SNP markers associated with body color traits of the golden-red large-scaled loach and their applications
By screening for SNP markers related to body color in the breeding of golden-red large-scaled loach, designing a targeted mating scheme, and using SNP mutation sites to detect genotypes, the problems of maintaining genetic diversity and breeding efficiency in the breeding of golden-red large-scaled loach were solved, and the increase of population genetic diversity and the maintenance of excellent traits of body color were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGXI PROVINCIAL FISHERIES SCI RES INST (JIANGXI PROVINCIAL POYANG LAKE FISHERY RES CENT JIANGXI PROVINCIAL FISHERY RESOURCES ECOLOGICAL ENVIRONMENT MONITORING CENT)
- Filing Date
- 2026-02-12
- Publication Date
- 2026-04-21
AI Technical Summary
In the breeding of the golden-red large-scaled loach, how to effectively utilize limited parental resources, maintain the genetic diversity of the breeding population, improve breeding efficiency, and avoid inbreeding depression and loss of desirable traits is a key challenge.
By screening SNP markers associated with the body color trait of the golden-red large-scaled loach, a Mendelian mating scheme was designed. Utilizing the A/G polymorphism of the SNP mutation site located at 1353bp in the rp2 gene on chromosome 7 of the large-scaled loach, primer pairs were designed for PCR amplification. Genotypes were then detected using primer pairs or kits to achieve targeted mating and breeding.
It significantly increases the genetic diversity of the offspring population, promotes the breeding process of new varieties of golden-red large-scaled loach, improves breeding efficiency, and maintains the superior traits of the germplasm.
Smart Images

Figure CN121674590B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular marker technology, specifically to an SNP marker related to the body color trait of the golden-red large-scaled loach and its application. Background Technology
[0002] Wild-type large-scaled loach individuals have brown backs. This species is highly valued for its excellent aquaculture performance due to its rapid growth, short cultivation cycle, and high yield. Furthermore, it holds significant ecological value in water purification, biodiversity maintenance, and sustainable fisheries development. Currently, it has become a major farmed loach species in China, significantly boosting the country's loach farming output.
[0003] The golden-red large-scaled loach is a farmed species developed from a mutant of the large-scaled loach. Due to its golden-red body color, it has both edible and ornamental value, and has become increasingly popular among fish farmers and ornamental fish enthusiasts in recent years. Moreover, its market price is relatively high, and its economic value is far higher than that of the large-scaled loach. It has broad prospects for aquaculture promotion and market demand. Therefore, cultivating the new golden-red large-scaled loach can promote the development of aquaculture, as well as promote scientific research, ecological sustainable development and economic benefits. It has broad application prospects and important strategic significance.
[0004] The body color of the golden-red large-scaled loach is controlled by a recessive homozygous gene, with an extremely low natural mutation rate. In artificial breeding, a significant proportion of heterozygous individuals are eliminated because they exhibit wild-type body coloration, directly resulting in a small core breeding population. Against this backdrop, traditional breeding methods can lead to severe inbreeding depression with each generation, drastically increasing the risk of germplasm degradation and loss of desirable traits. Therefore, effectively maintaining the genetic diversity of the breeding population while utilizing limited parental resources for seedling production and improved breeding has become a key technical bottleneck restricting the development of this strain.
[0005] Body color, as a quality trait controlled by major genes, has clearly defined key genetic loci, providing a theoretical basis for genotyping of the large-scaled loach using molecular marker technology. In recent years, with the rapid development of modern molecular biology techniques and the deepening of the post-genomic era, single nucleotide polymorphisms (SNPs), as a new generation of molecular marker technology, have been widely used in molecular breeding research of aquatic animals, providing strong technical support for the development and breeding of superior varieties.
[0006] Therefore, screening for molecular markers related to body color traits for breeding selection is of great significance for improving breeding efficiency, developing new strains, and enhancing biodiversity. Summary of the Invention
[0007] The purpose of this invention is to at least solve one of the technical problems existing in the prior art, and to provide an SNP marker related to the body color trait of the golden-red large-scaled loach and its application.
[0008] The purpose of this invention is to provide an SNP mutation site, molecular marker, and application associated with the red mutation in the body color of *Parasitic scalytus*. By applying the SNP mutation site to the body color selection of *Parasitic scalytus*, and designing mating schemes according to Mendel's laws, the genetic diversity of the offspring population can be effectively increased.
[0009] The technical solution of the present invention is as follows:
[0010] In a first aspect, the present invention provides an SNP marker related to the body color trait of the golden-red Paramecium fasciatus, wherein the SNP marker is located at 1353 bp of the rp2 gene on chromosome 7 of Paramecium fasciatus as shown in SEQ ID NO:4, and its polymorphic form is A / G.
