Trichoderma asperellum SWU Y1-45 and application thereof
By using Trichoderma SWU Y1-45 and its derivatives, the problem of green prevention and control of Osmanthus root rot has been solved, achieving effective inhibition and control of a variety of plant diseases and promoting the environmentally friendly development of agricultural production.
Patent Information
- Application Number
- CN202511778396.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies lack efficient and green control measures for osmanthus root rot. Chemical pesticide control poses problems such as environmental pollution and increased pathogen resistance, and there are no effective biocontrol Trichoderma strains.
Using Trichoderma SWU Y1-45 and its fermentation broth and volatile metabolites, biological agents were prepared to inhibit plant pathogenic fungi such as Rhizoctonia solani, Fusarium, Coccidioides praecox, Anthracnose, and Diplosporium trichophyton to control root rot of Osmanthus fragrans, basal rot of Ginkgo biloba, anthracnose of Loquat, and stem rot of Loquat.
It has achieved highly efficient prevention and control of osmanthus root rot, ginkgo basal rot, loquat anthracnose, and loquat stem rot, and has broad application prospects in green agricultural production.
Smart Images

Figure CN121674227A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control technology, and more specifically, to a Trichoderma spp. SWU Y1-45 and its applications. Background Technology
[0002] Osmanthus fragrans( Osmanthus fragrans Osmanthus fragrans (Lour.) is an evergreen broad-leaved small tree or shrub belonging to the Oleaceae family. It has been cultivated in my country for over 2500 years, and there are more than 2600 ancient Osmanthus trees over 100 years old in my country. It possesses ornamental, medicinal, edible, economic, and cultural value. Root rot is a common fungal disease in Osmanthus cultivation, mainly caused by Fusarium spp. (…). Fusarium spp.), Rhizoctonia spp. ( Rhizoctonia Osmanthus root rot is caused by a pathogen (spp.), which can lead to root rot, weakened tree vigor, and even the death of the entire plant. It is a soil-borne disease, difficult to detect in its early stages, and by the time above-ground symptoms appear, the optimal treatment window has passed, potentially causing widespread plant death. In recent years, with the continuous expansion of osmanthus planting areas and the increased frequency of seedling transportation, the incidence and cross-regional spread of osmanthus root rot have also been increasing, seriously hindering the development of the osmanthus industry.
[0003] Currently, root rot in osmanthus trees is mainly controlled through agricultural and chemical methods, with commonly used chemical agents including difenoconazole and carbendazim. However, chemical pesticide control has problems such as environmental pollution, damage to soil microbiota, and increased pathogen resistance. Therefore, there is an urgent need to develop a green and efficient control measure. Trichoderma ( Trichoderma Trichoderma harzianum (spp.) is widely used in plant disease control due to its strong adaptability, high sporulation rate, and broad antibacterial spectrum. For example, Trichoderma harzianum (spp.) T. harziensis It can prevent and control tobacco phytoestrogens ( Phytophthora nicotianae Tobacco black shank caused by *Trichoderma yunnanense*; T. yunnanense F2 can effectively control anthracnose in tea trees. However, there is currently no highly effective biocontrol Trichoderma strain for osmanthus root rot. Summary of the Invention
[0004] The purpose of this invention is to provide a Trichoderma SWU Y1-45, which, along with its fermentation broth and volatile metabolites, exhibits good inhibitory effects on plant pathogenic fungi such as Dikaryotic Rhizoctonia, Fusarium, Coccidioides praecox, Anthracnose, and Dispora trichoderma, thus enabling highly efficient prevention and control of root rot in Osmanthus fragrans.
[0005] Another objective of this invention is to provide the application of the above-mentioned Trichoderma SWU Y1-45 and its fermentation broth and volatile metabolites in the preparation of biological agents, which can achieve the prevention and control of Ginkgo basal rot, loquat anthracnose and loquat stem rot.
[0006] The technical problem solved by this invention is achieved by the following technical solution.
[0007] On the one hand, embodiments of this application provide a Trichoderma SWU Y1-45, whose classification name is Trichoderma asperellum It was deposited on May 22, 2025 at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41950, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0008] Furthermore, the ITS rDNA sequence of the above-mentioned Trichoderma SWU Y1-45 is shown in SEQ ID NO: 1. Furthermore, the aforementioned Trichoderma SWU Y1-45 was isolated and purified from healthy roots of Osmanthus fragrans plants infected with root rot.
