Specific markers, primer pairs, detection methods, kits, and applications for insertional variants in the mical2 gene of the striped rock seabream.

Abstract

This invention relates to the field of molecular biology, and more specifically to specific markers, primer pairs, detection methods, kits, and applications for insertion mutations in the *Mical2* gene of the striped rock seabream. The specific markers are DNA fragments with non-insertion and insertion-specific markers within the intron region of the *Mical2* gene of the striped rock seabream, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2. This invention uses a pair of specific primers to amplify 118 bp and 391 bp bands in individuals with DNA insertion mutations, while only amplifying the 118 bp band in individuals without insertion mutations. The detection method of this invention significantly shortens the identification time, improves detection efficiency, and has important application value in sex determination, high-male-ratio seedling preparation, and family selection of the striped rock seabream.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically to specific markers, primer pairs, detection methods, kits, and applications for insertional variations in the mical2 gene of the striped seabream. Background Technology

[0002] Striped rock sea bream ( Oplegnathus punctatus Belonging to the family Lycopodiaceae and the genus Lycopodiace, this species is widely distributed in the tropical and subtropical waters of the western Pacific Ocean and is an important economically important marine aquaculture fish. This species possesses a unique X1X1X2X2 / X1X2Y sex determination system, with females having a karyotype of 2n=48 (X1X1X2X2) and males having a karyotype of 2n=47 (X1X2Y). The Y chromosome is significantly larger and exhibits clear structural differentiation from its X1X2 homologous chromosomes. Aquaculture practices have shown significant sexual dimorphism in the growth of Lycopodiace, with males growing significantly faster than females, providing a crucial economic impetus for asexual breeding. Therefore, developing molecular sex markers based on sex chromosome differences to achieve accurate early sex identification is of great value for the preservation and utilization of high-quality male germplasm resources. Cultivating high-male-ratio or all-male fry through sex-controlled breeding technology is a key breakthrough direction for improving the efficiency of Lycopodiace aquaculture and promoting industrial development.

[0003] The Mical2 gene (Microtubule-Associated Monooxygenase, Calponin and LIM Domain Containing 2) is a member of the flavoprotein monooxygenase family and the microtubule-associated monooxygenase family. The protein encoded by the Mical2 gene primarily functions as an NAD(P)H oxidase and binds to actin and mitogen-activated protein kinases (MAPKs). These interactions promote key cellular processes such as cell growth and apoptosis-related signaling pathways. Studies have found that the mical2 gene is located on chromosome 7 in mice and chromosome 11 in humans, highlighting its important biological functions due to its high cross-species conservation. Furthermore, research indicates that the mical2 gene may influence tumor progression by regulating the serum response factor (SRF) signaling pathway, and is closely related to tumor metastasis and development. To date, there are no reports of genetic identification of male and female striped rockfish based on intron DNA insertion variations in the mical2 gene. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies for detecting intron DNA insertion variations in the mical2 gene of the striped rock seabream, and to provide specific markers, primer pairs, detection methods, kits, and applications for detecting insertion variations in the mical2 gene of the striped rock seabream.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A specific marker for insertion variation in the mical2 gene of the striped seabream is provided. The specific marker is a DNA fragment of non-insertion and insertion-specific markers in the intron region of the mical2 gene of the striped seabream. The nucleotide sequences of the DNA fragments are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] The nucleotide sequence of the non-insertion and insertion-specific marker DNA fragment of the intron region of the *Mical2* gene of the striped rock seabream, as shown in SEQ ID NO:1, is a common DNA feature marker for both non-insertion and insertion individuals in the intron region of the *Mical2* gene of the striped rock seabream; and the inserted sequence fragment (273 bp) between positions 33 and 34 of the base sequence shown in SEQ ID NO:1 is the base sequence shown in SEQ ID NO:2.

[0008] The application of a specific marker for the insertional variation of the mical2 gene in the striped rock seabream, and the application of the specific marker in identifying the genetic sex of the striped rock seabream.

[0009] A primer for a specific marker to detect the insertional variation in the mical2 gene of the striped seabream:

[0010] Ch mical2 _F:1 : 5'-GAAAACTTTGTCGGAGGTTCTC-3';

[0011] Ch mical2 _R:2 : 5'-AAAGACCTTTTGAAAAGGAGCATTT-3'.

