Alkaline protease mutant with improved specific activity
By performing site-directed mutagenesis on alkaline protease, particularly by substituting or combining amino acid positions 30, 77, 101, 138, 183, 197, and 226, the specific activity of the enzyme was improved, solving the problem of insufficient production capacity of existing alkaline protease, reducing production costs, and promoting its application in the detergent industry.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-27
- Publication Date
- 2026-03-17
AI Technical Summary
The existing alkaline protease production capacity is poor, the enzyme fermentation activity is low, the enzyme specific activity is low, and the washing application effect is poor. As a result, the alkaline protease products on the market are mainly monopolized by international giants, making it difficult to meet industrial needs.
By performing site-directed mutagenesis on wild-type alkaline protease, an alkaline protease mutant containing a specific amino acid sequence is constructed. Specifically, substitutions or combinations are made at amino acid positions 30, 77, 101, 138, 183, 197, and 226 to improve the specific activity of the enzyme.
It significantly improves the specific activity of alkaline protease, reduces production costs, and promotes its widespread application in the detergent industry.
Abstract
Description
Technical Field
[0001] This invention relates to the field of protein engineering technology, specifically to alkaline protease mutants with increased specific activity and their applications. Background Technology
[0002] Proteases are a class of enzymes that hydrolyze peptide bonds in proteins to produce amino acids or polypeptides. They are an important type of industrial enzyme, accounting for approximately 60% of the global enzyme production value. Alkaline proteases are enzymes that hydrolyze protein peptide bonds under alkaline conditions, with an optimal pH of 9-11. They are widely used and researched in industries such as detergents, food processing, leather, and textile manufacturing. Alkaline proteases are the most widely used and profitable type of industrial enzyme. With increasing emphasis on environmental protection and the achievement of carbon neutrality goals, the widespread use of microbial alkaline proteases in the detergent industry is an ideal choice for reducing chemical detergents.
[0003] Many microorganisms can produce alkaline proteases, but the yield of wild-type strains often cannot meet the needs of industrial production. Therefore, genetic principles and techniques are typically used to genetically modify wild-type strains to increase protease production and obtain engineered strains suitable for industrial production. Commonly used microbial genetic breeding methods include mutagenesis breeding, protoplast fusion, genetic engineering, and protein engineering breeding. Traditional mutagenesis was a commonly used method in the early selection of alkaline protease strains, using physical means or chemical reagents to treat microbial cells, altering the genetic traits of the strains to obtain high-yielding strains. In 1963, Novo fermented to produce the first alkaline protease for washing, and in 1972, the well-known saveinase was introduced. With the application of DNA recombination technology, in 1985, Jacobs et al. first publicly reported the successful cloning of the alkaline protease gene in Bacillus, opening a new research stage in constructing high-yielding engineered bacteria of alkaline protease using genetic engineering technology. In the past few decades of research, protein engineering has also become an important technical means to improve the activity and performance of alkaline proteases. Jaouadi et al. found that Leu31, Thr33, Asn99, Phe159, and Gly182 significantly affect the activity of SAPB, an alkaline protease derived from B. pumilus. Through site-directed mutagenesis, they constructed different mutants, and the triple mutant L31I / T33S / N99Y showed approximately twice the activity of the wild type (Jaouadi et al. 2010). Li et al. increased the expression level of Streptomyces keratinase Sfp2 by site-directed mutagenesis at positions -1 and -2 of the N-terminal sequence, ultimately finding that the specific activity of the L(-1)F mutant was nine times that of the wild-type Sfp2 (Li Junxia et al. 2013). Shi Yawei et al. engineered the protein PB92 of Bacillus subtilis protease, finding that the double mutant A188P / V262I significantly improved both thermostability and alkali resistance (Shi Yawei et al. 2020).
[0004] Most alkaline protease products currently on the market are protein-engineered mutants of wild-type proteases. The Chinese market for alkaline protease is mainly monopolized by international giants Novozymes and DuPont, primarily due to the poor production capacity of domestic alkaline protease-producing strains, low enzyme fermentation activity, low specific activity, and poor washing performance. Therefore, the protein engineering modification and screening of high-activity, high-stability, and high-potency alkaline proteases, as well as the construction of high-yield engineered strains, have become research hotspots both domestically and internationally. Summary of the Invention
[0005] The purpose of this invention is to provide an alkaline protease mutant with increased specific activity. The mutant exhibits a significantly higher specific activity than the wild type, thereby facilitating the widespread application of alkaline protease in the detergent field.
[0006] The present invention relates to an alkaline protease mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising an amino acid substitution at at least one position selected from the group consisting of: 30, 77, 101, 138, 183, 197, 219, 226 compared with SEQ ID NO:1.
[0007] In some embodiments of the present invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.
[0008] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.
[0009] In some embodiments of the present invention, the mutant comprises a substitution of at least one amino acid from the following group: V30I, I77L / V, S101G, N138Q / K, F183D, V197I / L, P219W / E, A226G / T.
