. Genetic analysis population.

[0035] The present invention has established two genetic population systems: First, based on 114 maize inbred lines from temperate, tropical, and subtropical regions with different genetic backgrounds such as CIMMYT, Reid, P Group, and TSPT, an association analysis population with extensive genetic variation was established. Second, through the hybridization of the disease-resistant material BT-1 and the susceptible material Xi502, a recombinant inbred line population containing 250 families was cultivated by continuous self-pollination for 10 generations using the single-seed method, providing a material basis for subsequent QTL fine mapping.

[0036] 2. Experimental methods.

[0037] 2.1 Field trial design.

[0038] The experiment was conducted simultaneously in two ecological zones in Henan Province in 2019. A randomized complete block design was adopted, with two biological replicates for each population. Each replicate was planted in two rows, with a row length of 3 meters and a row spacing of 50 centimeters, and 12 plants per row. Field management measures included conventional fertilization, irrigation, and weed control. All materials underwent artificial controlled pollination, and 15 days after pollination, ears were inoculated with Fusarium verticillatum to introduce the fungus into the maize seeds.

[0039] 2.2 Inoculate with Fusarium verticillatum.

[0040] Using laboratory-preserved Fusarium pseudomorpha ( Fusarium verticillioides The pathogen was first inoculated onto potato dextrose agar (PDA) medium for activation culture. After the colonies had filled the culture dishes, they were stored at 4°C for later use. To obtain a large number of spores for inoculation, the pathogen was further propagated on corn medium (CSM) before field planting to promote the production of microspores.

[0041] The *Fusarium verticillioides* used in this invention is disclosed in the reference: Genetic variation in ZmWAX2confers maize resistance to *Fusarium verticillioides*.

[0042] The preparation method of the culture medium used is as follows: (1) Preparation of PDA culture medium.

[0043] 1) Raw material processing: Select 200g of fresh, unsprouted potatoes, peel and rinse them, then cut them into 1cm pieces. 3 Add 1L of distilled water to the block and simmer over low heat for 20 minutes. Filter the solution twice using 8 layers of sterile gauze and collect the filtrate in a 2000ml beaker.

[0044] 2) Culture medium preparation: Add 20g of anhydrous glucose to the filtrate and stir magnetically until completely dissolved. After the solution temperature drops to 60℃, dispense into three 500ml Erlenmeyer flasks, adding 5g of agar powder to each. Seal with double-layer breathable sealing film.

[0045] 3) Sterilization: Autoclave at 121℃ for 30 minutes. After sterilization, cool to 60℃ and dispense into 9cm petri dishes in a laminar flow hood. After complete solidification, seal the edges with sealing film. The prepared culture medium must be tested for sterility for 48 hours before use, or stored at 4℃ for later use.

[0046] (3) Standard for preparation of corn culture medium.

[0047] 1) Raw material pretreatment: Weigh 1000g of plump corn kernels, rinse them 3 times with tap water, and then rinse them 2 times with distilled water. Add 3L of distilled water and heat in a boiling water bath for 1.5h.

[0048] 2) Dispensing and Sterilization: After draining the water, dispense quantitatively into 500ml Erlenmeyer flasks, 200ml / flask. Seal with double-layer breathable sealing film and autoclave at 121℃ for 30 minutes. After sterilization, leave at room temperature for 48 hours for sterility testing.

[0049] The preserved Fusarium pseudocortex was inoculated onto fresh PDA medium and incubated in the dark at 28°C for 7 days. After the colonies covered the entire culture dish, it was transferred to a 4°C refrigerator for storage.

[0050] Inside a clean bench, two 1cm × 1cm freshly cultured colony blocks were inoculated into corn culture medium, thoroughly mixed, and incubated in the dark at 28℃ for 10 days. Spores were collected by rinsing with sterile deionized water, filtered through eight layers of sterile gauze, and the spore concentration was adjusted to 5 × 10⁻⁶ using a hemocytometer. 6 1 cell / mL, and add Tween-80 to a final concentration of 2 μL / mL for the following artificial inoculation.

[0051] The population materials were inoculated into the ears 15 days after artificial pollination. 2 mL of spore suspension was inoculated into the middle of each ear using the needle-pricking method. The ears were harvested 45 days after inoculation, air-dried, and then used for resistance identification against *Fusarium verticillatum*.

[0052] 2.3 Identification of intraspecific resistance traits in related populations and recombinant inbred lines.