[0012] An application of the primers described herein, specifically their use in detecting the genetic sex of male and female striped seabream.

[0013] A kit for identifying the genetic sex of striped rock seabream, the kit containing the aforementioned primers.

[0014] A method for detecting the genetic sex of striped rock seabream.

[0015] 1) PCR amplification: Take the striped rock seabream to be tested and extract its genomic DNA; use the obtained genomic DNA as a template, use the intron-specific primers of the striped rock seabream micro2 gene to perform PCR amplification, and compare the obtained PCR amplification product with the specific markers.

[0016] 2) Result interpretation: Amplifying DNA fragments from the genomic DNA of the striped seabream to be tested is the determination that the striped seabream to be tested is an individual with DNA fragment insertion variation in the intron region of the mical2 gene; at the same time, the genetic sex of the striped seabream to be tested can be distinguished.

[0017] In step 2), only a single DNA fragment of 118 bp was amplified in the genomic DNA of the striped rock seabream to be tested, which means that the striped rock seabream to be tested is an individual in which no DNA fragment insertion variation has occurred in the intron region of the striped rock seabream mical2 gene; this individual is female X1X1X2X2.

[0018] Two DNA fragments, 391bp and 118bp, were amplified in the genomic DNA of the striped rock seabream to be tested. This indicates that the striped rock seabream to be tested is an individual with DNA fragment insertion variation in the intron region of the striped rock seabream mical2 gene; this individual is the male X1X2Y.

[0019] Advantages of this invention:

[0020] This invention provides a rapid and accurate method for detecting intron DNA insertion variations in the *mical2* gene of the striped rockfish to identify its genetic sex. This method compares the *mical2* gene on the Y chromosome of male striped rockfish with its homologous gene on the X chromosome of female striped rockfish, revealing a large sequence insertion in the intron of the *mical2* gene on the Y chromosome. This discovery is significant for understanding the differences in the regulatory mechanisms of cell growth and apoptosis in male and female striped rockfish, and enables rapid genetic sex identification, thereby accelerating the genetic breeding process of striped rockfish and improving the efficiency of large-scale production of high-quality seedlings.

[0021] This invention, through analysis of the whole genome sequence of the striped rock seabream, successfully screened and obtained specific large-fragment DNA insertion marker sequences of homologous regions of the introns of the micro2 gene on the X and Y chromosomes. Based on this, a rapid method for detecting DNA insertion variations in the micro2 gene of striped rock seabream was established to distinguish their genetic sex. This method uses a pair of primers to amplify two DNA fragments of 391 bp and 118 bp in individuals with DNA insertion, while only a 118 bp fragment is amplified in individuals without insertion. These two cases can be easily distinguished using agarose gel electrophoresis, significantly improving the speed and accuracy of detection. This method not only simplifies the identification process of intron variations in the micro2 gene of striped rock seabream but also shortens the identification time and improves detection efficiency. Furthermore, this method has broad application prospects in the fields of sex determination, preparation of male seedlings, and family selection in striped rock seabream, and has significant economic and scientific value for promoting the development of striped rock seabream aquaculture. Attached Figure Description

[0022] Figure 1 This is a nucleotide sequence alignment diagram of the intron region of the female sex marker mical2 gene and the X1 chromosome provided in an embodiment of the present invention; the modules connected by the connecting lines in the diagram represent highly homologous regions of the female mical2 gene intron region on the X1 chromosome and their location information.

[0023] Figure 2 ChrX1 provided for embodiments of the present invention mical2 and Chry mical2 Location information of homologous sequence alignment; 118bp represents ChrX1 mical2 The length of the fragment, 391bp represents Chrys. mical2 Length; Chry mical2 The middle low region represents the inserted 273bp nucleotide sequence, which is related to ChrX1. mical2 The fragment has no homologous matching sequence.

[0024] Figure 3 The X chromosome ChrX1 obtained as provided in the embodiments of the present invention mical2 ChrY with Y chromosome mical2 Nucleotide sequence alignment diagram, with primer positions at both ends indicated by double black underlines; *: represents ChrX1 mical2 and Chry mical2 Sequence consistency: blank areas indicate sequences with inconsistent bases; ------: represents insertion or deletion sequences; black single underline represents the region where the insertion sequence is located.