[0010] In some embodiments of the present invention, the mutant comprises substitutions or combinations of substitutions selected from the following substitutions and combinations thereof: V30I; I77L; I77V; S101G; N138Q; N138K; F183D; V197I; V197L; P219W; P219E; A226G; A226T; V30I / I77L; V30I / N138Q; V30I / F183D; V30I / V197I; V30I / P219W; V30I / A226G; V30I / I77L / N138Q; V30I / I77L / P219W; V30I / I77L / A226G; V30I / N138Q / F183D; V30I / N138Q / V197I; V30I / N138Q / P219W; V30I / N138Q / A226G; V30I / V197I / P219W; V30I / V197I / A226G; V30I / P219W / A226G; V30I / I77L / N138Q / F183D; V30I / I77L / N138Q / V197I; V30I / I77L / N138Q / P219W; V30I / I77L / N138Q / A226G; V30I / N138Q / P219W / A226G; V30I / V197I / P219W / A226G; V30I / I77L / N138Q / F183D / V197I; V30I / I77L / N138Q / F183D / P219W; V30I / I77L / N138Q / F183D / A226G; V30I / N138Q / F183D / V197I / P219W; V30I / I77L / N138Q / F183D / V197I / P219W; V30I / I77L / N138Q / F183D / V197I / A226G; V30I / N138Q / F183D / V197I / P219W / A226G; V30I / S101G / N138Q / F183D / V197I / A226G; V30I / S101G / F183D / V197I / P219W / A226G; V30I / I77L / N138Q / F183D / V197I / P219W / A226G; V30I / I77L / S101G / F183D / V197I / P219W / A226G; I77L / N138Q; I77L / F183D; I77L / V197I / ; I77L / P219W; I77V / A226G; I77L / N138Q / F183D; I77L / N138QV197I; I77L / N138Q / P219W; I77L / N138Q / A226G; I77L / F183D / V197I; I77L / F183D / P219W; I77L / V197I / P219W; I77L / V197I / A226G; I77L / P219W / A226G; I77L / N138Q / F183D / V197I; I77V / N138Q / F183D / P219W; I77V / N138Q / F183D / A226G; I77L / F183D / V197I / P219W; I77L / F183D / V197I / A226G; I77L / V197I / P219W / A226G; I77V / N138Q / F183D / V197I / P219W; I77V / N138Q / F183D / V197I / A226G; I77L / N138Q / F183D / V197I / P219W / A226G; F183D / V197I; F183D / P219W; F183D / A226G; F183D / V197I / P219W; F183D / V197I / A226G; F183D / P219W / A226G; F183D / V197I / P219W / A226G; V197I / P219W; V197I / A226G; V197I / P219W / A226G; P219W / A226G; V30I / I77V; V30I / S101G; V30I / N138K; V30IV197L; V30I / P219E; V30I / A226T; V30I / I77V / S101G; V30I / I77V / N138K; V30I / I77V / F183D; V30I / I77V / V197L; V30I / I77V / P219E; V30I / I77V / A226T; V30I / I77V / S101G / N138K; V30I / I77V / S101G / F183D; V30I / I77V / S101G / V197L; V30I / I77V / S101G / P219E; V30I / I77V / S101G / A226T; V30I / S101G / N138K / F183D; V30I / S101G / N138K / V197L; V30I / S101G / N138K / P219E; V30I / S101G / N138K / A226T; V30I / / N138K / F183D / V197L; V30I / I77V / S101G / N138K / F183D; V30I / I77V / S101G / N138K / V197L; V30I / I77V / S101G / N138K / P219E; V30I / I77V / S101G / N138K / A226T; V30I / S101G / N138K / F183D / V197L; V30I / S101G / N138K / F183D / P219E; V30I / S101G / N138K / F183D / A226T; V30I / N138K / F183D / V197L / P219E; V30IN138K / F183D / V197L / A226T; V30I / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L; V30I / I77V / S101G / N138K / F183D / P219E; V30I / I77V / S101G / N138K / F183D / A226T; V30I / I77V / S101G / V197L / P219E / A226T; V30I / I77V / S101G / N138K / P219E / A226T; V30I / S101G / F183D / V197L / P219E / A226T; V30I / S101G / N138K / V197L / P219E / A226T; V30I / S101G / N138K / F183D / P219E / A226T; V30I / N138K / F183D / V197L / P219E / A226T; V30I / N138K / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219E; V30I / I77V / S101G / N138K / F183D / V197L / A226T; V30I / I77V / S101G / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / A226T; V30I / I77V / S101G / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / V197L / P219E / A226T; V30I / I77V / N138K / F183D / V197L / P219E / A226T; V30I / S101G / N138K / F183D / V197L / P219E / A226T; V30I / I77L / S101G / N138Q / F183D / V197I / P219W / A226G; V30I / I77V / S101G / N138Q / F183D / V197I / P219W / A226G; V30I / I77L / S101G / N138Q / F183D / V197L / P219W / A226G; V30I / I77V / S101G / N138Q / F183D / V197L / P219W / A226G; V30I / I77L / S101G / N138K / F183D / V197I / P219W / A226G; V30I / I77V / S101G / N138K / F183D / V197I / P219W / A226G; V30I / I77L / S101G / N138K / F183D / V197L / P219W / A226G; V30I / I77V / S101G / N138K / F183D / V197L / P219W / A226G; V30I / I77L / S101G / N138Q / F183D / V197I / P219E / A226G; V30I / I77V / S101G / N138Q / F183D / V197I / P219E / A226G; V30I / I77L / S101G / N138Q / F183D / V197L / P219E / A226G; V30I / I77V / S101G / N138Q / F183D / V197L / P219E / A226G; V30I / I77L / S101G / N138K / F183D / V197I / P219E / A226G; V30I / I77V / S101G / N138K / F183D / V197I / P219E / A226G; V30I / I77L / S101G / N138K / F183D / V197L / P219E / A226G; V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226G; V30I / I77L / S101G / N138Q / F183D / V197I / P219W / A226T; V30I / I77V / S101G / N138Q / F183D / V197I / P219W / A226T; V30I / I77L / S101G / N138Q / F183D / V197L / P219W / A226T; V30I / I77V / S101G / N138Q / F183D / V197L / P219W / A226T; V30I / I77L / S101G / N138K / F183D / V197I / P219W / A226T; V30I / I77V / S101G / N138K / F183D / V197I / P219W / A226T; V30I / I77L / S101G / N138K / F183D / V197L / P219W / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219W / A226T; V30I / I77L / S101G / N138Q / F183D / V197I / P219E / A226T; V30I / I77V / S101G / N138Q / F183D / V197I / P219E / A226T; V30I / I77L / S101G / N138Q / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138Q / F183D / V197L / P219E / A226T; V30I / I77L / S101G / N138K / F183D / V197I / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197I / P219E / A226T; V30I / I77L / S101G / N138K / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T; I77V / S101G; I77V / N138K; I77V / F183D; I77V / V197L; I77V / P219E; I77V / A226T; I77V / S101G / N138K; I77V / S101G / F183D; I77V / S101G / V197L; I77V / S101G / P219E; I77V / S101G / A226T; I77V / N138K / F183D; I77V / N138K / V197L; I77V / N138K / P219E; I77V / N138K / A226T; I77V / 183D / V197L; I77V / P219E / A226T; I77V / S101G / N138K / F183D; I77V / S101G / P219E / A226T; I77V / S101G / N138K / A226T; I77V / N138K / V197L / P219E; I77V / N138K / F183D / A226T; I77V / N138K / V197L / A226T; I77V / F183D / V197L / P219E; I77V / F183D / V197L / A226T; I77V / F183D / P219E / A226T; I77V / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L; I77V / S101G / N138K / F183D / P219E; I77V / S101G / N138K / F183D / A226T; I77V / N138K / F183D / V197L / P219E; I77V / N138K / F183D / V197L / A226T; I77V / N138K / V197L / P219E / A226T; I77V / N138K / F183D / P219E / A226T; I77V / F183D / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L / P219E; I77V / S101G / N138K / F183D / V197L / A226T; I77V / S101G / F183D / V197L / P219E / A226T; I77V / S101G / N138K / V197L / P219E / A226T; I77V / N138K / F183D / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L / P219E / A226T; N138K / F183D; N138K / V197L; N138K / P219E; N138K / A226T; N138K / F183D / V197L / P219E; N138K / F183D / V197L / A226T; N138K / V197L / P219E / A226T; N138K / F183D / V197L / P219E / A226T; F183D / V197L; F183D / P219E; F183D / A226T; F183D / V197L / P219E; F183D / V197L / A226T; F183D / P219E / A226T; F183D / V197L / P219E / A226T; V197L / P219E; V197L / A226T; V197L / P219E / A226T; P219E / A226T.
[0011] The present invention also relates to DNA molecules encoding the above-mentioned alkaline protease mutants.
[0012] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.
[0013] In some embodiments of the present invention, a host cell is Bacillus subtilis (B. subtilis) Bacillus subtilis ), which includes the aforementioned recombinant expression vectors.
[0014] In some embodiments of the present invention, a host cell is Bacillus licheniformis (B. licheniformis) Bacillus licheniformis ), which includes the aforementioned recombinant expression vectors.