[0053] After drying, seeds of related population materials and recombinant inbred lines were systematically sampled around the inoculation site. Ten outwardly healthy seeds were collected as test samples. After surface sterilization with a 10% sodium hypochlorite solution, the seeds were placed embryo-side down on moistened filter paper in a petri dish, sealed with sealing film, and incubated in the dark at 28°C for 5 days. Disease incidence was recorded, and the disease severity was classified into five levels: level 1, 3, 5, 7, and 9. Specific indicators were as follows:

[0054] Level 1: The number of diseased seeds per dish is less than 3, and the diseased area of ​​a single seed accounts for ≤25% of the total area of ​​the seed. The disease index is recorded as 1. Level 3: The number of diseased seeds per dish is less than 3, and the diseased area of ​​a single seed accounts for ≥25% of the total seed area; or, 3 seeds ≤ the number of diseased seeds per dish < 7 seeds, and the diseased area of ​​a single seed accounts for <50% of the total seed area; or the number of diseased seeds per dish is ≥ 7 seeds, and the diseased area of ​​a single seed accounts for <25% of the total seed area. The disease index is recorded as 3. Level 5: 3 ≤ number of diseased seeds per dish < 7 seeds, and 50% ≤ diseased area of ​​a single seed < 75% of the total seed area; or ≥ 7 diseased seeds per dish, and 25% ≤ diseased area of ​​a single seed < 50% of the total seed area, the disease index is recorded as 5; Level 7: 3 ≤ number of diseased seeds per dish < 7 seeds, and 75% ≤ diseased area of ​​a single seed < 100% of the total seed area; or 3 ≤ number of diseased seeds per dish ≥ 7 seeds, and 50% ≤ diseased area of ​​a single seed < 75% of the total seed area, the disease index is recorded as 7; Level 9: 3 ≤ number of diseased seeds per dish < 7 seeds, and the diseased area of ​​a single seed accounts for 100% of the total seed area; or ≥ 7 diseased seeds per dish, and 75% ≤ the diseased area of ​​a single seed accounts for 9% of the total seed area. The disease index is recorded as 9.

[0055] 2.4 Chain analysis.

[0056] Genotypic analysis of 250 recombinant inbred lines was performed using GenoBaits targeted gene capture technology developed by Shijiazhuang Moore Breeding Biotechnology Co., Ltd. The disease severity of these 250 recombinant inbred lines was converted to BLUE values ​​using QTL IciMapping software. Then, based on 6807 polymorphic SNP markers between the Xi502 and BT-1 parents, a high-density genetic linkage map was constructed using QTL IciMapping software. The inclusive composite interval mapping model of this software was used to identify QTLs associated with intraspecific Fusarium oxysporum resistance, with an LOD threshold set to 2.5. Figure 1As shown, a total of 4 QTLs were identified, including one located in the interval 196571484~197278216 on chromosome 3. qSFR3 It has the largest phenotypic contribution rate, at 11.28%. This interval is 706.7kb in length and contains 8 protein-coding genes.

[0057] 2.5 Genome-wide association analysis.

[0058] The incidence rate of the associated populations described in section 2.3 was converted to BLUE values ​​using QTL IciMapping software. Combined with high-density SNP molecular markers in the associated populations, genome-wide association analysis of phenotypic BLUE was performed using TASSEL 5.0 software with an MLM model. The allele frequency threshold was set to 0.05. p <10 -3 Horizontal qSFR3 The significance of the association between SNPs and traits within the interval was determined. The results showed that the most significant SNP was the one located at chr3_196866619 (see...). Figure 2 Its correlation with resistance to Fusarium verticillatum within the species was significant. p =1.14×10 -4 The allele is G / C, located on the first exon of the GRMZM2G409430 gene, but it does not cause an amino acid change. (See results below.) Figure 3 Two homozygous genotypes, GG and CC, were found in the inbred lines of the tested population. Haplotype analysis showed that variation at this locus was significantly associated with intraspecific resistance to *Fusarium verticillatum*. (See [link to relevant documentation]). Figure 4 .

[0059] 2.6 Identification of functional variations in the InDel promoter of the GRMZM2G409430 gene As mentioned above, the region containing the GRMZM2G409430 gene is closely related to *Fusarium verticillatum* within the same species. To determine the functional variations of the GRMZM2G409430 gene, sequence analysis was performed on the promoter region of the GRMZM2G409430 gene from 112 accessions. Cloning and sequencing alignment revealed a 659 bp transposon insertion 155 bp upstream of the ATG translation initiation site (referencing the B73 genome) in the resistant materials, named InDel-155. Further linkage disequilibrium analysis showed a high degree of linkage between InDel-155 and the chr3_196866619 SNP site. Figure 5 Haplotype association analysis showed that the InDel-155 variant was highly correlated with intraspecific resistance phenotypes, see [link to relevant documentation]. Figure 6Given that this variant is located in the gene promoter region and is closely associated with the phenotype, it is speculated that InDel-155 may be a key functional variant that regulates the expression of the GRMZM2G409430 gene and affects disease resistance.