[0025] Figure 4 The X chromosome ChrX1 provided in the embodiments of the present inventionmical2 ChrY with Y chromosome mical2 A schematic diagram of differentially inserted DNA fragments with homologous nucleotide sequences; black areas represent homologous regions, and blank areas represent deleted regions and site information.

[0026] Figure 5 The image shows the 1.5% agarose gel electrophoresis results of PCR products from male and female striped rockfish provided in this embodiment of the invention. M: DL 2000 DNA Maker; ♂: physiological male fish; ♀: physiological female fish. Individuals showing two bands (391bp and 118bp) are individuals with DNA insertion in the intron of the microcal2 gene, which are also genetically male fish, and are physiologically male based on histological identification. Individuals showing a single band (118bp) are individuals without DNA insertion in the intron of the microcal2 gene, which are also genetically female fish, and are physiologically female based on histological identification. Detailed Implementation

[0027] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0028] This invention first used third-generation PacBio whole-genome sequencing technology to complete the sequencing and assembly of the whole genomes of male and female striped rockfish, obtaining high-quality genomes at the chromosome level (SRP160016, SRP220007, Xiao et al., 2019, 2020). Through genomic bioinformatics analysis, a large DNA sequence insertion variation was found in the microcal2 gene on the male Y chromosome compared to its homologous gene on the female X1 chromosome (e.g., ...). Figure 1 (As shown). This invention selects the intron region 27,888,421bp to 27,888,538bp of the micro2 gene on the X1 chromosome of female fish and the homologous region 27,319,037bp to 27,319,427bp of the Y chromosome of male fish as the research target regions. Figure 1 On chromosome X1, the DNA fragment is 118 bp in length and is named ChrX1. mical2 Its sequence is shown in SEQ ID NO:1; while on the Y chromosome, the DNA fragment is 391 bp in length and contains a sequence homologous to the micro2 gene on the X1 chromosome, and is named ChrY. mical2 Its sequence is shown in SEQ ID NO:2. Through analysis of ChryY... mical2 With ChrX1 mical2 Alignment with homologous sequences revealed that in ChrX1 mical2There is a 273bp DNA sequence insertion between positions 33 and 34 (e.g. Figure 2 (As shown). This inserted sequence serves as a DNA marker for detecting whether a base insertion variation has occurred in the intron of the *mical2* gene in the striped rock seabream; simultaneously, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, this fragment is also a DNA marker unique to the Y chromosome of male striped rock seabream, while ChrX1... mical2 This is a DNA characteristic marker shared by males and females of the striped rock seabream.

[0029] This invention utilizes a long DNA insertion sequence marker found at positions 27,319,037bp~27,319,427bp within the intron region of the *mical2* gene on the Y chromosome of male *Sinocyclocheilus davidii* to determine whether DNA insertion mutations have occurred in the intron region of the *mical2* gene. This discovery facilitates a method for rapidly detecting intron mutations in the *mical2* gene of *Sinocyclocheilus davidii*, and further applies this method to the rapid identification of the genetic sex of *Sinocyclocheilus davidii*. Specifically, the detection method first confirms the presence of a Y chromosome-specific *mical2* gene nucleotide fragment (391bp) in the *Sinocyclocheilus davidii* sample. This step achieves rapid identification by designing specific PCR primers. This invention further analyzes the *mical2* gene sequence on the Y chromosome of *Sinocyclocheilus davidii* by comparing it with homologous sequences on chromosomes X1 and X2, thus identifying the *mical2* gene sequence on chromosome X1 (X...). mical2 ID No:1) A sequence on the Y chromosome homologous to the nucleotide sequence (Y mical2 ID No:2). Based on the characteristic of a large DNA insertion on the Y chromosome in this homologous intron region, a pair of primers was designed. Analysis of the PCR products by 1.5% agarose gel electrophoresis can quickly determine whether a DNA insertion variation has occurred in the intron of the *Mical2* gene in *Sinocyclocheilus spp.* Furthermore, since this DNA insertion marker is located on the male Y chromosome and exhibits sex-linked inheritance, it is also suitable for accurately identifying the genetic sex of *Sinocyclocheilus spp.* The upstream and downstream primer sequences are as follows:

[0030] Ch mical2 _F:1 : 5'-GAAAACTTTGTCGGAGGTTCTC-3' (X mical2 ID No:2 (SEQ ID NO:3)

[0031] Ch mical2 _R:2 : 5'-AAAGACCTTTTGAAAAGGAGCATTT-3'(X mical2 ID No:3 (SEQ ID NO:4).