[0015] This invention, based on the wild-type alkaline protease AprE derived from Bacillus claurifolius, provides single-point mutants containing any one of the mutation sites V30I, I77L, I77V, S101G, N138Q, N138K, F183D, V197I, V197L, P219W, P219E, A226G, and A226T. The specific activity of these single-point mutants is generally increased by 8.2%-26.5%. Compared to the corresponding single-point mutants, the combined mutants containing two or more mutation sites provided by this invention generally have a higher specific activity of 37.8%-65.4%, all significantly higher than the specific activities of the aforementioned single-point mutants. This achieves unexpected technical benefits, helps reduce the production cost of the enzyme, and promotes its widespread application in the detergent industry. Detailed Implementation
[0016] This invention discloses an alkaline protease mutant, its preparation method and application, the DNA molecule encoding the alkaline protease mutant, the vector, and the host cell. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0017] The method of the present invention will be further illustrated below with reference to examples. Experimental methods not specified in the examples can be performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual* by J. Sambrook et al., or according to the manufacturer's recommendations. Those skilled in the art can better understand and master the present invention with the help of these examples. However, the methods for implementing the present invention should not be limited to the specific method steps described in the embodiments of the present invention.
[0018] In this invention, the nomenclature used to define the amino acid positions is based on the amino acid sequence WP_094423791.1 of the Bacillus alkaline protease deposited in GenBank, which is given in the sequence listing as SEQ ID NO:1 (amino acids 1-269 of SEQ ID NO:1). Therefore, in this context, the basis for position numbering, SEQ ID NO:1, begins at A1 (Ala1) and ends at R269 (Arg269). SEQ ID NO:1 serves as the standard for position numbering and thus as the basis for nomenclature.
[0019] Labeling of alkaline protease mutants: The mutated amino acid in the alkaline protease mutant is indicated by "the amino acid that was replaced at the original amino acid position". For example, V30I indicates that the amino acid at position 30 is replaced by Ile(I) in the original alkaline protease. The position number corresponds to the number in SEQ ID NO:1 of the appendix sequence listing.
[0020] The culture medium formulation involved in the embodiments of the present invention is as follows: LB liquid medium: 1% tryptone, 0.5% yeast extract, 0.5% NaCl; LB agar: 1% tryptone, 0.5% yeast extract, 0.5% NaCl, 2% agar; Skim milk agar plates: 1% tryptone, 0.5% yeast, 0.5% NaCl, 1% skim milk, 1.5% agar; The preparation method for GM I is as follows: 95.6 ml of 1* minimum salt solution, 2.5 ml of 20% glucose, 0.4 ml of 5% hydrolyzed casein, and 1 ml of 10% yeast extract; wherein the preparation method for the 1* minimum salt solution is as follows: K2HPO4 14 g / L, KH2PO4 6 g / L, (NH4)2SO4 2 g / L, trisodium citrate 1 g / L, and MgSO4•7H2O 0.2 g / L, dissolved in distilled water in sequence; The preparation method for GM II is as follows: 96.98 ml of 1* minimum salt solution, 2.5 ml of 20% glucose, 0.08 ml of 5% hydrolyzed casein, 0.04 ml of 10% yeast extract, 0.25 ml of 1 M MgCl2, and 0.05 ml of 1 M CaCl2. Seed culture medium: yeast extract 0.5%, tryptone 0.5%, NaCl 0.5%; Fermentation medium: 1% glucose, 0.2% disodium hydrogen phosphate, 1% peptone, 1% sodium chloride. Yeast powder 0.5%.
[0021] Example 1 Construction of alkaline protease mutant Bacillus claurinus ( Bacillus clausii alkaline protease gene aprE The lead peptide and mature peptide were optimized based on Bacillus codon preferences, and the optimized nucleotide sequence was synthesized by Beijing Liuhe BGI Genomics Co., Ltd. The protease gene was named... aprE Its amino acid sequence is SEQ ID NO:1, and its encoding nucleotide sequence is SEQ ID NO:2.
[0022] by aprE Using gene (SEQ ID NO:2) as a template, PCR amplification was performed using the above primers and the GeneMorph II random mutagenesis PCR kit. The PCR primers and reaction conditions are as follows: aprE-F: gcactgctggcaggaggcgcaactcaagcttttgccgctgaagaagcaaaagaaaaata; aprE-Rv: ggaaacagctatgaccatgattacgccaagctttagcgtgttgccgcttctgcattg.
[0023] PCR conditions were: 98℃ for 2 min; 98℃ for 10 s; 58℃ for 20 s, 72℃ for 45 s, 30 cycles; 72℃ for 5 min. PCR amplification products were recovered using a gel extraction kit. Hind After III enzyme digestion and... HInd The pX131 vector was ligated with enzyme III, and the enzyme digestion reaction system for expressing the pX131 vector is shown in Table 1.
[0024] Table 1 Enzyme digestion reaction system pX131 20uL 10*Buffer 5ul HindIII 2.5uL <![CDATA[ddH2O]]> 22.5ul Total volume 50ul Enzyme digestion was performed in a 37℃ water bath for 2 hours. After electrophoresis, the target fragments were recovered and dissolved in 20 μL ddH2O.
[0025] Using the NEB Gbison assembly kit, in a 20 μL reaction system, genes aprE The molar ratio of fragment to carrier pX131 was 1:3, and the reaction was carried out at 50℃ for 60 min.
