Method for cultivating stable-resistance japonica rice material by polymerizing broad-spectrum rice blast resistance genes Pijx and Pikh

By combining the Pijx and Pikh genes, along with marker-assisted selection and multi-generational self-pollination homozygosity, the problem of easy loss of resistance in varieties with single resistance genes was solved. This led to the cultivation of japonica rice materials with stable resistance and excellent agronomic traits, achieving sustained improvement in rice blast resistance and increasing breeding efficiency.

CN121674418APending Publication Date: 2026-03-17JIANGSU LIXIAHE REGION AGRI RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-24
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing single-resistance varieties are prone to losing resistance after changes in the rice blast fungus population, resulting in unstable control of rice blast and making it difficult to cultivate japonica rice materials with long-lasting resistance and excellent agronomic traits.

Method used

By aggregating two broad-spectrum rice blast resistance genes, Pijx and Pikh, and using molecular marker-assisted selection technology combined with PCR amplification and gel imaging analysis, japonica rice materials carrying both Pijx and Pikh genes were screened and bred. Stable resistant japonica rice materials were obtained by combining agronomic trait selection and multiple generations of self-pollination homozygosity.

Benefits of technology

It significantly improved the resistance spectrum and resistance persistence of japonica rice materials to rice blast, maintained excellent agronomic traits, yield and quality, shortened the breeding cycle and improved breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674418A_ABST
    Figure CN121674418A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of rice breeding, and discloses a method for cultivating a japonica rice material with stable resistance by polymerizing broad-spectrum rice blast resistance genes Pijx and Pikh. The method comprises the following steps: screening a resistance gene Pijx by using a specific functional marker P1Pijx (primer sequences are shown as SEQIDNO.1 and SEQIDNO.2) through a molecular marker-assisted selection technology, screening a resistance gene Pikh by using a functional marker FM143 (primer sequences are shown as SEQIDNO.3 and SEQIDNO.4), and polymerizing two broad-spectrum resistance genes in the same japonica rice material through hybridization, backcrossing, multiple crossing and multi-generation screening. The cultivated japonica rice material shows stable and efficient resistance to rice blast (seedling blast and panicle blast) on the basis of keeping excellent agronomic characters, yield and quality, the resistance frequency is obviously higher than that of a control variety, and the variety popularization period can be effectively prolonged.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of rice breeding technology, and in particular to a method for breeding stable resistant japonica rice materials by aggregating the broad-spectrum rice blast resistance genes Pijx and Pikh. Background Technology

[0002] Rice blast, caused by the fungus Magnaportheoryzae, is one of the most widespread and damaging fungal diseases in rice production, occurring in all rice-producing regions worldwide. In my country, the annual affected area of ​​rice blast exceeds 4 million hectares, resulting in a rice yield loss of over 2 billion kg, seriously threatening food security.

[0003] Breeding disease-resistant varieties using disease-resistant genes is the most economical, environmentally friendly, and effective way to control rice blast. To date, 102 rice blast resistance genes and more than 500 rice blast resistance QTLs have been identified, of which 40 major resistance genes and multiple resistance QTLs have been successfully cloned. In disease resistance breeding, gene resources with broad-spectrum and durable resistance are highly valued: Pijx is a newly discovered broad-spectrum rice blast resistance gene throughout the entire growth period, located on chromosome 12 of rice. It has a CC-NBS-LRR domain, and its encoded protein can interact with the β subunit of ATP synthase and promote its ubiquitination and degradation, thereby activating the OsRbohC-mediated ROS burst, enabling the plant to acquire resistance. This gene has not yet been widely used in japonica rice production. Pikh (also known as Pi54) is an NBS-LRR type dominant resistance gene located on chromosome 11. It has broad-spectrum resistance and has shown strong resistance to rice blast in many places such as Sichuan, Chongqing, Fujian, Jilin, and Jiangsu. The resistance frequencies to seedling blast and panicle blast are 42.20% and 35.71%, respectively. It has been applied in some japonica rice varieties (such as Yangnong Rice No. 1 and Wuyun Japonica 24).