[0032] The steps for identifying intron insertion variants in the mical2 gene of the striped rock seabream using the above primers mainly include: extracting high-quality whole-genome DNA from the striped rock seabream, amplifying the specific marker DNA fragment of the intron insertion on the mical2 gene on the Y chromosome, and detecting the PCR product DNA by agarose gel electrophoresis; among them, two DNA fragments of 391bp and 118bp were amplified in the Y chromosome and X1 chromosome of male striped rock seabream (X1X2Y), respectively, and the 391bp fragment was a marker fragment specific to the variant intron mical2 gene; while in female striped rock seabream (X1X1X2X2) individuals, only a single DNA fragment of 118bp was amplified.

[0033] This invention is based on whole-genome sequencing of male and female striped rockfish and localization and DNA sequence alignment analysis of the micro2 gene in male and female individuals. It reveals a long-segment insertion mutation in the intron region of the micro2 gene on the Y chromosome of male striped rockfish. This insertion mutation serves as a unique DNA marker for intron insertion in the micro2 gene on the Y chromosome of striped rockfish. This method allows for rapid sexing of striped rockfish by utilizing micro2 gene intron insertion mutations. It can quickly, accurately, and efficiently distinguish whether the tested striped rockfish have micro2 gene intron insertion mutations. In striped rockfish individuals with micro2 gene intron mutations, two bands (391 bp and 118 bp) are amplified, with the 391 bp band being the specific target band. In individuals with non-mutated introns, only a single band (118 bp) is amplified. These target bands can be rapidly and accurately distinguished using agarose gel electrophoresis, enabling rapid identification of whether micro2 gene intron mutations have occurred in striped rockfish. Meanwhile, since this specific target band (391bp) is located on the male Y chromosome and has male-linked inheritance characteristics, this fragment is also a DNA marker unique to the Y chromosome of male striped rockfish, and can be used for rapid identification of the genetic sex of male striped rockfish.

[0034] Example 1: Screening and Validation of DNA Markers Specific to Intron Base Insertion Variations in the mical2 Gene of the Rockfish

[0035] Discovery of homologous regions of the micro2 gene on the X and Y chromosomes of the striped rock seabream, containing a large inserted target DNA sequence: The DNA sequences from the neo-Y chromosome of male fish and the X1 chromosome of female fish were obtained from the research team of Li Jun at the Marine Fish Culture and Breeding Technology Laboratory, Institute of Oceanology, Chinese Academy of Sciences. The team commissioned Wuhan Fraser Gene Information Co., Ltd. to complete the sequencing and assembly of the whole genomes of male and female striped rock seabream using the third-generation PacBio whole-genome sequencing technology. The assembly results have been published (SRP160016, SRP220007, Xiao et al., 2019, 2020). Comparative genomic bioinformatics analysis of the male and female striped rock seabream genome sequences showed that the micro2 gene on the neo-Y chromosome of male striped rock seabream is homologous to the micro2 gene on the X1 chromosome of female striped rock seabream, and a large DNA inserted fragment exists. The target DNA fragment of the micro2 gene on the X1 chromosome is 118 bp in length and is named ChrX1. mical2 Its sequence is SEQ ID NO:1:

[0036] GAAAACTTTGTCGGAGGTTCTCCAGTGTTATTAAATTATTTTTAAAATCAAAATTGTATTTGTTTTTTTAAAAACTGAATTATAGAAACTTCAAAATGCTCCTTTTCAAAGGTCTTT.