[0011] Optionally, the nucleotide sequence containing the SNP marker is shown in SEQ ID NO:1, wherein the SNP marker is located at 130 bp of the sequence shown in SEQ ID NO:1, and its polymorphism is A / G.
[0012] The aforementioned SNP markers are located at 1353 bp of the rp2 gene on chromosome 7 of *Parasitic scabra* as shown in SEQ ID NO:4, or at 130 bp from the 5' end as shown in SEQ ID NO:1. When the SNP markers on the two chromosomes are A and A respectively, it is called the AA genotype. *Parasitic scabra* with the AA genotype has a golden-red body color, i.e., the mutant—golden-red *Parasitic scabra*. When the SNP markers on the two chromosomes are A and G respectively, it is called the AG genotype. *Parasitic scabra* with the AG genotype has a brown body color, i.e., the wild-type *Parasitic scabra*. When the SNP markers on the two chromosomes are G and G respectively, it is called the GG genotype. *Parasitic scabra* with the GG genotype has a brown body color, i.e., the wild-type *Parasitic scabra*.
[0013] Optionally, the SNP marker has a genotype of AA, AG, or GG, wherein the body color of the large-scaled loach with genotype AA is golden red, and the body color of the large-scaled loach with genotype AG or GG is wild-type brown.
[0014] Secondly, the present invention provides a primer pair for detecting the SNP marker, the nucleotide sequences of the primer pair being shown in SEQ ID NO:2-SEQ ID NO:3.
[0015] Thirdly, the present invention provides a kit for detecting the body color trait of the golden-red large-scaled loach, the kit comprising the primer pair described above.
[0016] Fourthly, the present invention provides the application of the primer pair or the kit described herein in detecting the body color trait of the golden-red large-scaled loach.
[0017] Fifthly, the present invention provides a method for detecting the body color trait of the golden-red large-scaled loach, comprising the following steps:
[0018] The genomic DNA of the loach to be tested was amplified by PCR using the primer pair or the kit described above to obtain the PCR amplification product.
[0019] The genotype at the 130bp position of the PCR amplification product was detected.
[0020] Optionally, the loach test subject with genotype AA at 130bp of the PCR amplification product has a golden-red body color, and the loach test subject with genotype AG or GG at 130bp of the PCR amplification product has a wild-type brown body color.
[0021] Sixthly, the present invention provides the application of the primer pair or the kit described herein in the breeding of *Parasitic maculatus*.
[0022] Seventhly, the present invention provides a breeding method for a golden-red large-scaled loach, comprising the following steps:
[0023] Wild-type brown large-scaled loach with genotype AG was screened using the primer pairs or the kit described above and then cultured separately.
[0024] During the breeding season, wild-type brown large-scaled loach with genotype AG is selectively bred with golden-red large-scaled loach with genotype AA, or wild-type brown large-scaled loach with genotype AG is selectively bred with wild-type brown large-scaled loach with genotype AG.
[0025] Golden-red large-scaled loach with genotype AA were selected from the offspring for breeding.
[0026] This invention utilizes the aforementioned primers to detect the genotype of the SNP marker rp2-130 mutation site in potential broodstock individuals of *Parasitic scabra*, screening out individuals with the wild-type brown body color but the genotype AG. These individuals are then raised separately, and targeted mating is carried out during the breeding season: fertilization is performed between wild-type AG individuals and mutant AA individuals; fertilization is also performed between wild-type AG individuals and mutant AG individuals. Individuals with mutant body color are selected from the offspring for further breeding, thus realizing a breeding method for the golden-red body color trait of *Parasitic scabra*.
[0027] This invention has at least one of the following beneficial effects:
[0028] This invention provides a SNP locus associated with the body color trait of the golden-red large-scaled loach. The SNP molecular marker is located at position 1354 bp of the rp2 gene on chromosome 7 of the large-scaled loach. An A / G base mutation exists at this locus, which is significantly correlated with the golden-red body color trait of the large-scaled loach. Individuals with the AA genotype have a golden-red body color, while individuals with the AG and GG genotypes have a wild-type body color. The molecular marker provided by this invention can be used for breeding of the golden-red large-scaled loach, effectively increasing the genetic diversity of offspring and significantly promoting the breeding process for new varieties of the red-colored large-scaled loach. Attached Figure Description
[0029] Figure 1 The diagram shows the sequencing peaks of the amplified products in Example 1 for the three genotypes. In the diagram, a represents genotype AA, b represents genotype GG, and c represents genotype AG. Detailed Implementation
[0030] To make the technical problems solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
[0031] Example 1: Identification of polymorphic sites in the rp2 gene of *Paramis gargarizans* (golden-red large-scaled loach)
[0032] 1. Obtaining genomic DNA from different body colors of the large-scaled loach:
[0033] Thirty individuals each of the mutant golden-red variety of *Parasitic scabra* and the wild-type coloration variety of *Parasitic scabra* were obtained as test samples. Genomic DNA was extracted from the fin tissue of the test samples: Genomic DNA was extracted from the caudal fin tissue of the fish using the Seville Tissue / Cell / Blood Genomic DNA Extraction Kit (G3633).