[0009] On the other hand, embodiments of the present invention provide the application of the above-mentioned Trichoderma SWU Y1-45 in the prevention and control of root rot in osmanthus.
[0010] On the other hand, embodiments of the present invention provide the application of the above-mentioned Trichoderma SWU Y1-45 in inhibiting fungal pathogens.
[0011] Furthermore, the aforementioned fungal pathogens are any one of Dinucleotidylcholine, Fusarium, Coccidioides imbricata, Anthrax, and Dispora trichophyton.
[0012] On the other hand, embodiments of the present invention also provide a biological agent comprising the above-mentioned Trichoderma SWU Y1-45; and / or, fermentation product of Trichoderma SWU Y1-45; and / or, volatile metabolites of Trichoderma SWU Y1-45.
[0013] Furthermore, embodiments of the present invention also provide the application of the above-mentioned biological agents in the prevention and control of Ginkgo basal rot; and / or, loquat anthracnose; and / or, loquat stem rot. Compared with the prior art, the embodiments of the present invention have at least the following advantages or beneficial effects: 1. The present invention provides a Trichoderma SWU Y1-45 strain, which has good inhibitory effects on Dikaryotic Rhizoctonia, Fusarium, Coccidioides imbricata, Anthracnose, and Dispora trichophyton, and can achieve the prevention and control of Osmanthus root rot, Ginkgo basal rot, Loquat anthracnose, and Loquat stem rot; 2. This invention also provides a biological agent prepared from Trichoderma SWU Y1-45 and / or its derivatives, which, when applied in practice, can effectively control root rot of Osmanthus fragrans, basal rot of Ginkgo biloba, anthracnose of Loquat, and stem rot of Loquat, and has broad application prospects in green agricultural production. Attached Figure Description
[0014] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.
[0015] Figure 1 This is a diagram showing the colony growth and morphological characteristics of Trichoderma SWU Y1-45 in Example 1 of this invention; Figure 2 This is the phylogenetic tree of Trichoderma SWU Y1-45 constructed in Example 1 of the present invention; Figure 3 This is a diagram showing the plate confrontation culture effect of Trichoderma hygroscopicum SWU Y1-45 against Rhizoctonia solani G1-3 in Example 2 of the present invention; Figure 4 The image shows the inhibitory effect of the aseptic fermentation broth of Trichoderma SWU Y1-45 on Rhizoctonia solani G1-3 in Example 3 of this invention. Figure 5 The diagram shows the inhibitory effect of the volatile metabolites of Trichoderma SWU Y1-45 on Rhizoctonia solani G1-3 in Example 3 of the present invention. Figure 6 This is a graph showing the inhibitory effect of Trichoderma hygroscopicum SWU Y1-45 on four different plant pathogens in Example 6 of the present invention. Detailed Implementation
[0016] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Unless otherwise specified, specific conditions in the embodiments are performed under conventional conditions or conditions recommended by the manufacturer. Information on the reagents used in the embodiments is shown in Table 1, and information on the instruments and equipment used is shown in Table 2. Unless otherwise specified, the reagents or instruments used are all commercially available conventional products.
[0017] Table 1
[0018] Table 2
[0019] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to specific embodiments.
[0020] Example 1 This embodiment provides a Trichoderma SWU Y1-45, which is obtained through the following steps: ① Obtaining the strain: The test material of this invention was collected from the healthy root systems of Osmanthus fragrans plants infected with root rot in Hongensi Forest Park, Chongqing. Vigorous root systems were selected during collection, and the soil adhering to the roots was washed away in clean water before being brought back to the laboratory for separation.
[0021] ② Strain Isolation: After washing the roots with sterile water, blot the surface moisture with sterile filter paper; use a sterile scalpel to take a 4mm sample. 2 Tissue blocks; soak in 75% alcohol for 3-5 minutes, then rinse 2-3 times with sterile water; treat with 4% NaClO for 30-60 seconds, then rinse 3-4 times with sterile water; blot dry with sterile filter paper, then inoculate onto PDA medium; incubate in the dark at 25 ℃ for 3 days.