[0026] Example 2 Screening of high specific activity alkaline protease mutants The above 20 μL assembly reaction solution was transformed into Bacillus subtilis 1A751 host cells using the competent cell method. The specific transformation process is as follows: Freshly activated Bacillus subtilis 1A751 was inoculated into 5 ml GMI solution on an LB plate and cultured overnight at 30°C and 125 rpm with shaking. The next day, 1 ml of the culture solution was transferred to 9 ml of GMI and cultured at 37°C and 220 rpm for 3.5 h. Then, 1 ml of the culture solution from the previous step was transferred to 9 ml of GMII solution and cultured at 37°C and 125 rpm for 90 min. The cells were then collected by centrifugation at 5000 g for 10 min. The cells were gently resuspended in 1 ml of GMII solution. The resuspended cells are the competent cells. Then, 0.2 ml of competent cells were taken and 20 μL of assembly reaction solution was added. The cells were cultured at 37°C and 200 rpm for 60 min with shaking. The mixture was then plated on skim milk containing 30 μg / mL kanamycin and incubated overnight at 37°C. The transformants and the size of the clear zone were examined the next day, and wild-type alkaline protease was used as the assay result. aprE For comparison Transformants with significantly larger clear zones than the control were picked from transformation plates and purified by streaking on skim milk plates containing 30 μg / mL kanamycin to obtain single colonies. These colonies were then individually inoculated into 96-well plates using toothpicks, with 200 μL of LB solution added to each well. The plates were incubated at 37°C and 500 rpm for approximately 48 hours with shaking. The supernatant was obtained by centrifugation, and the alkaline protease activity and protein content were measured. The specific activity of different mutants was calculated. Ultimately, the applicant screened from over 6000 transformants with good clear zones to identify mutation sites that significantly increased the specific activity of alkaline protease without affecting its original enzymatic properties: V30I, I77L, I77V, S101G, N138Q, N138K, F183D, V197I, V197L, P219W, P219E, A226G, and A226T.
[0027] Based on the wild-type alkaline protease aprE, this invention provides mutants containing a single mutation site of V30I, I77L, I77V, S101G, N138Q, N138K, F183D, V197I, V197L, P219W, P219E, A226G, or A226T.
[0028] The present invention also provides alkaline protease mutants comprising at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 mutation sites selected from V30I, I77L / V, S101G, N138Q / K, F183D, V197I / L, P219W / E, and A226G / T, such as V30I / I77L, V30I / N138Q, V30I / F183D, and V30I / V1. Two-point mutants: 97I, V30I / P219W, V30I / A226G, I77L / N138Q, I77V / F183D, I77V / V197I, I77L / P219W, I77L / A226G, F183D / V197I, F183D / P219W, F183D / A226G, V197I / P219W, V197I / A226G, and P219W / A226G; V30I / I77L / N138Q, V30I / I77V / A226G, V30I / N138Q / F183D, V30I / N138Q / V197I, V30I / V197I / P219W, V3 0I / V197I / A226G, I77L / N138Q / F183D, I77L / N138QV197I, I77V / N138Q / A226G, I77V / F183D / V197L, F183 D / V197I / P219W, V197L / P219E / A226T three-point mutants; V30I / I77L / N138Q / V197I, V30I / V197L / P219W / A22, I77L / N138Q / F183D / P219, I77V / V197L / P219E / A226T, N138K / V197L / P219E / A226T, F183D / V197I / P219W / A226G Four-point mutants: V30I / S101G / N138K / F183D / V197L, V30I / F183D / V197L / P219E / A226T, I77V / N138K / F183D / P219E / A226T, I77L / F183D / V197I / P219W / A226G Five-point mutants: V30I / S101G / F183D / V197I / P219W / A226G, I77L / N138Q / F183D / V197I / P219W / A226G, I77V / N138K / F183D / V197L / P219E / A226T six-point mutants; V30I / I77L / S101G / N138Q / F183D / V197I / P219W, V30I / I77V / S101G / N138K / F183D / V197L / P219E, V30I / S101G / N138K / F183D / V197L / P219E / A226T, I77V / S101G / N138K / F183D / V197L / P219E / A226T seven-point mutant; V30I / I77L / S101G / N138Q / F183D / V197I / P219W / A226G, V30I / I77V / S101G / N138Q / F183D / V197L / P219E / A226G, V3 0I / I77L / S101G / N138Q / F183D / V197L / P219E / A226T, V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T eight-point mutant.
[0029] Example 3: Specific activity analysis of alkaline protease mutants The recombinant Bacillus subtilis strains expressing wild-type alkaline protease or its mutants, constructed in Example 2, were inoculated into fermentation medium (0.5% yeast extract, 0.5% tryptone, 1% glucose, 1.8% K2HPO4) and fermented in shake flasks for 48 h. The supernatant was collected by centrifugation at 5000 rpm for 10 min, and the protease activity and protein content in the supernatant were measured to calculate the specific activity. Simultaneously, the relative specific activity of the alkaline protease mutants was calculated as 100% of the specific activity of the wild-type alkaline protease AprE. The specific results are shown in Table 2.