[0060] 2.7. Molecular marker development targeting the InDel-155 variant of the GRMZM2G409430 promoter.

[0061] Furthermore, to apply the mutation of the GRMZM2G409430 promoter to disease-resistant germplasm screening and genetic breeding, this invention designs specific primers targeting InDel-155 in the GRMZM2G409430 promoter region. The primer design is based on the following principles:

[0062] When a 659bp transposon insertion is present, the PCR amplification product is approximately 1250bp; while without the insertion, the product is approximately 600bp. The size of the PCR product can be determined by DNA agarose gel electrophoresis, which can then be used to determine whether the InDel-155 marker is present in maize inbred lines. The successful development of this marker provides a simple and reliable technical solution for large-scale screening of Fusarium oxysporum resistance germplasm resources.

[0063] The primer sequences are as follows: SEQ ID NO.2, forward primer: 5'-TGCGCGCATGATATGAAACG-3'; SEQ ID NO.3, reverse primer: 5'-CAAACAATGTGTCGCACTTTTG-3'.

[0064] 2.8. This invention also provides a method for identifying resistance to Fusarium verticillatum in maize inbred lines using the InDel-155 molecular marker, the specific steps of which are as follows: 2.8.1 Extracting genomic DNA from maize inbred lines, the specific procedure is as follows: (1) Using three-leaf stage seedlings of maize inbred lines as material, grind them into powder with liquid nitrogen, take an appropriate amount of powder and dispense it into 2mL centrifuge tubes, add 800μL of CTAB solution preheated at 65℃, and incubate in a 65℃ water bath for 60min. During this period, gently mix once every 10min to prevent the sample in the tube from agglomerating.

[0065] (2) After cooling to room temperature, add an equal volume of chloroform-isoamyl alcohol solution. The volume ratio of chloroform to isoamyl alcohol in the chloroform-isoamyl alcohol solution is 24:1. Gently invert and mix for 10 min, then centrifuge at 12000g for 10 min.

[0066] (3) Transfer 600 μL of the supernatant to a new 2.0 mL centrifuge tube. Add 1.5 μL of RNase at 10 mg / mL and incubate at 37 °C for 1 h.

[0067] (4) Add 600 μL of chloroform-isoamyl alcohol solution, shake manually up and down for 5 min, centrifuge at 12000 g / min at room temperature for 8 min.

[0068] (5) Aspirate 400 μL of the supernatant into a 1.5 mL centrifuge tube, add 400 μL of isopropanol, mix well, let stand at -20℃ for 30 min, and centrifuge at 12000 g / min for 8 min.

[0069] (6) Wash the precipitate twice with 75% ethanol, centrifuge at 12000g for 5 min, and discard the supernatant.

[0070] (7) After the DNA precipitate is dried, add 100 μL of deionized water to dissolve it and store at -20 ℃.

[0071] 2.8.2 PCR method.

[0072] Using the genomic DNA of the maize inbred line to be identified as a template, PCR amplification was performed using primers SEQ ID NO.2 and SEQ ID NO.3 to obtain PCR products, which were then subjected to agarose gel electrophoresis.

[0073] The amplification system consisted of: 10 μL KOD FX Neo MIX; 1 μL of 10 μM upstream primer, 1 μL of 10 μM downstream primer, 1 μL DNA template, and 7 μL H2O.

[0074] The amplification program was as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 55℃ annealing for 5 s, 68℃ extension for 10 s, for a total of 35 cycles; and 68℃ extension for another 10 min.

[0075] The agarose gel electrophoresis method is as follows: Weigh 2.5g of agarose and mix it with 100ml of electrophoresis buffer (TAE) and heat to dissolve. Cool to 60℃, add 10μL of nucleic acid dye, mix well, pour into a gel casting mold, and insert a comb to form sample wells. After the gel solidifies, add 2μL of 6× loading buffer to the PCR product and add it to the sample wells using a micropipette. Simultaneously, add a DNA molecular weight standard marker as a control. Set the voltage to 5V / cm to allow the DNA to migrate towards the anode in the electric field. Stop electrophoresis when the bromophenol blue migrates to 2cm from the gel front, and observe the DNA bands under a UV lamp.

[0076] 2.8.3 Result determination.

[0077] The resistance of maize inbred lines to Fusarium verticillatum in the seeds is determined according to the size of the PCR product in section 2.8.2: If the PCR product contains the InDel marker of Fusarium verticillatum in the maize species, that is, the size of the PCR band is about 1250 bp, then the maize inbred line has stronger resistance to Fusarium verticillatum in the seeds than maize materials whose PCR products lack the InDel marker of Fusarium verticillatum in the maize species.

[0078] 3. Verification of functional variations in the InDel promoter of the GRMZM2G409430 gene.