[0037] The target DNA fragment of the mical2 homologous gene on the male fish's heteromorphic Y chromosome is 391 bp in length, and it contains a sequence homologous to X1, named ChrY. mical2 Its sequence is SEQ ID NO:2:

[0038] GAAAACTTTGTCGGAGGTTCTCCAGTGTTATAAGAGCCTCACTGGGCATCAAGTGACAGATGATCATTTCCCTCTGGCTGAAGACAAAATTAGTAAGGCAGTCCTTTATGACATTTTAAGCCCATTAAAAGGCTTAAATGAAGGGCATAAACGAAAGACGAGTGGTAATATATGGAGCCCACAGGTGTTCAATATT CAATATATCACATGAATAAATTGTGTAAAATATATAAATTAACCAGTAATTTGTGAACTAATTTAAGAAATGATTAAAACTCAGCTAATTATTATGAAATATTATTTCATAATTATTTTTAAAATCAAAATTGTATTTGTTTTTTAAAAAAATTGAATTATAGAAACTTCAAAATGCTCCTTTTCAAAGGTCTTT.

[0039] Whole genome scans of males and females, along with the localization and DNA sequence alignment of the micro2 gene in both individuals, showed that it is related to the micro2 gene segment ChrX located on chromosome X1. mical2 homologous Chrys mical2 One intron DNA sequence insertion occurred on the Y chromosome, corresponding to ChrX1. mical2 Between positions 33 and 34, the size is 273 bp ( Figure 3 , Figure 4 The target region of the micro2 gene on the Y chromosome (ChrY) mical2 DNA sequence ratio with homologous DNA regions of chromosome X1 (ChrX1) mical2 A 273bp DNA sequence was inserted, which is a unique DNA marker for intron insertion mutations in the *ChrY* gene of the striped rock seabream. Its presence or absence can be used to identify *ChrY*. mical2 Whether the gene has undergone intron insertion variation. Furthermore, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, therefore, ChrY... mical2 This fragment is also a DNA marker unique to the Y chromosome of male striped rockfish, and ChrX1 mical2 These are DNA markers shared by males and females of the striped rock seabream, such as... Figure 3 As shown.

[0040] Sequence verification of DNA markers specific to intron insertion variants in the mical2 gene: Based on the nucleotide sequence characteristics of SEQ ID NO:2 of the mical2 gene on the Y chromosome and the homologous gene SEQ ID NO:1 on the X1 chromosome, two primers were designed ( Figure 1 Selected female and male striped rock seabream of known physiological sex and extracted high-quality DNA from them, while using Ch... mical2 _F:1、Ch mical2 PCR amplification was performed using two primers, _R:2. The reaction conditions and procedure are as follows: The PCR reaction system was 20 µL, including 5.8 µL of 10× Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), and upstream and downstream primers (Ch mical2 _F:1、Ch mical2 _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch-down PCR amplification program: 94℃ 3mins, 59℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 57℃ 30s, 72℃ 1min30s, 30 cycles; 72℃ 10min, 15℃ storage. PCR products were distinguished by 1.5% agarose gel electrophoresis, revealing differences between intron-variant and non-variant mical2 gene individuals. The differentially expressed mical2 gene fragments were recovered from the gel and transformed into competent cells using the PMD18-T vector. Positive clones were selected and sent to Qingdao Paisennuo Gene Biotechnology Co., Ltd. for sequencing. Sequencing results confirmed that the homologous mical2 gene on the X and Y chromosomes of the striped rock seabream contains a large inserted target DNA sequence fragment, such as... Figure 1 and Figure 2 As shown.

[0041] Example 2: Establishment and Application of Intron Insertion Variation Identification Technology for the mical2 Gene of the Rockfish

[0042] Genetic identification was conducted on striped rock seabream (12 of which were female and 12 were male) raised by Laizhou Mingbo Aquatic Products Co., Ltd. in Laizhou City, Yantai, Shandong Province.

[0043] High-quality DNA extraction: DNA was extracted from the fin rays of the striped rock seabream using the Tiangen Marine Animal DNA Extraction Kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured using a UV spectrophotometer. The DNA concentration was adjusted to 70 ng / µL and stored at -20℃ for later use.

[0044] PCR reaction system and PCR amplification identification: Primers specific to the intron insertion variation of the *Mical2* gene of the striped sea bream were used.mical2 _F:1 and Ch mical2 _R:2 The presence of intron variations in the *Mical2* gene of the striped rock seabream was detected by PCR. The PCR reaction system was 20 µL, including 5.8 µL of 10×Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), and upstream and downstream primers (Ch... mical2 _F:1、Ch mical2 _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch-down PCR amplification program: 94℃ 3mins, 59℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 57℃ 30s, 72℃ 1min30s, 30 cycles; 72℃ 10min, 4℃ storage. Using 1.5% agarose gel electrophoresis at a constant voltage of 110V for 20 minutes, gel imaging clearly distinguished between individuals with and without DNA insertion in the introns of the striped rock seabream (see [link to relevant documentation]). Figure 5 ).