[0030] Relative activity (%) = Specific activity of alkaline protease mutant / Specific activity of wild-type alkaline protease × 100%.
[0031] Table 2 Comparison of relative specific activities of alkaline protease single-point mutants alkaline protease Relative vitality Wild-type AprE 100% V30I 111.9% I77V 108.2% I77L 117.2% S101G 110.9% N138K 109.5% N138Q 115.7% F183D 120.5% V197I 122.2% V197L 118.4% P219W 126.5% A226G 119.3% A226T 119.8% As can be seen from the data in Table 1, compared with the wild-type alkaline protease AprE, the alkaline protease mutants provided by this invention, which contain single mutation sites of V30I, I77L, I77V, S101G, N138Q, N138K, F183D, V197I, V197L, P219W, P219E, A226G, and A226T, respectively, have significantly increased specific activities by 8.2%-26.5%.
[0032] Furthermore, the present invention provides two-point mutants of V30I / I77L, V30I / N138Q, V30I / F183D, V30I / V197I, V30I / P219W, V30I / A226G, I77L / N138Q, I77V / F183D, I77V / V197I, I77L / P219W, I77L / A226G, F183D / V197I, F183D / P219W, F183D / A226G, V197I / P219W, V197I / A226G, and P219W / A226G; V30I / I77L / N138Q, V30I / I77V / A226G, V30I / N138Q / F183D, V30I / N138Q / V197I, V30I / V197I / P219W, V3 0I / V197I / A226G, I77L / N138Q / F183D, I77L / N138QV197I, I77V / N138Q / A226G, I77V / F183D / V197L, F183 D / V197I / P219W, V197L / P219E / A226T three-point mutants; V30I / I77L / N138Q / V197I, V30I / V197L / P219W / A22, I77L / N138Q / F183D / P219, I77V / V197L / P219E / A226T, N138K / V197L / P219E / A226T, F183D / V197I / P219W / A226G Four-point mutants: V30I / S101G / N138K / F183D / V197L, V30I / F183D / V197L / P219E / A226T, I77V / N138K / F183D / P219E / A226T, I77L / F183D / V197I / P219W / A226G Five-point mutants: V30I / S101G / F183D / V197I / P219W / A226G, I77L / N138Q / F183D / V197I / P219W / A226G, I77V / N138K / F183D / V197L / P219E / A226T six-point mutants; V30I / I77L / S101G / N138Q / F183D / V197I / P219W, V30I / I77V / S101G / N138K / F183D / V197L / P219E, V30I / S101G / N138K / F183D / V197L / P219E / A226T, I77V / S101G / N138K / F183D / V197L / P219E / A226T seven-point mutant; V30I / I77L / S101G / N138Q / F183D / V197I / P219W / A226G, V30I / I77V / S101G / N138Q / F183D / V197L / P219E / A226G, V3 0I / I77L / S101G / N138Q / F183D / V197L / P219E / A226T, V30I / I77V / S101G / N138K / Combinations of different mutants, such as the F183D / V197L / P219E / A226T eight-point mutant, generally increased the specific activity by 37.8%-65.4%, which was significantly higher than the specific activity level of the single-point mutants mentioned above, achieving unexpected technical results.
[0033] The above results indicate that the mutation sites V30I, I77L, I77V, S101G, N138Q, N138K, F183D, V197I, V197L, P219W, P219E, A226G, and A226T provided by this invention can significantly improve the specific activity of wild-type alkaline protease AprE, which is beneficial to reducing the production cost of the enzyme and promoting its widespread application in the field of industrial enzymes.
[0034] (a) Methods for determining protease activity: 1. Principle Under specific temperature and pH conditions, proteases hydrolyze casein substrates to produce amino acids containing phenolic groups (such as tyrosine and tryptophan). Under alkaline conditions, Folin reagent is reduced to produce molybdenum blue and tungsten blue. The absorbance of the solution is measured at a wavelength of 680 nm using a spectrophotometer. Enzyme activity is directly proportional to absorbance, thus allowing the calculation of the product's enzyme activity.
[0035] 2. Definition of enzyme activity The definition of protease activity, expressed in units, is as follows: 1 g of solid enzyme powder (or 1 ml of liquid enzyme) hydrolyzes casein to produce 1 μg of tyrosine in 1 minute under certain temperature and pH conditions, which is 1 unit of enzyme activity, expressed as u / g (u / ml).
[0036] 3. Reagents and solutions (1) Folin reagent (Folin:water = 1:2); (2) 42.4 g / L sodium carbonate solution; (3) 0.5 mol / L sodium hydroxide solution; (4) borate buffer (pH 10.5); (5) 10.0 g / L casein solution; (6) 100 g / mL and 1 mg / mL L-tyrosine standard solutions; (7) 6.54% trichloroacetic acid.
