Stem tip stripping culture method for lilium lancifolium virus-free seedlings
By using gradient temperature stress and plant stress hormones for synergistic pretreatment, combined with RNA interference agents, the virus-free zone of the shoot tip meristem was expanded, resolving the contradiction between shoot tip size and virus-free survival rate, and achieving efficient virus-free and high-survival shoot tip peeling culture.
Patent Information
- Application Number
- CN202610082473.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-21
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies for shoot tip peeling culture struggle to maintain high detoxification and survival rates while increasing shoot tip size, and the lack of synergy among the steps leads to operational difficulties and poor results.
A synergistic pretreatment of gradient temperature stress and plant stress-inducing hormones was employed, combined with a specific RNA interference agent, to expand the virus-free zone of shoot tip meristem. Systemic resistance of plants was activated through high-temperature → sub-high-temperature treatment and brassinolide oscillating culture, which was then combined with large-size shoot tip stripping and precise biological targeting treatment.
While ensuring a high detoxification rate, it significantly improves the success rate and survival rate of stem tip peeling, reduces operational difficulty, and allows the stem tip size to reach 0.8-1.2mm. The detoxification rate is stable at over 95%, the survival rate is over 85%, the amount of chemical reagents used is reduced, and the plant grows vigorously.
Smart Images
Figure CN121667102A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant biotechnology, specifically to a method for stem tip peeling culture of virus-free seedlings of Lilium tigrinum. Background Technology
[0002] Lilium tigrinum is an important ornamental, edible, and medicinal plant, but its production is often restricted by various viral infections, such as Cucumber Mosaic Virus (CMV), Lily Asymptomatic Virus (LSV), Lily Mottle Virus (LMoV), and Lily X Virus (LRV). Viral infection can lead to stunted plant growth, reduced quality, and lower yield.
[0003] Currently, the main method used in production is heat treatment combined with shoot tip culture to obtain virus-free seedlings. This method utilizes the different tolerances of viruses and plant cells to high temperatures, and the characteristic that shoot tip meristems (0.1-0.3 mm) typically contain no virus or have extremely low virus concentrations. However, existing technology presents a significant contradiction: smaller shoot tip sizes result in higher virus elimination rates, but also increase operational difficulty and lower explant survival rates; conversely, increasing shoot tip size improves survival rates, but significantly reduces the virus elimination rate.
[0004] Current technologies typically employ single, constant heat treatment conditions. For example, one study treated bulbils of *Lilium tigrinum* at 38°C for 20 consecutive days, then harvested stem tips of 0.4-0.6 mm in size, adding 10 mg / L ribavirin to the culture medium as a comprehensive approach to balance survival and virus elimination rates. Another study used alternating high and low temperatures of 38°C and 4°C to treat bulbils, then directly harvested large stem tips of 1.0-1.5 mm for cultivation. While the seedling survival rate reached 90%, the virus elimination rates against LMoV and LSV were only 86% and 88%, respectively. Another method used 36°C pretreatment for 10 days before harvesting 0.2 mm stem tips, achieving 100% virus elimination against specific viruses, but it did not mention survival rates, and the extremely small stem tip size made the operation extremely difficult. None of these methods have solved the technical bottleneck of simultaneously and significantly improving virus elimination and survival rates while significantly increasing the difficulty of stem tip harvesting. Furthermore, the steps in existing technologies, such as heat treatment, chemical reagent treatment (e.g., ribavirin), and shoot tip stripping, are mostly simple superpositions, lacking organic synergy between the steps, and failing to stimulate the systemic resistance of plants as a whole to expand the range of virus-free zones. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a method for stem tip peeling and culture of virus-free Lilium tigrinum seedlings. Through a combination of physical and biological pretreatment methods, the effective size of the stem tips that can be used for efficient virus-free culture is significantly expanded. This greatly improves the success rate of stem tip peeling and the survival rate of in vitro culture while ensuring a high virus-free rate, thus resolving the contradiction in existing technologies where small stem tips are difficult to survive and large stem tips are not virus-free.