[0079] The InDel-155-deficient and InDel-155-containing promoters, GRMZM2G409430, were cloned from the genomic DNA of BT-1 (a highly resistant inbred line to Fusarium verticillatum) and Xi502 (a less resistant inbred line to Fusarium verticillatum), respectively. These promoters were then constructed into the pGreen0800II dual-luciferase reporter vector and transformed into mesophyll protoplasts of etiolated maize seedlings. The RLUC / FLUC ratio was used to reflect the promoter activity levels of different genotypes. The results showed that the InDel-155-deficient GRMZM2G409430 promoter sequence exhibited stronger transcriptional activity. Figure 7 .

[0080] Further, 20 inbred lines containing the InDel-155 marker in the GRMZM2G409430 promoter and 20 inbred lines without the InDel-155 marker in the GRMZM2G409430 promoter were selected. RNA was extracted from their seeds, and RT-qPCR experiments were performed using GRMZM2G409430-specific quantitative primers to compare the differences in GRMZM2G409430 expression levels among these inbred lines. The results showed that the expression level of GRMZM2G409430 in the inbred lines containing the InDel-155 marker was significantly lower than that in the inbred lines without the InDel-155 marker. (See [link to study]). Figure 8 .

[0081] The results above indicate that the InDel marker affects the gene expression level by controlling the transcriptional activity of the GRMZM2G409430 promoter, thereby regulating the resistance trait of Fusarium verticillatum within maize species.

[0082] 4. Application test of the InDel marker of the present invention in the resistance trait of Fusarium verticillatum in maize.

[0083] Eight samples were randomly selected from the linkage population. Specific primers (SEQ ID NO.2 and SEQ ID NO.3) were designed using the flanking ends of the region where the InDel marker was located. PCR amplification was performed using KOD FX Neo high-fidelity polymerase with genomic DNA as a template. The PCR products were subjected to 2% agarose gel electrophoresis. Electrophoresis was stopped when bromophenol blue migrated to 2 cm from the gel front, and the DNA bands were observed under UV light. The resistance of maize inbred lines to *Fusarium verticillatum* inside the seeds was determined based on the size of the PCR products.

[0084] like Figure 9 As shown, the PCR products of CNW031, CNW133, CML40, and CNW054 all contain the InDel marker of Fusarium verticillatum within the maize species, with PCR band sizes around 1250 bp; while the PCR products of CNW069, CNW070, CML497, and CML486 do not contain the InDel marker of Fusarium verticillatum within the maize species, with PCR band sizes around 600 bp.

[0085] The PCR results were consistent with the actual susceptibility / resistance results of CNW031, CNW133, CML40, CNW054, CNW069, CNW070, CML497, and CML486. This result indicates that the InDel marker can successfully genotype these eight intraspecific Fusarium oxysporum accessions with different resistance levels.

[0086] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0087] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. A kit for detecting molecular markers associated with resistance in Fusarium verticillatum, characterized in that, The kit contains primers shown in SEQ ID NO.2 and SEQ ID NO.

3.

2. The kit according to claim 1, characterized in that, The kit also contains KOD FX Neo high-fidelity polymerase.

3. The application of the reagent kit as described in claim 1, characterized in that, The application refers to at least one of the following: 1) To detect or assist in the detection of maize's resistance to Fusarium verticillatum; 2) To detect or assist in the detection of maize's resistance to Fusarium ear rot; 3) Marker-assisted breeding of maize.

4. The application as described in claim 3, characterized in that, The Fusarium rot is at least one of ear rot, stem rot, and seedling blight.

5. The application as described in claim 3, characterized in that, The method for detecting maize's resistance to Fusarium verticillatum is as follows: Extract DNA from the corn to be tested; Using maize DNA as a template, PCR amplification was performed using the kit described above to obtain PCR products; Electrophoresis was performed on the PCR products, and the band size was used to determine whether the maize sample had resistance to Fusarium verticillatum. When the PCR product band size is 1250bp, the maize to be tested is a Fusarium verticillata resistant material; when the PCR product band size is 600bp, the maize to be tested is a Fusarium verticillata susceptible material.

6. The application as described in claim 5, characterized in that, The PCR amplification system consisted of: 10 μL KOD FX Neo MIX; 1 μL 10 μM upstream primer; 1 μL 10 μM downstream primer; 1 μL corn DNA; and 7 μL H2O.

7. The application as described in claim 5, characterized in that, The procedure for PCR amplification is as follows: Pre-denaturation at 98℃ for 3 minutes; Denaturation at 98℃ for 10 seconds, annealing at 55℃ for 5 seconds, extension at 68℃ for 10 seconds, for a total of 35 cycles; Extend the heat to 68°C for another 10 minutes.

8. The application as described in claim 5, characterized in that, The maize DNA was derived from maize at the three-leaf stage.

Images