[0004] Because the genetic background of rice blast fungus is complex and prone to variation, varieties bred from a single resistance gene often lose their resistance after 3-5 years of promotion due to changes in the fungal population's adaptability. Therefore, aggregating multiple broad-spectrum, durable resistance genes with different resistance mechanisms is a key strategy to improve the stability and durability of rice blast resistance in varieties. The Zhejiang native japonica rice variety Xiushui 134 carries the Pijx gene, which is not found in Jiangsu approved varieties; the Pikh gene, however, is widely distributed in Jiangsu japonica rice varieties. This invention uses marker-assisted selection technology to aggregate the not widely used Pijx gene with the widely used Pikh gene, aiming to cultivate new japonica rice materials with durable resistance and excellent agronomic traits. Summary of the Invention

[0005] The purpose of this invention is to provide a method for breeding japonica rice that integrates the broad-spectrum rice blast resistance genes Pijx and Pikh, thereby solving the problem of easy loss of resistance in existing varieties with single resistance genes, and cultivating japonica rice materials with stable rice blast resistance, excellent agronomic traits, and satisfactory yield and quality.

[0006] The present invention adopts the following technical solution:

[0007] A method for breeding stable resistant japonica rice materials by aggregating the broad-spectrum rice blast resistance genes Pijx and Pikh includes the following steps:

[0008] S1. Select the japonica rice variety Xiushui 134 carrying the Pijx gene and the japonica rice variety Wuyunjing 24 carrying the Pijx gene as the resistance gene donor parents, and use the excellent eating japonica rice variety Nanjing 9108 as the recipient parent and intermediate modification material.

[0009] S2. Extract genomic DNA from the parents and segregating populations of each generation of offspring;

[0010] S3. PCR amplification of genomic DNA using functional markers, wherein the functional markers include P1 for detecting the Pijx gene. Pijx (Primer sequences are SEQ ID NO. 1 and SEQ ID NO. 2) and FM143 for detecting the Pikh gene (primer sequences are SEQ ID NO. 3 and SEQ ID NO. 4);

[0011] S4. PCR products were analyzed by gel imaging to screen for single plants carrying both the Pijx and Pikh genes. Stable resistant japonica rice materials were cultivated through agronomical trait selection, backcrossing, recrossing, and multiple generations of self-pollination to achieve homozygosity. The total volume of the PCR amplification system was 20 μL, including: 1.5 μL each of the forward and reverse primers, 2 μL of dNTPs, 2 μL of 10×PCR buffer, and 2 μL of 50-100 ng DNA template. 0.2 μL of Taq enzyme and 11.8 μL of ddH2O.

[0012] As a further aspect of the present invention, the specific operation of step S3 includes:

[0013] S1. Using Nanjing 9108 as the female parent, F1 generation seeds were obtained by crossing it with Xiushui 134 and Wuyunjing 24 respectively.

[0014] S2. Plant F1 generation plants and backcross them with Nanjing 9108 to obtain BC1F1 generation seeds;

[0015] S3. Plant BC1F1 generation plants and utilize P1. PijxSingle plants carrying the Pijx and Pikh genes and with agronomic traits similar to Nanjing 9108 were selected using the FM143 marker and backcrossed to the BC3F1 generation.

[0016] S4. Using single plants carrying the Pijx gene from the BC3F1 generation as the female parent and single plants carrying the Pikh gene as the male parent, perform a recross to obtain the recrossed plants. F1 generation seeds;

[0017] S5. Plant F1 generation plants from multiple crosses, screen for single plants carrying both Pijx and Pikh genes, and harvest F2 generation seeds.

[0018] S6. Plant F2 to F5 generation lines, detect homozygous double-resistant lines by molecular markers, and combine agronomic trait determination, yield-to-quality ratio and rice blast resistance identification to finally screen and obtain stable resistant japonica rice materials.

[0019] As a further aspect of the present invention, a marker P1 for detecting the Pijx gene is used. Pijx The primer sequences are:

[0020] SEQIDNO.1:[GAGATTTGTTGATTGTGTCC];

[0021] SEQ ID NO.2: [CTCTAAACAACTAACACAGG], expected amplification product size is 326bp;

[0022] The marker FM143 used for detecting the Pikh gene has the following primer sequence:

[0023] SEQIDNO.3:[CCCAACATTGTAGTAGTGC];

[0024] SEQ ID NO.4: [TCCTTCATACGCAACAATCT], the expected amplified product size is 258bp.

[0025] The present invention achieves the following technical effects compared to the prior art:

[0026] The Pijx gene aggregated in this invention is a novel resistance gene that has not been widely used, while the Pikh gene is a verified broad-spectrum resistance gene. The two have different resistance mechanisms. After aggregation, the resistance spectrum and resistance persistence of the variety against rice blast fungus can be significantly improved, avoiding the problem of single-gene varieties being prone to loss of resistance.

[0027] The japonica rice material (Nanjing 9108) cultivated in this invention Pijx+PikhThe plant height and sowing start date were basically the same as the control variety Nanjing 9108, and the yield per mu reached 621.5 kg, which was comparable to the control. The quality traits such as hulling rate, milled rice rate, head rice rate, and amylose content were not significantly different from the control, and the excellent eating characteristics were maintained.