[0006] To achieve the above objectives, the present invention provides the following technical solution: a method for stem tip peeling culture of virus-free Lilium tigrinum seedlings, comprising the following steps performed in sequence: (1) Pretreatment: Take the virus-infected explants of Lilium tigrinum and first subject them to the first high temperature stress treatment. Then, transfer them to sub-high temperature conditions and use a pretreatment medium containing plant stress-inducing hormones for shaking culture. (2) Stem tip stripping: After the pretreatment in step (1), the stem tip meristem with a size of 0.8-1.2 mm is stripped; (3) Induction culture: The shoot tip meristem stripped in step (2) is inoculated onto a solid induction culture medium and cultured in the dark until callus formation is achieved. The solid induction culture medium contains cytokinins and antiviral compounds. (4) Differentiation and rooting culture: The callus tissue was transferred into differentiation culture medium and rooting culture medium and cultured sequentially to obtain complete virus-free plants.
[0007] Preferably, in step (1), the temperature of the first high-temperature stress treatment is 38-40℃ and the treatment time is 3-7 days; the temperature of the sub-high temperature condition is 32-35℃ and the shaking culture time is 7-15 days.
[0008] Preferably, the plant stress-inducing hormone is brassinolide (BR), and the concentration in the pretreatment medium is 0.01-0.1 mg / L; the pretreatment medium is 1 / 2 MS liquid medium with 20-30 g / L of sucrose added.
[0009] Preferably, in step (3), the cytokinin is thiamethoxam (TDZ) with a concentration of 0.5-2.0 mg / L; the antiviral compound is ribavirin with a concentration of 2-5 mg / L; and the solid induction medium is MS-based medium with 0.5-1.0 mg / L of naphthaleneacetic acid (NAA) added.
[0010] Preferably, in the initial stage of dark culture in step (3), the solid induction medium also contains a specific RNA interference (RNAi) agent for common lily viruses; the common lily viruses include at least one of cucumber mosaic virus (CMV), lily asymptomatic virus (LSV), and lily mottle virus (LMoV).
[0011] Preferably, in the initial stage of dark culture in step (3), the solid induction medium also contains a specific RNA interference (RNAi) agent for common lily viruses; the common lily viruses include at least one of cucumber mosaic virus (CMV), lily asymptomatic virus (LSV), and lily mottle virus (LMoV).
[0012] The sense strand segment targeting the LMoV coat protein gene is: ATGGCGAGTACAAAGACAAGGCTCTCAACCATGGAGAGAAGATCCGCGACAACCTCAAGTCCA AGGTGACCGGTGTCAACTCCTCCGGCATCAACGGCACCATCAAGAAGTTCTCCGGCGACAAGA AGGCCAAGTTCTTCCGCAACTCCAAGGGCGCCAAGGCCAAGGTGATCAACGTCAACACCGGCA AGGCCAAGAAGAACCTCAAGGCCAAGGTCAAGGTCAAGGGCATCAAGGCCAAGGCCAAGGCCA AGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGG CCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCCAAGGCC.
[0013] Compared with existing technologies, this invention provides a method for shoot tip peeling culture of virus-free *Lilium tigrinum* seedlings, which has the following beneficial effects: Through gradient temperature stress (high temperature → sub-high temperature) and the induction of specific stress hormones (BR), a deep synergistic effect in terms of temporal and physiological functions is achieved, thereby regulating the overall physiological state of the explants during pretreatment. Short-term high temperature stress initially inactivates virus activity, while subsequent sub-high temperature and BR synergy focus on activating defense pathways such as systemically acquired resistance (SAR) within the plant, biologically expanding the virus-free or low-virus concentration zone near the shoot tip meristem.
[0014] This invention allows for the successful peeling and cultivation of large-sized shoot tips (0.8-1.2 mm), significantly larger than the 0.1-0.6 mm required by conventional virus elimination methods. This greatly reduces the technical difficulty of the peeling operation and the skill requirements for the operator. Despite this large size, the overall virus elimination rate (against multiple viruses such as CMV, LSV, LMoV, and LRV) of this invention remains consistently above 95%, while the initial survival rate of the shoot tips can reach over 85%, and the subsequent tissue culture seedlings grow robustly.