[0034] After extraction, the integrity of the DNA was detected by 2% agarose gel electrophoresis. The quality and concentration of DNA were determined by NanoDrop2000 micro-spectrophotometer. The purity was considered to be qualified if the A260 / A280 ratio was between 1.7 and 1.9, and the concentration was considered to be qualified if the DNA concentration was higher than 100 ng / µL. The qualified genomic DNA samples were stored at -20℃ for later use.
[0035] 2. Whole genome sequencing of *Parasitic scabra*:
[0036] Whole-genome sequencing was performed on both the wild-type and mutant *Parasius maculatus*, obtaining the rp2 gene sequence on chromosome 7. The sequence of the rp2 gene on chromosome 7 of the mutant *Parasius maculatus* is shown in SEQ ID NO:4, and the sequence of the rp2 gene on chromosome 7 of the wild-type *Parasius maculatus* is shown in SEQ ID NO:5.
[0037] SEQ ID NO:4:
[0038] A
[0039] SEQ ID NO:5:
[0040]
[0041] Analysis and comparison revealed that the SNP marker associated with the body color trait of the golden-red Paramecium fasciatus is located at 1354 bp of the rp2 gene on chromosome 7 of Paramecium fasciatus, as shown in SEQ ID NO:4 (see underlined portion), and its polymorphism is A / G.
[0042] 3. Obtain the first-generation sequencing sequence of the mutant golden-red large-scaled loach.
[0043] The first-generation sequencing sequence of the rp2 gene of the mutant golden-red large-scaled loach is shown in SEQ ID NO:1.
[0044] The SNP marker associated with the body color trait of the golden-red large-scaled loach is located at 130 bp of the sequence shown in SEQ ID NO:1 (see underlined part for details).
[0045] SEQ ID NO:1:
[0046] accgttggcc ggttgccagg cacactcaat ggccagcagt ttgtcattca ggagtgtgagaactgcaaca tctacgtatt ggaccattca gcgactataa ccatcgacga ctgtgtgaactgccgcata atgttgggtcc aatcaaaggc agcgtattct tcagagactg taaagatatc aaatgcgtagtggcctgcca acagttccgc accagagact gcaagaaaat ggacgtcttt ttgtcctgtg ccacccagcccattatcgag tcttctacgg gcatgaagtt tggctgtttt cagtactact accctgattt ggctttccactttaaagatg caggccttag cattttcaat aacaactgga gcaatattca tgacttcaca cctgtgtctggagagaccaa ttggagtcta ctccccgaag aaactgttgt cctggatcat gtgccattac cggattctgagtcggagttt aaatccgtga gaatttcgac cgaggcaagc cggagcatag ttcccctgac caaaggaggccggcgcaagg agagtgaaga gtcctgtctg tttgttttct tcgctggaga ctacaccact gctaatgcccgcaagcttat tgatgaggtt agagatagtt taagaaagtt tccatcagtt gttgctcatc tgca.
[0047] 4. Amplify nucleotide fragments containing SNP sites
[0048] 4.1 Primer design: Using the DNA sequence of the rp2 region of the gene shown in SEQ ID NO:1 as a template, primers were designed, including forward primer F: 5'- CTTCATGCTGACAGGCCTCA - 3' (SEQ ID NO:2); and reverse primer R: 5'- CAGATGAGCAACAACTGATGGA- 3' (SEQ ID NO:3).
[0049] The expandable region of the primer is a 674 bp sequence, as shown in SEQ ID NO:1, which contains the molecular marker site of the A / G mutation at position 130 bp.
[0050] 4.2 PCR Amplification: The PCR reaction system consisted of 20 µL, including: 10 µL 2×San Taq PCR Mix, 0.8 µL forward primer (10 µmol / L), 0.8 µL reverse primer (10 µmol / L), 2 µL template DNA (≥100 ng / μL), and 6.4 µL ddH2O. The PCR reaction conditions were: 98℃ pre-denaturation for 5 min, 35 amplification cycles (98℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s), and a final extension at 72℃ for 10 min. The PCR amplification products were obtained.