[0022] ③ Strain purification: After hyphae grow on the surface or edge of the tissue block, isolate and purify them using an inoculation needle, observing and recording the growth and characteristics of the colonies. Figure 1 As shown in Figure A, the colonies initially appear white to light gray on PDA, with fluffy and well-developed aerial hyphae, resembling felt, gradually turning green later. A distinct sporulation zone is present in the center of the colony, with conidial clusters arranged concentrically, gradually expanding towards the periphery as the culture time increases, eventually covering the entire colony. (Reference) Figure 1 B and Figure 1 C shows that the conidiophores of this strain are clustered, with more than two ampoules-shaped phialides at the apex. The conidia are dark green, rough in surface, spherical or oval, and approximately 3.1-3.6 μm in diameter. Based on the colony morphology, it was preliminarily identified as a mold.
[0023] The strain was then stored on a slant at 4°C for later use.
[0024] ④ Strain identification: Genomic DNA was extracted from the above-mentioned strains using a fungal genomic DNA extraction kit. The ITS fragment of the strain was then amplified using universal fungal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC). The reaction mixture consisted of: 10 μL of 2× PCR Master mix, 1 μL of ITS1 (10 μM), 1 μL of ITS4 (10 μM), 2 μL of DNA template (50 ng / mL), and 6 μL of ddH2O. The PCR amplification program was: 94℃ for 5 min, followed by 35 cycles of (94℃ for 40 s, 58℃ for 30 s annealing, and 72℃ for 45 s), and then 72℃ for 10 min.
[0025] The amplified product was then sequenced, and its ITS sequence is shown in SEQ ID No: 1: SEQ ID No:1: TACGAGCTTACACTCCCAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGAACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACG TATTTCTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGA ACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGATCGGCGTTGGGGATCGGGACCCCTCACACGGGTGCCGGCCCCGAAATACAGTGGCGGTCTCGCCG CAGCCTCTCCTGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATAAAAGGGGGGGGGA Then, the phylogenetic tree was constructed using the MAGA-X software with the Neighbor-Joining Method (NJ).
[0026] Experimental results are as follows Figure 2 As shown, the results indicate that strain SWU Y1-45 and T. asperellum TRS705 and T. asperellum Based on the morphological characteristics of the TRS744 strain, strain SWU Y1-45 was identified as *Trichoderma hygroscopica*. Trichoderma asperellum This strain was deposited on May 22, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNo. 41950.
[0027] Example 2 This embodiment demonstrates the inhibitory effect of Trichoderma hyacinthus SWU Y1-45 on root rot of Osmanthus fragrans. The specific steps are as follows: First, select *Binucleate*, the pathogen causing root rot in osmanthus. Rhizoctonia G1-3 was used as the target bacterium, and antagonistic strains were screened using the plate confrontation culture method. Using a 5mm diameter punch, two *Rhizoctonia solani* G1-3 and *Trichoderma echinococcus* SWU Y1-45 were respectively placed symmetrically 30mm from the center line of a PDA plate, with a single pathogen inoculation as a control. Each group was repeated three times. After incubation at 28℃ for 7 days, the colony radius of *Rhizoctonia solani* G1-3 was measured, and the inhibition rate was calculated using the formula:
[0028] Experimental results are as follows Figure 3 As shown, Trichoderma SWU Y1-45 has a significant inhibitory effect on Rhizoctonia solani G1-3, with an average inhibition rate of 71.71%. This indicates that Trichoderma SWU Y1-45 can inhibit the growth of pathogens through nutrient competition (preferentially occupying PDA plates and absorbing nutrients) and spatial competition (covering the growth of Rhizoctonia solani G1-3 colonies).
[0029] Example 3 This embodiment verifies the control effect of a derivative of *Trichoderma hyacinthus* SWU Y1-45 on root rot in osmanthus. The derivative consists of the sterile fermentation broth and volatile metabolites of *Trichoderma hyacinthus* SWU Y1-45. The specific experimental steps are as follows: 1. The effect of aseptic fermentation broth of Trichoderma hygroscopicum SWU Y1-45 on the prevention and control of root rot in Osmanthus fragrans: Three 5mm diameter Trichoderma hygroscopicus SWU Y1-45 mycelial discs were inoculated into 100mL of liquid PDB medium and cultured at 28℃ with shaking at 180 rpm for 5 days. After centrifugation, the mycelium was removed by filtration to obtain sterile fermentation filtrate. PDA medium was cooled to about 45℃, and PDA medium was mixed with the sterile fermentation filtrate of Trichoderma hygroscopicus SWU Y1-45 at a ratio of 5:1 (V / V) to prepare plates. After the medium solidified, a 5mm diameter Rhizoctonia solani G1-3 mycelial disc was inoculated in the center of each plate. A PDA plate without sterile fermentation broth was used as a control. Each treatment was replicated three times. After incubation at 28℃ upside down for 5 days, the diameter of the pathogen colony was determined using the cross-cross method, and the inhibition rate was calculated.