[0015] Because the pretreatment stage enhances the plant's own resistance, the dosage of chemical inhibitors such as ribavirin can be significantly reduced from the conventional 10 mg / L to 2-5 mg / L in the subsequent induction culture stage. This reduces the toxic effects of chemical reagents on plant cells and is beneficial for the regeneration and robust growth of plants in the later stages.
[0016] By introducing RNAi agents targeting specific viral gene sequences as an optional step, this invention provides an enhanced dimension of precise biological targeting. This approach organically combines precise molecular biological intervention with traditional tissue culture techniques. Attached Figure Description
[0017] Figure 1 This is a schematic diagram of the process flow of the present invention. Detailed Implementation
[0018] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0019] Please see Figure 1 This invention provides a technical solution for the stem tip peeling culture method of virus-free Lilium tigrinum seedlings: It should be noted that the plant stress-inducing hormones mentioned here specifically refer to natural or synthetic substances that can systematically activate plant innate immune or stress response signaling pathways (such as salicylic acid, jasmonic acid / ethylene, or brassinolide pathways). Their core function is to synergize with gradient temperature stress to pretreat explants physiologically, expanding the effective non-toxic area of the shoot apical meristem. In addition to the brassinolide specifically implemented in the examples, the specification should also list other optional substances such as salicylic acid and methyl jasmonic acid that can be used as subordinate implementations of this overarching concept, and clarify that their logic is consistent with the pretreatment steps of this invention.
[0020] The common lily viruses described in this invention refer to RNA viruses that are prevalent globally or in major lily-producing areas and pose a widespread economic threat to the production of lily tigrinum. Specifically, they include at least cucumber mosaic virus, lily asymptomatic virus, lily mottle virus, and lily X virus.
[0021] The purpose of the shaking culture here is to ensure continuous and uniform contact between the stress-inducing hormones (such as BR) in the liquid culture medium and the explant surface and micro-wounds under sub-high temperature conditions, while promoting the diffusion of explant metabolic waste and avoiding local anaerobic environments, thereby maximizing the effect of hormone-induced resistance. This explanation closely integrates shaking culture with sub-high temperature and hormone treatment, demonstrating the organic synergy between the steps, rather than a simple additive process.
[0022] The gradient high-temperature stress of this invention is a preliminary physical passivation step, while the subsequent sub-high temperature combined with hormone-induced oscillation culture is a deep biological induction step. The two are closely linked and inseparable in terms of timing and function, jointly serving the core objective of expanding the effective shoot tip size. The subsequent large-size shoot tip stripping and induction culture containing specific growth regulators are both necessary choices and optimized complements based on this unique pretreatment.
[0023] Unless otherwise specified, all the following embodiments and comparative examples use the same basic materials and methods: Plant material: healthy bulbils of Lilium tigrinum collected from the same infected field and confirmed by RT-PCR to be co-infected with Cucumber Mosaic Virus (CMV), Lily Mottle Virus (LMoV) and Lily X Virus (LRV).
[0024] Explant disinfection: The bulbils were rinsed with running water for 30 minutes, soaked in 75% ethanol for 30 seconds, disinfected with 0.1% HgCl2 solution for 10 minutes, rinsed with sterile water 5 times, and then dried with sterile filter paper for later use.
[0025] Culture conditions: Except for the pretreatment stage, the culture temperature was 25±1℃, the photoperiod was 16h light / 8h dark, and the light intensity was 40μmol·m⁻¹. -2 ·s -1 .
[0026] Detection method: During the rooting stage of tissue culture seedlings (approximately 90 days after culture), individual plants were tested for CMV, LMoV, and LRV using RT-PCR. Overall virus elimination rate = (Number of plants negative for all three viruses / Total number of plants tested) × 100%.