[0028] The resistance frequency of this material to seedling blast reached 96.78% in 2022 and 97.54% in 2023, and the resistance frequency to panicle blast reached 75.67% in 2022 and 78.32% in 2023. The overall resistance evaluation was moderately resistant (MR), while the overall resistance evaluation of the control cultivar Nanjing 9108 was susceptible (S), showing a significant improvement in resistance.

[0029] Marker-assisted selection can quickly and accurately screen individual plants carrying target genes in early generations, significantly reducing field screening workload, shortening the breeding cycle, and improving breeding efficiency. Attached Figure Description

[0030] Figure 1 A flowchart illustrating a method for breeding stable resistant japonica rice materials by aggregating the broad-spectrum rice blast resistance genes Pijx and Pikh. Detailed Implementation

[0031] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] 1. Breeding materials

[0033] Donor parent 1: Xiushui 134 (bred by Jiaxing Academy of Agricultural Sciences, Zhejiang Province, a mid-maturing late-maturing japonica variety carrying the broad-spectrum rice blast resistance gene Pijx throughout the entire growth period);

[0034] Donor parent 2: Wuyunjing 24 (bred by Jiangsu (Wujin) Rice Research Institute, a high-yielding variety carrying the broad-spectrum rice blast resistance gene Pikh).

[0035] Recipient / Intermediate Parent: Nanjing 9108 (bred by Jiangsu Academy of Agricultural Sciences, a high-quality japonica rice variety with weak resistance to rice blast, used as a target for modification).

[0036] 2. Test site and environment

[0037] Summer planting location: Yangzhou, Jiangsu (conventional rice planting environment, natural conditions for rice blast disease).

[0038] Winter planting location: Sanya, Hainan (for accelerated generation propagation, short-day environment, and accelerated generation process).

[0039] 3. Detailed breeding process

[0040] (1) Breeding (Summer 2018, Yangzhou, Jiangsu): Using Nanjing 9108 as the female parent, it was artificially hybridized with Xiushui 134 and Wuyunjing 24 respectively. After pollination, the plants were bagged and isolated. After maturity, 21 seeds of Nanjing 9108 / Xiushui 134 F1 generation and 26 seeds of Nanjing 9108 / Wuyunjing 24 F1 generation were harvested.

[0041] (2) BC1F1 generation cultivation (Winter and spring of 2018-2019, Sanya, Hainan): 15 plants of Nanjing 9108 / Xiushui 134 F1 generation and 18 plants of Nanjing 9108 / Wuyunjing 24 F1 generation were planted. When the plants grew to the heading stage, backcrossing was carried out with the F1 generation plants as the male parent and Nanjing 9108 as the female parent. 85 and 96 seeds of BC1F1 generation were harvested respectively.

[0042] (3) BC2F1 generation cultivation (Summer 2019, Yangzhou, Jiangsu): 65 Nanjing 9108 / Xiushui 134 BC1F1 generation plants were planted, and DNA was extracted from the leaves of each individual plant. P1 was used to analyze the DNA. Pijx The markers were amplified by PCR and detected by gel imaging. Five single plants carrying the Pijx gene and with agronomic traits (plant type, leaf shape, maturity date) similar to Nanjing 9108 were screened. These plants were backcrossed with Nanjing 9108 to obtain 76 seeds of the BC2F1 generation. Nanjing 9108 / Wuyunjing varietals were planted concurrently. Of the 78 plants, 5 single plants carrying the Pikh gene and with similar agronomic traits were selected using the FM143 marker, and 68 seeds of the BC2F1 generation were obtained by backcrossing.

[0043] (4) BC3F1 generation cultivation (Winter and spring of 2019-2020, Sanya, Hainan): 62 plants of Nanjing 9108 / Xiushui 134 BC2F1 generation were planted and cultured using P1. Pijx Five plants carrying the Pijx gene and with similar agronomic traits were selected by marker detection and backcrossed to obtain 56 seeds of the BC3F1 generation. Fifty-five plants of Nanjing 9108 / Wuyunjing 24 BC2F1 generation were planted, and five plants carrying the Pijx gene and with similar agronomic traits were selected by FM143 marker detection and backcrossed to obtain 48 seeds of the BC3F1 generation.