[0045] Depend on Figure 5 It is evident that two target bands (391 bp and 118 bp) are amplified in individuals of the striped rock seabream with DNA insertion in the intron of the mical2 gene. Among them, the 391 bp band is the ChrY band, which is a specific target band for DNA insertion variation in the intron of the mical2 gene. mical2 In individuals where no DNA insertion variation has occurred in the introns of the micro2 gene, only a single band of ChrX1 can be amplified. mical2 (118bp). Due to ChrY mical2 The marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics; therefore, ChrY... mical2 This fragment is also a DNA marker unique to the Y chromosome of male striped rockfish, and ChrX1 mical2 This method identifies the shared DNA markers of male and female striped rock seabream, allowing for the differentiation of selected seabream. The method of this invention can not only rapidly, accurately, and efficiently identify whether the mical2 gene of the striped rock seabream has undergone intron insertion variation, but also has significant implications and application value in the study of differences in the regulation of cell growth and apoptosis between male and female striped rock seabream based on the mical2 gene, as well as in sex identification, high-male seedling preparation, and family breeding.

[0046] As described above, this invention utilizes a pair of primers to amplify 391bp and 118bp bands in individuals with DNA insertion mutations, while only a 118bp band is amplified in individuals without insertion mutations. These bands can be distinguished by agarose gel electrophoresis, thus enabling rapid and accurate identification of DNA insertion mutations in the introns of the *mical2* gene in *Syngonium stenoptera*. The detection method of this invention significantly shortens the identification time, improves detection efficiency, and has important application value in sex determination, high-male seedling preparation, and family selection in *Syngonium stenoptera*.

Claims

1. A specific molecular marker for the genetic sex determination of striped rock seabream, characterized in that: The specific molecular markers are DNA fragments with nucleotide sequences as shown in SEQ ID NO:1 and DNA fragments with nucleotide sequences as shown in SEQ ID NO:

2.

2. The application of the specific molecular marker as described in claim 1 in identifying the genetic sex of striped rock seabream, characterized in that: Specifically 1) PCR amplification: Take the striped rock seabream to be tested and extract its genomic DNA; use the obtained genomic DNA as a template and use primers to perform PCR amplification. The nucleotide sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:

4. 2) Result interpretation: If only a single DNA fragment of 118 bp is amplified from the genomic DNA of the striped rock seabream to be tested, it is determined that the striped rock seabream to be tested is female; Two DNA fragments, 391bp and 118bp, were amplified from the genomic DNA of the striped rock seabream, indicating that the seabream was male.

3. A primer for detecting the specific molecular marker of claim 1, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:

4.

4. The application of the primer according to claim 3 in detecting the genetic sex of male and female striped rock seabream, characterized in that, Specifically: 1) PCR amplification: Take the striped rock seabream to be tested and extract its genomic DNA; use the obtained genomic DNA as a template and use primers to perform PCR amplification. The nucleotide sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:

4. 2) Result interpretation: If only a single DNA fragment of 118 bp is amplified from the genomic DNA of the striped rock seabream to be tested, it is determined that the striped rock seabream to be tested is female; Two DNA fragments, 391bp and 118bp, were amplified from the genomic DNA of the striped rock seabream, indicating that the seabream was male.

5. A kit for identifying the genetic sex of striped rock seabream, characterized in that: The kit contains the primers as described in claim 3.

6. A method for detecting the genetic sex of male and female striped rock seabream using the primers described in claim 3, characterized in that, 1) PCR amplification: Take the striped rock seabream to be tested and extract its genomic DNA; use the obtained genomic DNA as a template and use primers to perform PCR amplification. The nucleotide sequences of the primers are shown in SEQ ID NO:3 and SEQ ID NO:

4. 2) Result interpretation: If only a single DNA fragment of 118 bp is amplified from the genomic DNA of the striped rock seabream to be tested, it is determined that the striped rock seabream to be tested is female; Two DNA fragments, 391bp and 118bp, were amplified from the genomic DNA of the striped rock seabream, indicating that the seabream was male.

Images