[0027] Example 1: Synergistic pretreatment: Disinfected bulbils were placed in a 38°C incubator for 5 days (first high-temperature stress). They were then transferred to a constant-temperature shaker at 32°C and 100 rpm and cultured for another 10 days in 1 / 2 MS liquid medium (25 g / L sucrose) containing 0.05 mg / L brassinolide (BR).
[0028] Shoot tip dissection: Under a clean bench and a stereomicroscope, approximately 1.0 mm of shoot tip meristem tissue was dissected.
[0029] Induction and regeneration: Shoot tips were inoculated onto solid induction medium (MS + 1.0 mg / L LTDZ + 0.8 mg / L NAA + 3 mg / L ribavirin + 30 g / L sucrose + 7 g / L agar, pH 5.8). After 4 weeks of dark culture, callus tissue formed, which was then transferred to differentiation medium (MS + 1.5 mg / L 6-BA + 0.1 mg / L NAA) and rooting medium (1 / 2 MS + 0.8 mg / L NAA) to complete plant regeneration.
[0030] Example 2 follows the same steps as Example 1, except that in step 2, approximately 0.8 mm of shoot tip meristem is peeled off.
[0031] Example 3 follows the same steps as Example 1, except that in step 2, approximately 1.2 mm of shoot tip meristem is peeled off.
[0032] Example 4 follows almost identical steps to Example 1, except that in step 3, double-stranded RNA (dsRNA) targeting the LMoV coat protein gene is added to a final concentration of 30 nM during the preparation of the solid induction medium. This dsRNA is encapsulated using a biodegradable liposome carrier to ensure its stability and efficient uptake by plant cells.
[0033] Comparative Example 1, Pretreatment: The pretreatment step was omitted. The sterilized bulbils were directly subjected to shoot tip stripping. Shoot tip stripping: Approximately 1.0 mm of shoot tip meristem was stripped (method as in Example 1). Induction and regeneration: The same solid induction medium and subsequent culture procedure as in Example 1 were used.
[0034] Comparative Example 2, Pretreatment: Traditional single heat treatment was used. Sterilized bulbils were placed in a 38°C incubator for 15 consecutive days (total treatment time equal to 5+10 days in Example 1), but without shaking culture and BR hormone. Shoot tip ablation: Approximately 1.0 mm of shoot tip meristem was ablated (method as in Example 1). Induction and regeneration: The same solid induction medium and subsequent culture procedures as in Example 1 were used.
[0035] Comparative Example 3, Synergistic Pretreatment: Exactly the same as Step 1 of Example 1. Shoot Tip Removal: Exactly the same as Step 2 of Example 1 (removing approximately 1.0 mm of shoot tip). Induction and Regeneration: Shoot tips were inoculated into conventional induction medium (MS + 1.0 mg / L 6-BA + 0.5 mg / L NAA + 10 mg / L ribavirin, other components the same as in Example 1). Subsequent differentiation and rooting steps were the same as in Example 1.
[0036] Test item definition and calculation formula Initial survival rate of shoot tips: measures the ability of the stripped shoot tip meristem to survive and initiate growth during the initial culture stage.
[0037] Calculation formula: Initial survival rate of shoot tips = (Number of explants that remain viable and show signs of growth after the specified number of days of inoculation and culture / Total number of explants initially inoculated) × 100%.
[0038] Callus induction rate: measures the ability of surviving shoot tip explants to successfully dedifferentiate and form callus tissue.
[0039] Calculation formula: Callus induction rate = (Number of explants that form typical callus at the end of the induction culture stage / Total number of explants initially inoculated) × 100%.
[0040] Overall virus elimination rate: measures the final effect of completely eliminating the specified virus species in the regenerated plants obtained after the entire culture cycle.
[0041] Calculation formula: Overall devirulence rate = (Number of plants that tested negative for all target viruses / Total number of regenerated plants tested) × 100%.
[0042] Detailed testing procedures and standards (a) Initial survival rate test of shoot tips Timing of testing: The detached shoot tip meristems were inoculated onto solid induction medium and cultured under standard culture conditions (25±1℃, dark culture) for 14 days before the first statistical analysis was performed.
[0043] Test steps: Observation should be conducted in a clean bench or sterile environment.