[0044] (5) Re-examination Cultivation under contract (Summer 2020, Yangzhou, Jiangsu): Planting of Nanjing 9108 / Xiushui Forty-two F1 generation plants and forty F1 generation plants of Nanjing 9108 / Wuyunjing 24 were identified as carrying the target gene through corresponding marker detection. Five plants carrying the Pijx gene were selected as the female parent and five plants carrying the Pikh gene were selected as the male parent for artificial crossbreeding. A total of 68 F1 generation seeds were harvested.

[0045] (6) Screening of F1 generation after cross (Winter and Spring of 2020-2021, Sanya, Hainan): 51 F1 generation plants were planted, and DNA was extracted and screened using P1. Pijx Using FM143 dual-marker detection, 21 resistant single plants carrying both Pijx and Pikh genes were screened, and F2 generation seeds of each single plant were harvested after maturity.

[0046] (7) Screening of F2~F3 generation (summer of 2021 - winter and spring of 2022): In the summer of 2021, 21 double-resistant F2 generation lines were planted in Yangzhou, Jiangsu Province, with 100 plants of each line. 65 resistant lines carrying Pijx and Pikh genes were screened by double marker detection, and F3 generation seeds were harvested. In the winter and spring of 2021-2022, 65 F3 generation lines were planted in Sanya, Hainan Province. 35 double-resistant homozygous lines were screened by double marker detection, and 16 superior lines were selected based on agronomic traits (plant height, maturity, and seed setting rate).

[0047] (8) F4 generation identification (Summer 2022, Yangzhou, Jiangsu): Sixteen F4 generation lines were planted, and field agronomic traits (plant height, sowing start date, yield components) and rice blast resistance were determined (seedling blast, leaf blast, panicle blast incidence and loss index) were conducted. Five superior lines were selected.

[0048] (9) F5 generation finalization (Summer 2023, Yangzhou, Jiangsu): Five superior F5 lines were planted, and a triple-plot experiment was set up with 0.02 mu per plot. Yield-to-quality ratio identification, agronomic trait retesting and rice blast resistance verification were carried out. Finally, one stable resistant japonica rice material was determined and named Nanjing 9108. Pijx+Pikh .

[0049] 4. Detection and Identification Methods

[0050] (1) DNA extraction: CTAB method was used to extract genomic DNA from rice leaves. The purity and concentration of DNA were detected by agarose gel electrophoresis and ultraviolet spectrophotometer to ensure that it met the requirements for PCR amplification.

[0051] (2) PCR amplification: Prepare PCR reaction solution according to the system described in 2.2 above. The amplification program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 10 min; store at 4℃.

[0052] (3) Gel imaging analysis: PCR products were subjected to 1.5% agarose gel electrophoresis (120V, 30min), EB staining, and observed through a gel imaging system. If a 326bp band appeared, it was determined that the Pijx gene was carried, and if a 258bp band appeared, it was determined that the Pikh gene was carried.

[0053] (4) Agronomic traits determination: Plant height, sowing date, number of panicles, total number of grains per panicle, seed setting rate, thousand-grain weight and yield per mu were determined in accordance with the "Technical Regulations for Regional Trials of Rice Varieties".

[0054] (5) Quality traits determination: The brown rice rate, milled rice rate, head rice rate, chalkiness rate, chalkiness, length-width ratio, amylose content, gel consistency and transparency were determined in accordance with GB / T 17891-2021 "High-quality rice".

[0055] (6) Rice blast resistance identification: The method of combining natural induction identification and artificial inoculation identification is adopted. Seedling blast is investigated during the seedling stage, and leaf blast and panicle blast are investigated during the peak of disease occurrence. The disease level is recorded according to the grading standard of the "Technical Regulations for Rice Blast Resistance Identification", and the resistance frequency, disease incidence and loss index are calculated to comprehensively evaluate the resistance level.

[0056] 5. Results and Analysis

[0057] (1) Agronomic traits and yield: The cultivated Nanjing 9108 Pijx+Pikh The plant height was 96.5 cm, and the sowing period was 97 days, which was basically the same as the control variety Nanjing 9108 (plant height 96.8 cm, sowing period 97 days); the number of panicles per mu was 225,000, the total number of grains per panicle was 141.3, the seed setting rate was 91.6%, the thousand-grain weight was 26.3 g, and the yield per mu was 621.5 kg, which was not significantly different from the control (yield per mu 620.3 kg), maintaining excellent high yield (see table below).

[0058] (2) Quality characteristics: The material has a hulling rate of 84.5%, a milled rice rate of 74.2%, a head rice rate of 72.3%, a chalkiness rate of 36.4%, a chalkiness of 8.7%, a length-to-width ratio of 1.8, a straight-chain starch content of 10.5%, a gel consistency of 78 mm, and a transparency grade of 2. All quality indicators are comparable to the control variety Nanjing 9108, and it maintains excellent taste characteristics (see table below).