[0037] 4. Measurement Method (1) Preparation of standard curve: Prepare L-tyrosine standard solutions with concentrations of 0 g / mL, 10 g / mL, 20 g / mL, 30 g / mL, 40 g / mL and 50 g / mL. Take 1.00 mL of each standard solution, add 5.00 mL of 0.4 mol / L sodium carbonate solution and 1.00 mL of Folin reagent working solution, shake well, and place in a 40℃ water bath for color development for 20 min. Remove and use a spectrophotometer at a wavelength of 680 nm with a 10 mm cuvette, using a tyrosine-free tube (C) as a blank, to measure the absorbance of each. Plot the standard curve with absorbance A as the ordinate and the concentration of tyrosine C as the abscissa (this line should pass through the zero point).
[0038] (2) Enzyme activity assay Take a pre-diluted amount of enzyme solution, then add an equal volume of 10% casein preheated at 40℃, and react at 40℃ for 10 min. Then add an equal volume of trichloroacetic acid (6.54% concentration) to the reaction system, mix well, and let stand at room temperature for 10 min to terminate the reaction. Take 1 ml of the terminated reaction solution, then add 5 ml of 42.4 g / L sodium carbonate solution, followed by 1 ml of Folin reagent, and perform a colorimetric reaction at 40℃ for 20 min. Finally, measure the OD608 value.
[0039] (3) Calculation Read the enzyme activity of the final diluted sample from the standard curve, in units of u / mL. The enzyme activity of the sample is calculated using the following formula: X = (A × K × 4 × n) / 10.
[0040] Where: X — enzyme activity of the sample (u / g or u / ml); A—The average absorbance of the sample in parallel tests; K—absorption constant; 4 — Total volume of reaction reagents (ml); 10 — Reaction time 10 min, calculated as 1 min; n – dilution factor.
[0041] (II) Methods for determining protein content: The Bradford binding method for protein determination is a combined colorimetric and dye-based method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution, turning blue upon binding to protein. Within a certain protein concentration range, it follows Beer's Law and can be measured colorimetrically at 595 nm. It exhibits significant absorption within 3–5 minutes and remains stable for at least 1 hour. In the range of 10–1000 μg / mL, the absorbance is directly proportional to the protein concentration. The enzyme solution and Coomassie Brilliant Blue solution are mixed at a volume ratio of 1:5, allowed to stand for 10 minutes, and then the protein content is determined using the Bradford binding method. (III) Specific vitality calculation: "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein.
[0042] Specific activity calculation formula: Specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).
Claims
1. A mutant of alkaline protease, characterized in that, The mutant is alkaline protease with amino acid sequence of SEQ ID NO: 1 comprising substitution of any one amino acid or combination of substitutions in the following group: I77L; V30I / I77L; V30I / I77L / N138Q; V30I / I77L / P219W; V30I / I77L / A226G; V30I / I77L / N138Q / F183D; V30I / I77L / N138Q / V197I; V30I / I77L / N138Q / P219W; V30I / I77L / N138Q / A226G; V30I / I77L / N138Q / F183D / V197I; V30I / I77L / N138Q / F183D / P219W; V30I / I77L / N138Q / F183D / A226G; V30I / I77L / N138Q / F183D / V197I / P219W; V30I / I77L / N138Q / F183D / V197I / A226G; V30I / I77L / N138Q / F183D / V197I / P219W / A226G; V30I / I77L / S101G / F183D / V197I / P219W / A226G; I77L / N138Q; I77L / F183D; I77L / V197I / ; I77L / P219W; I77V / A226G; I77L / N138Q / F183D; I77L / N138QV197I; I77L / N138Q / P219W; I77L / N138Q / A226G; I77L / F183D / V197I; I77L / F183D / P219W; I77L / V197I / P219W; I77L / V197I / A226G; I77L / P219W / A226G; I77L / N138Q / F183D / V197I; I77V / N138Q / F183D / P219W; I77V / N138Q / F183D / A226G; I77L / F183D / V197I / P219W; I77L / F183D / V197I / A226G; I77L / V197I / P219W / A226G; I77V / N138Q / F183D / V197I / P219W; I77V / N138Q / F183D / V197I / A226G; I77L / N138Q / F183D / V197I / P219W / A226G; V30I / I77V; V30I / I77V / S101G; V30I / I77V / N138K; V30I / I77V / F183D; V30I / I77V / V197L; V30I / I77V / P219E; V30I / I77V / A226T; V30I / I77V / S101G / N138K; V30I / I77V / S101G / F183D; V30I / I77V / S101G / V197L; V30I / I77V / S101G / P219E; V30I / I77V / S101G / A226T; V30I / I77V / S101G / N138K / F183D; V30I / I77V / S101G / N138K / V197L; V30I / I77V / S101G / N138K / P219E; V30I / I77V / S101G / N138K / A226T; V30I / I77V / S101G / N138K / F183D / V197L; V30I / I77V / S101G / N138K / F183D / P219E; V30I / I77V / S101G / N138K / F183D / A226T; V30I / I77V / S101G / V197L / P219E / A226T; V30I / I77V / S101G / N138K / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219E; V30I / I77V / S101G / N138K / F183D / V197L / A226T; V30I / I77V / S101G / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / A226T; V30I / I77V / S101G / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / V197L / P219E / A226T; V30I / I77V / N138K / F183D / V197L / P219E / A226T; V30I / I77L / S101G / N138Q / F183D / V197I / P219W / A226G; V30I / I77V / S101G / N138Q / F183D / V197I / P219W / A226G; V30I / I77L / S101G / N138Q / F183D / V197L / P219W / A226G; V30I / I77V / S101G / N138Q / F183D / V197L / P219W / A226G; V30I / I77L / S101G / N138K / F183D / V197I / P219W / A226G; V30I / I77V / S101 G / N138K / F183D / V197I / P219W / A226G; V30I / I77L / S101 G / N138K / F183D / V197I / P219W / A226G; V30I / I77V / S101 G / N138K / F183D / V197I / P219W / A226G; V30I / I77L / S101 G / N138Q / F183D / V197I / P219E / A226G; V30I / I77V / S101 G / N138Q / F183D / V197I / P219E / A226G; V30I / I77L / S101 G / N138Q / F183D / V197I / P219E / A226G; V30I / I77V / S101 G / N138Q / F183D / V197I / P219E / A226G; V30I / I77L / S101 G / N138K / F183D / V197I / P219E / A226G; V30I / I77V / S101 G / N138K / F183D / V197I / P219E / A226G; V30I / I77L / S101 G / N138K / F183D / V197I / P219E / A226G; V30I / I77V / S101 G / N138K / F183D / V197I / P219E / A226G; V30I / I77L / S101 G / N138Q / F183D / V197I / P219W / A226T; V30I / I77V / S101 G / N138Q / F183D / V197I / P219W / A226T; V30I / I77L / S101 G / N138Q / F183D / V197I / P219W / A226T; V30I / I77V / S101 G / N138Q / F183D / V197I / P219W / A226T; V30I / I77L / S101 G / N138K / F183D / V197I / P219W / A226T; V30I / I77V / S101 G / N138K / F183D / V197I / P219W / A226T; V30I / I77L / S101 G / N138K / F183D / V197I / P219W / A226T; V30I / I77V / S101 G / N138K / F183D / V197I / P219W / A226T; V30I / I77L / S101 G / N138Q / F183D / V197I / P219E / A226T; V30I / I77V / S101 G / N138Q / F183D / V197I / P219E / A226T; V30I / I77L / S101G / N138Q / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138Q / F183D / V197L / P219E / A226T; V30I / I77L / S101G / N138K / F183D / V197I / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197I / P219E / A226T; V30I / I77L / S101G / N138K / F183D / V197L / P219E / A226T; V30I / I77V / S101G / N138K / F183D / V197L / P219E / A226T; I77V / S101G; I77V / N138K; I77V / F183D; I77V / V197L; I77V / P219E; I77V / A226T; I77V / S101G / N138K; I77V / S101G / F183D; I77V / S101G / V197L; I77V / S101G / P219E; I77V / S101G / A226T; I77V / N138K / F183D; I77V / N138K / V197L; I77V / N138K / P219E; I77V / N138K / A226T; I77V / 183D / V197L; I77V / P219E / A226T; I77V / S101G / N138K / F183D; I77V / S101G / P219E / A226T; I77V / S101G / N138K / A226T; I77V / N138K / V197L / P219E; I77V / N138K / F183D / A226T; I77V / N138K / V197L / A226T; I77V / F183D / V197L / P219E; I77V / F183D / V197L / A226T; I77V / F183D / P219E / A226T; I77V / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L; I77V / S101G / N138K / F183D / P219E; I77V / S101G / N138K / F183D / A226T; I77V / N138K / F183D / V197L / P219E; I77V / N138K / F183D / V197L / A226T; I77V / N138K / V197L / P219E / A226T; I77V / N138K / F183D / P219E / A226T; I77V / F183D / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L / P219E; I77V / S101G / F183D / V197L / P219E / A226T; I77V / S101G / N138K / V197L / P219E / A226T; I77V / S101G / N138K / F183D / V197L / P219E / A226T.
2. A DNA molecule encoding the alkaline protease mutant of claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2. The host cell comprises the recombinant expression plasmid of claim 4; the host cell is a non-animal or plant species. Pichia 4. A host cell, characterized in that, pastoris 5. The host cell of claim 4, wherein The host cell is Pichia pastoris (MUT+) Trichoderma reesei 6. Use of the alkaline protease mutant of claim 1 in the field of washing. ) or Trichoderma reesei (P1) .