[0044] Examine each explant using a stereomicroscope (magnification 20-40x).
[0045] Criteria for survival: Explants should be bright green or pale yellowish-green in color, without browning or water-soaked rot, and with obvious swelling at the base or around the periphery or the formation of visible tiny callus protrusions. Explants that only slightly increase in size but are dull in color and show no structural changes are not considered to have survived.
[0046] Record the number of explants that meet the criteria and calculate according to the formula.
[0047] (ii) Callus induction rate test Testing timing: After completing the initial survival rate statistics of the shoot tips, continue the induction culture and conduct statistics from day 35 to day 42 after inoculation (i.e., about 5-6 weeks of culture).
[0048] Test steps: A preliminary judgment can be made by visual observation, and confirmation can be made with the help of a stereomicroscope if necessary.
[0049] Criteria for determining callus: New cell clusters with a diameter of not less than 1 mm, dense or loose structure, granular or nodular appearance, and milky white, pale yellow, or light green color, formed at the explant incision site or on the entire surface. Clusters with only basal swelling but lacking typical cell cluster structure are not considered.
[0050] Record the number of explants that form typical callus tissue and calculate according to the formula.
[0051] (III) Comprehensive Detoxification Rate Test Testing timing: Samples should be taken for testing when the tissue culture seedlings have grown in the rooting medium for more than 30 days and have 3-4 unfolded leaves and well-developed root systems.
[0052] Test steps: Sampling: Aseptically extract about 100 mg of fresh leaves from each seedling to be tested, place them in a labeled centrifuge tube, and use them immediately for testing or store them at -80℃.
[0053] Virus detection method: Reverse transcription polymerase chain reaction (RT-PCR).
[0054] RNA extraction: Use a commercially available plant total RNA extraction kit and follow the instructions.
[0055] Reverse transcription: RNA is reverse transcribed into cDNA using universal or random primers.
[0056] PCR amplification: Design specific primers targeting the conserved sequences of the target virus (such as CMV, LMoV, LRV). Use cDNA as a template and set up an independent PCR reaction system for amplification. A positive control (RNA from a known virus-carrying plant) and a negative control (RNA from sterile water and known virus-free seedlings) must be included.
[0057] Result interpretation: Perform agarose gel electrophoresis on the PCR products (usually 1.5-2% concentration) and observe under UV light.
[0058] Virus negative determination: No specific bands are found at the expected size of the target virus, and the internal reference gene (such as the plant housekeeping gene) amplifies normally. At the same time, the positive control shows a band and the negative control shows no band, which proves that the experimental system is effective.
[0059] Virus positivity determination: The appearance of a specific band of the expected size.
[0060] Comprehensive determination: Only plants with negative RT-PCR results for all target viruses are considered completely virus-free. If any virus test is positive, that plant is not counted in the virus-free success count. The overall virus-free rate is calculated using the formula.
[0061] It should be noted that the target gene is the lily mottle virus coat protein gene.
[0062] Target region: Select a conserved region of about 400 nucleotides in length in the gene to ensure effectiveness against different viral isolates.
[0063] Parallel experiments were conducted on Examples 1, 2, 3, and 4 and Comparative Examples 1, 2, and 3, with 30 explants treated in each group. The initial survival rate of shoot tips, callus induction rate, and overall detoxification rate at key stages were statistically analyzed. Detailed test results are shown in Table 1.
[0064] Table 1
[0065] The survival rate and virus elimination rate of Comparative Example 1 were extremely low, indicating that pretreatment is essential for shoot tips with a diameter of 1.0 mm. While Comparative Example 2 showed some effect, its performance indicators were significantly lower than those of Example 1, which employed the gradient temperature + BR synergistic pretreatment method of this invention. This demonstrates that the pretreatment scheme of this invention produces a significant synergistic gain effect, which cannot be achieved by a single heat treatment.