[0051] 5. Detect PCR amplification fragments and obtain SNP markers:
[0052] The PCR amplification product from step 4 was subjected to first-generation sequencing, and the genotype at the 130 bp position of the PCR amplification product was determined to be the genotype of the SNP site.
[0053] Sequencing peak diagrams of the three genotypes are as follows Figure 1 As shown.
[0054] Example 2
[0055] Breeding applications were carried out, different mating schemes were designed based on body color, and population analysis was conducted on the polymorphic sites of the rp2 gene loci in different selected lines.
[0056] Obtaining materials for different breeding lines: Golden-red mutant individuals from the wild-type *Parasitic scabra* population were subjected to targeted mating and artificial selection. F1 families were constructed through reciprocal crosses between wild-type and mutant individuals. The following year, the F1 hybrids matured, and testcrosses were conducted between the F1 hybrids and *Parasitic scabra*, as well as self-crossing experiments, to obtain F2 families. Successfully fertilized parent fish were then cultured separately. The body coloration of the F1 and F2 generations is shown in the table below:
[0057] Table 1: Body color ratio of different breeding lines
[0058]
[0059] Thirty individuals from the F1 hybrid generation, 30 individuals from the F2 testcross with different body colors, and 30 individuals from the F2 selfcross with different body colors were selected; the fins were removed, and genomic DNA was extracted from the fin tissues of the fish to be tested.
[0060] The chi-square test was used to analyze the above samples (results are shown in Table 2). The frequencies of the above SNP sites in different body colors basically conformed to Mendelian segregation. This verified that allele A at this SNP site was significantly positively correlated with body color mutations.
[0061] Table 2 Genotype frequencies of SNP sites in different breeding lines of *Paramecium chinense*
[0062]
[0063] Note: * indicates a significant difference (P < 0.05), and ** indicates an extremely significant difference (P < 0.01).
[0064] In the breeding process of the golden-red large-scaled loach, individuals with the genotype AG can be selected from wild-type large-scaled loach and hybridized with golden-red large-scaled loach with the genotype AA to screen for a golden-red population with richer genetic diversity.
[0065] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.
Claims
1. The application of primer pairs for detecting SNP markers associated with the body color trait of *Parasitic maculatus* in the breeding of *Parasitic maculatus* with the body color trait, characterized in that, The SNP marker is located at 1354 bp of the rp2 gene on chromosome 7 of Parasitic Loach as shown in SEQ ID NO:4, and its polymorphic form is A / G; The nucleotide sequences of the primer pairs are shown in SEQ ID NO:2-SEQ ID NO:
3.
2. The application according to claim 1, characterized in that, The nucleotide sequence containing the SNP marker is shown in SEQ ID NO:1, wherein the SNP marker is located at 130 bp of the sequence shown in SEQ ID NO:1, and its polymorphic form is A / G.
3. The application according to any one of claims 1 to 2, characterized in that, The SNP marker has a genotype of AA, AG, or GG. Among them, the body color of the large-scaled loach with genotype AA is golden red, and the body color of the large-scaled loach with genotype AG or GG is brown like the wild type.
4. A method for detecting the body color trait of the golden-red large-scaled loach, characterized in that, Includes the following steps: The genomic DNA of the loach to be tested was amplified by PCR using primers as shown in SEQ ID NO:2-SEQ ID NO:3 to obtain PCR amplification products; Detect the genotype at the 130bp position of the PCR amplification product; The loach with the genotype AA at 130bp of the PCR amplification product has a golden-red body color, while the loach with the genotype AG or GG at 130bp of the PCR amplification product has a wild-type brown body color.
5. A breeding method for a golden-red, large-scaled loach, characterized in that, Includes the following steps: Wild-type brown large-scaled loach with genotype AG was screened out using primer pairs shown in SEQ ID NO:2-SEQ ID NO:3 and then cultured separately. During the breeding season, wild-type brown large-scaled loach with genotype AG is selectively bred with golden-red large-scaled loach with genotype AA, or wild-type brown large-scaled loach with genotype AG is selectively bred with wild-type brown large-scaled loach with genotype AG. Golden-red large-scaled loach with genotype AA were selected from the offspring for breeding.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker for identifying body color character of carp, primer and application
CN115927653A
Gene related to body color character of paramisgurnus dabryanus, primer group of SNP (Single Nucleotide Polymorphism) marker and application of primer group
CN120485198A