[0030] Experimental results are as follows Figure 4 As shown, calculations showed that the sterile fermentation broth of Trichoderma SWU Y1-45 had an inhibition rate of 41.21% against Rhizoctonia solani G1-3, indicating that it could play a certain antibacterial role, but the antibacterial effect was lower than that of Trichoderma SWUY1-45.
[0031] 2. The control effect of volatile metabolites of Trichoderma hygroscopicum SWU Y1-45 on root rot of Osmanthus fragrans: Using a sterile punch with a diameter of 5 mm, inoculate *Trichoderma echinosporum* SWU Y1-45 and *Rhizoctonia solani* G1-3 mycelial discs onto the center of PDA agar plates. Remove the plate caps, place a layer of sterile cellophane between the two plates, and then invert them to block the spread of *Trichoderma* spores. Subsequently, seal the edges of the plates with airtight sealing film to prevent the escape of volatile metabolites. The inverted culture group without *Trichoderma echinosporum* SWU Y1-45 served as a control. Each group had three replicates. After incubation at 28℃ for 4 days, measure the colony diameter of *Rhizoctonia solani* G1-3 and calculate the inhibition rate of volatile metabolites of *Trichoderma echinosporum* SWU Y1-45 against the pathogen.
[0032] Experimental results are as follows Figure 5 As shown, calculations showed that the volatile metabolites of Trichoderma SWU Y1-45 had an inhibition rate of 26.09% against Rhizoctonia solani G1-3, indicating that it could play a certain antibacterial role, but the antibacterial effect was lower than that of Trichoderma SWU Y1-45 and the aseptic fermentation broth of Trichoderma SWU Y1-45.
[0033] Example 4 This embodiment further verifies the control effect of Trichoderma hygroscopicum SWU Y1-45 on root rot of Osmanthus fragrans. The experimental steps are as follows: Diseased soil was collected from a site in Hongensi Forest Park, Chongqing, where Osmanthus fragrans root rot was present. Healthy one-year-old Osmanthus seedlings with uniform growth were planted in pots. Thirty days after transplanting, the roots were incised and the roots were inoculated with *Rhizoctonia solani* G1-3 and *Trichoderma hydathodes* SWU Y1-45. The disease phenotype of the plants was observed 60 days after inoculation. Control group: Inoculated only with *Rhizoctonia solani* G1-3 mycelial suspension; Treatment group: Inoculated simultaneously with 40 mL of *Trichoderma hydathodes* SWU Y1-45 (1×10⁻⁶). 6 Spore suspensions (spores / mL) and *Rhizoctonia solani* G1-3 mycelial suspensions were used for each treatment, with 3 biological replicates per replicate, and 6 *Osmanthus fragrans* plants per replicate.
[0034] Then, referring to the "Methods of Plant Disease Research," and combining the symptoms of Osmanthus root rot, a disease severity grading standard was established: Grade 0: Roots and above-ground parts grow well, with no symptoms; Grade 1: Roots show brown lesions, with a browning rate ≤25%, and leaves are asymptomatic; Grade 2: 26% ≤ root browning rate ≤50%, with reduced fibrous roots; Grade 3: 51% ≤ root browning rate ≤75%, with leaf tips turning yellow; Grade 4: Root browning rate ≥76%, but not completely necrotic, with wilting of the plant and some leaf drop; Grade 5: Root necrosis, and death of above-ground parts. Based on the disease severity grading, the disease index of each treatment group and the relative efficacy of Trichoderma against root rot were calculated, and statistical analysis was performed using IBM-SPSS software. The calculation formula is as follows: ; ;
[0036] The experimental results are shown in Table 3: Table 3. Control efficacy of Trichoderma acicularis against root rot in Osmanthus fragrans.