[0066] Example 2 achieved a 100% virus elimination rate using 0.8mm small stem tips, but the operation was extremely difficult. The present invention, by increasing the stem tip size to 1.0mm (significantly reducing operational difficulty), still maintains an extremely high virus elimination rate of 96.7% and a maximum survival rate of 95%. Example 3 shows that when the size is further increased to 1.2mm, the virus elimination rate begins to decrease, indicating that 1.0mm is the optimal range for balancing operability and virus elimination effect under this method.
[0067] Under the same pretreatment and shoot tip size, Comparative Example 3, which used a conventional induction medium, had lower callus induction rate and detoxification rate than the TDZ medium scheme optimized in this invention, and required a higher amount of ribavirin.
[0068] Example 4 adds targeted dsRNA to the core solution, successfully increasing the detoxification rate to 100% without significantly negatively impacting the survival rate, demonstrating the good compatibility and scalability of the present invention.
[0069] The above are merely specific embodiments of the present invention, but the technical features of the present invention are not limited thereto. Any simple changes, equivalent substitutions, or modifications made based on the present invention to solve essentially the same technical problems and achieve essentially the same technical effects are all covered within the protection scope of the present invention.
Claims
1. A stem tip stripping culture method of virus-free seedling of Lilium lancifolium, characterized by comprising the steps of: The method comprises the following steps in sequence: (1) Pretreatment: taking the virus-infected explants of Lilium lancifolium, first performing a first high-temperature stress treatment, then transferring into a sub-high-temperature condition, and performing oscillation culture using a pretreatment medium containing a plant stress resistance induction hormone; (2) Stem tip stripping: after the pretreatment in step (1), stripping the stem tip meristem with a size of 0.8-1.2 mm; (3) Induction culture: inoculating the stem tip meristem stripped in step (2) onto a solid induction medium containing a cytokinin and an anti-virus compound to perform dark culture until callus formation; (4) Differentiation and rooting culture: transferring the callus into a differentiation medium and a rooting medium to obtain complete virus-free plants in sequence.
2. The stem tip stripping culture method of the virus-free seedling of the Lilium lancifolium according to claim 1, characterized in that: In step (1), the temperature of the first high-temperature stress treatment is 38-40℃, and the treatment time is 3-7 days; the temperature of the sub-high-temperature condition is 32-35℃, and the oscillation culture time is 7-15 days.
3. The stem tip stripping culture method of the virus-free seedling of the Lilium lancifolium according to claim 2, characterized in that: The plant stress resistance induction hormone is brassinosteroid, and the concentration in the pretreatment medium is 0.01-0.1 mg / L; the pretreatment medium is 1 / 2MS liquid medium, and 20-30 g / L of sucrose is added.
4. The stem tip stripping culture method of the virus-free seedling of the Lilium lancifolium according to claim 1, characterized in that: In step (3), the cytokinin is thidiazuron, and the concentration is 0.5-2.0 mg / L; the anti-virus compound is ribavirin, and the concentration is 2-5 mg / L; the solid induction medium is an MS-based medium, and 0.5-1.0 mg / L of naphthaleneacetic acid is added.
5. The stem tip stripping culture method of the virus-free seedling of the Lilium lancifolium according to claim 4, characterized in that: In the initial stage of the dark culture in step (3), the solid induction medium further contains a specific RNA interference preparation against common viruses of lilies; the common viruses of lilies include at least one of cucumber mosaic virus, lily symptomless virus and lily mottle virus.
6. The stem tip stripping culture method of the virus-free seedling of the Lilium lancifolium according to claim 5, characterized in that: The specific RNA interference preparation is double-stranded RNA designed for the coding sequence of the coat protein gene of lily mottle virus, and the effective concentration is 10-50 nM.
7. A virus-free tissue culture plantlet of Lilium lancifolium, characterized in that, The virus-free Lilium lancifolium tissue culture seedlings are obtained by the method in any one of claims 1 to 6.
8. A method for producing virus-free seeds of Lilium lancifolium, which is characterized by, The virus-free Lilium lancifolium seedballs are obtained by taking the virus-free Lilium lancifolium tissue culture seedlings in claim 7 through seedling raising, transplanting to a greenhouse, and cultivating until the underground bulbs are swollen and matured.