[0059]

[0060] (3) Rice blast resistance: The resistance identification results in 2022-2023 showed that Nanjing 9108 Pijx+Pikh The resistance frequencies to seedling blast were 96.78% and 97.54%, respectively, and the resistance frequencies to panicle blast were 75.67% and 78.32%, respectively; the comprehensive resistance index was 3.5, and the resistance evaluation was moderately resistant (MR); while the control variety Nanjing 9108 had a resistance frequency of only 10.56%~12.23% to seedling blast and a resistance frequency of 6.78%~7.56% to panicle blast, with a comprehensive resistance index of 6.75 and a resistance evaluation of susceptible (S). The resistance enhancement effect was extremely significant (see table below).

[0061] This invention utilizes marker-assisted selection technology to successfully integrate the broad-spectrum rice blast resistance genes Pijx and Pikh into the superior eating japonica rice variety Nanjing 9108, resulting in the stable resistant japonica rice material Nanjing 9108. Pijx+Pikh While maintaining its original excellent agronomic traits, yield, and quality, it significantly improves resistance to rice blast, and the resistance is stable and long-lasting. It provides a new variety option for the green control of rice blast and has important production application value and promotion prospects.

[0062] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention shall still fall within the scope of the technical solution of the present invention.

Claims

1. A method for breeding stable resistant japonica rice material by aggregating broad-spectrum blast resistance genes Pijx and Pikh, characterized in that, The method comprises the following steps: S1, selecting Xiusui 134 carrying Pijx gene and Wuyunjing 24 carrying Pikh gene as resistance gene donor parents, and selecting Nanjing 9108 as a receptor parent and intermediate modification material; S2, extracting genomic DNA of the parents and each generation of offspring; S3, PCR amplification of genomic DNA using functional markers including P1 Pijx (Primer sequences are SEQ ID NO. 1 and SEQ ID NO. 2) and FM143 (primer sequences are SEQ ID NO. 3 and SEQ ID NO. 4) for detecting Pikh gene; S4, screening single plants carrying Pijx and Pikh genes simultaneously by gel imaging analysis of PCR products, combining agronomic trait selection, backcrossing, multiple crossing and multiple generations of self-crossing to obtain stable resistant japonica rice materials; The total volume of the PCR amplification system is 20 μL, including: 1.5 μL of forward and reverse primers, respectively, 2 μL of dNTPs, 2 μL of 10×PCR buffer, 2 μL of 50-100 ng of DNA template, 0.2 μL of Taq enzyme, and 11.8 μL of ddH2O.

2. The method of breeding stable resistant japonica rice material with polymeric broad spectrum blast resistance genes Pijx and Pikh as claimed in claim 1, wherein, The specific operation of step S3 comprises: S1, using Nanjing 9108 as the female parent, and crossing with Xiusui 134 and Wuyunjing 24 to obtain F1 generation seeds; S2, planting F1 generation plants and backcrossing with Nanjing 9108 to obtain BC1F1 generation seeds; S3, planting BC1F1 generation plants, using P1 Pijx , FM143 marker to screen single plants carrying Pijx, Pikh genes and similar agronomic traits to Nangeng 9108, and continue backcrossing to BC3F1 generation; S4, using single plants carrying Pijx gene in BC3F1 generation as the female parent, and using single plants carrying Pikh gene as the male parent to perform multiple crossing to obtain multiple crossing F1 generation seeds; S5, planting multiple crossing F1 generation plants, screening double-resistant single plants carrying Pijx and Pikh genes simultaneously, and harvesting F2 generation seeds; S6, planting F2-F5 generation strains, detecting homozygous double-resistant strains by molecular markers, combining agronomic trait determination, yield comparison and rice blast resistance identification, and finally screening stable resistant japonica rice materials.

3. The method for breeding stable resistant japonica rice materials of the polymeric broad-spectrum rice blast resistance genes Pijx and Pikh according to claim 1 or 2, wherein, Marker P1 for detecting Pijx gene Pijx with the primer sequence of: SEQ ID NO. 1: [GAGATTTGTTGATTGTGTCC]; SEQ ID NO. 2: [CTCTAAACAACTAACACAGG], and the expected amplification product size is 326 bp; The marker FM143 for detecting Pikh gene has the following primer sequences: SEQ ID NO. 3: [CCCAACATTGGTAGTAGTGC]; SEQ ID NO. 4: [TCCTTCATACGCAACAATCT], and the expected amplification product size is 258 bp.