[0037] As shown in Table 3, the disease index of the treatment group was lower than that of the control group, with a relative prevention efficacy of approximately 53.99%. This further demonstrates that Trichoderma hygroscopicum SWU Y1-45 can effectively inhibit the occurrence of root rot in Osmanthus fragrans.
[0038] Example 5 This embodiment tested the broad-spectrum antibacterial activity of *Trichoderma hyacinthus* SWU Y1-45, including its activity against *Fusarium solani* (…). Fusarium solani G1-17, Coccidioides immitis (G1-17, Coccidioides immitis) Macrophomina phaseolina Y1-1, Dioscorea opposita ( Lasiodiplodia sinensis )120802, Fruit-borne anthracnose ( Colletotrichum fructicola The antibacterial effect of 0623-3-2 was tested, and the experimental steps are as follows: Using a 5mm diameter punch, samples of the test bacteria and *Trichoderma hydathodes* SWU Y1-45 were taken and placed symmetrically 30mm from the center line of a PDA plate. Single inoculation of the pathogen served as a control, and each strain was replicated three times. After incubation at 28℃ for 7 days, the colony radius of the test bacteria was measured, and the inhibition rate was calculated. The experimental results are shown below. Figure 6 As shown in Table 4: Table 4. Inhibition rates of Trichoderma hyacinthus SWU Y1-45 against various pathogenic fungi.
[0039] It can be seen that *Trichoderma hygroscopicum* SWU Y1-45 has an inhibitory effect on *Fusarium solani* G1-17, *Coccidioidomyces chinensis* Y1-1, *Dispora cocovenenans* 120802, and *Anthracnose spp.* 0623-3-2. These fungi are the main sources of root rot of osmanthus, basal rot of ginkgo, anthracnose of loquat, and stem rot of loquat. In other words, *Trichoderma hygroscopicum* SWU Y1-45 of this invention can also be applied to the prevention and control of basal rot of ginkgo, anthracnose of loquat, and stem rot of loquat.
[0040] In summary, this invention provides a Trichoderma SWU Y1-45 strain and its application. This strain has good inhibitory effects on Dikaryotic Rhizoctonia, Fusarium, Coccidioides imbricata, Anthracnose, and Dispora trichoderma, and can achieve the prevention and control of Osmanthus root rot, Ginkgo basal rot, Loquat anthracnose, and Loquat stem rot. The present invention also provides a biological agent prepared from Trichoderma SWU Y1-45 and / or its derivatives, which, when applied in practice, can effectively control root rot of Osmanthus fragrans, basal rot of Ginkgo biloba, anthracnose of Loquat, and stem rot of Loquat.
[0041] The embodiments described above are some, but not all, embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.
Claims
1. A Trichoderma asperellum strain SWU Y1-45, characterized in that, The classification name is Trichoderma asperellum , preserved in China General Microbiological Culture Collection Center on May 22, 2025, with a preservation number of CGMCC No. 41950 and a preservation address of No. 3, Xili, Beichen West Road, Chaoyang District, Beijing.
2. The Trichoderma asperellum strain SWU Y1-45 of claim 1, wherein, The ITS rDNA sequence of which is shown as SEQ ID NO:
1.
3. The Trichoderma asperellum SWU Y1-45 for use in preventing and treating root rot of Osmanthus fragrans according to claim 1.
4. The Trichoderma asperellum SWU Y1-45 for use in inhibiting fungal pathogen according to claim 1.
5. Use according to claim 4, characterized in that, The fungal pathogen is any one of Rhizoctonia biserialis, Fusarium, Aspergillus alliaceus, Colletotrichum gloeosporioides, and Alternaria alternate.
6. A derivative of Trichoderma asperellum SWU Y1-45, characterized in that, The spore suspension comprising the Trichoderma asperellum SWU Y1-45 according to claim 1; and / or, the fermentation product of the Trichoderma asperellum SWU Y1-45; and / or, the volatile metabolite of the Trichoderma asperellum SWU Y1-45.
7. The derivative according to claim 6 for use in preventing and treating root rot of Osmanthus fragrans, root rot of Ginkgo biloba; and / or, anthracnose of loquat; and / or, stem rot of loquat.