LAMP (loop-mediated isothermal amplification) specific primer, detection system and detection method for peach bacterial perforation bacterium pantoea agglomerans detection
By designing a specific LAMP primer set and optimizing the detection system, the time-consuming and instrument-dependent problems of detecting clustered and widespread bacterial perforation pathogens of peach in existing technologies have been solved, enabling rapid and accurate field detection, reducing detection costs and time, and improving detection sensitivity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-13
- Publication Date
- 2026-03-17
AI Technical Summary
In existing technologies, the detection methods for the clustered spores of peach bacterial leaf spot are time-consuming, rely on expensive instruments and complex procedures, making it difficult to detect the pathogen quickly and accurately in the field. Furthermore, the detection results are unstable due to genetic diversity.
We designed a specific LAMP primer set and optimized the detection system. We used LAMP technology to amplify the target sequence under isothermal conditions and determined the results by observing color changes or gel electrophoresis. This simplified the operation process and reduced our dependence on expensive instruments.
It enables rapid and accurate detection of clusters of peach bacterial leaf spot pathogens, with high sensitivity, allowing for early diagnosis of the disease in the field and reducing economic losses.
Smart Images
Figure CN121674596A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant pathogen detection technology, and in particular to a specific primer, detection system, and detection method for detecting clustered *Prunus perforatum*, a bacterial causal agent of peach leaf spot. Background Technology
[0002] Peach[ Prunus persica [L.) Batsch] belongs to the genus Prunus of the Rosaceae family. It is native to my country and has a long history of cultivation there. Currently, my country has the world's largest peach planting area and yield. However, peach production faces severe threats from various pests and diseases. Among them, peach bacterial spot is one of the most important bacterial diseases, occurring in all peach-producing regions worldwide. Infected peach trees suffer an average loss of 20%-50%, and in severe cases, even total crop failure. Traditionally, the pathogen is believed to be *Xanthomonas aeruginosa*, a pathogenic species of *Prunus*. Xanthomonas arboricola pv. pruni In 2020, Tong Yaping et al. isolated, re-inoculated, and identified bacterial leaf spot samples of peaches and plums from Gutian County, Fujian Province, and reported for the first time a clear finding of bacterial leaf spot disease. P. agglomerans It is one of the pathogens of this disease. Subsequently, several other reports indicated the presence of *Plasmodium spp.*, a bacterium causing bacterial leaf spot in peaches. P. agglomerans) This is the pathogen of peach bacterial leaf spot. The inventor's laboratory, after years of research on the pathogen of peach bacterial leaf spot, discovered it in samples of this disease collected from Mengyin County in Shandong Province, Dali County in Shaanxi Province, and Guilin City in Guangxi Province. P. agglomerans It can be considered a pathogen causing bacterial leaf spot in peaches. As a novel pathogen, its distribution range is not yet clear, therefore, there is an urgent need to establish an effective detection and monitoring system for this pathogen.
[0003] In pathogen identification, traditional morphological methods suffer from drawbacks such as being time-consuming, unreliable, prone to contamination, and requiring specialized technicians. Among existing technologies, PCR detection methods based on specific gene molecules are gradually being applied to pathogen identification, offering high sensitivity and specificity. However, their dependence on expensive instruments and complex temperature cycling procedures limit their application in field testing. Later, loop-mediated isothermal amplification (LAMP) was developed, which can efficiently and specifically amplify target sequences at constant temperatures, offering advantages such as high sensitivity, ease of operation, and easy interpretation of results (e.g., through visual observation of turbidity or color changes). Currently, LAMP technology is widely used in the molecular detection and diagnosis of plant diseases. Furthermore, LAMP primers have been designed based on the gyrB gene sequence of *Panthelios galbana*, further optimizing the LAMP reaction system and establishing… P. agglomeransVisualization of the LAMP system. However, when our laboratory used the aforementioned LAMP primer set to detect *Pantotheca acuminata*, a bacterial perforator of peach isolated from Mengyin County, Shandong Province, and Dali County, Shaanxi Province, we found that not all results were positive. This is speculated to be related to the genetic diversity within the pathogen population. Therefore, there is an urgent need to develop a stable and specific detection method for *Pantotheca acuminata*. P. agglomerans The LAMP primer set was developed to enable early and rapid monitoring of the pathogen, which will help in the formulation and implementation of early control measures. Furthermore, it lays an important foundation for clarifying the distribution and occurrence patterns of the disease caused by this pathogen in my country, thereby reducing the economic losses caused by the disease. Summary of the Invention
[0004] This invention addresses the issue of clustered pantothenia in existing technologies. P. agglomerans To address the problems encountered in the detection process, this paper provides a LAMP-specific primer, detection system, and detection method for detecting clustered pan-bacterial bacteria of peach bacterial perforation causal agent. By setting up a LAMP primer set and optimizing the detection system and method, a rapid and specific detection of clustered pan-bacterial bacteria of peach bacterial perforation causal agent can be achieved for rapid field diagnosis.
[0005] The first objective of this invention is to provide a LAMP-specific primer for detecting clusters of *Plasmodium spp.*, a bacterial perforator of peaches, characterized in that the base sequence of the LAMP-specific primer is: External primers: F3: 5'-gaagcgactgcgcttctc-3'; B3: 5'-ggtcggtcatcagcatacg-3' Internal primer: FIP: 5'-ccaggctgacaaacagcaggg-cctcgcagttcgtttgcc-3'; BIP: 5'-aacgacctatctggtggtgctg-cttcgtaagcgagcacctta-3'.
[0006] Furthermore, the conserved target sequence of the peach bacterial perforation pathogen, Pantotheca cum C., is shown in SEQ ID NO.1, and its complete gene is numbered GL000358 in the whole genome database; the encoded protein is a signal transduction histidine kinase.
[0007] Furthermore, the conserved targets are screened using the following method: the whole genome sequence of *Pantotheca acuminata*, the bacterial causal agent of peach leaf spot, is sequenced and compared with that of *Pyrus pyrifolia*, the causal agent of pear fire blight. Erwinia amylovora Pantothecinia pineapple Pantoea ananatis and Xanthomonas arboreum var. praecox, a pathogenic species of plum. Xanthomonas arboricola pv. pruniWhole genome sequences were compared and screened out. E. amylovora , P. agglomerans and P. ananatis The common genes were identified, and then highly conserved DNA fragments with sequence lengths >170bp were screened using NCBI BLAST.
[0008] The second objective of this invention is to provide a detection system for *Pantotheca acuminata*, a bacterium causing peach bacterial perforation, using the above-mentioned LAMP-specific primers. The system comprises, by volume 25 µl, 1.4 mM dNTPs, 4.0 mM MgSO4, 0.1 µM MF3 / B3 outer primers, 1.6 µM FIP / BIP inner primers, 1.0 µl Bst 2.0® DNA Polymerase, 2.5 µl 10×Isothermal Amplification Buffer, 1.0 µl test solution, and 6.5 µl ddH2O.
[0009] Furthermore, the above detection system has a sensitivity of 10 pg / µl for detecting Pantotheca acuminata, a bacterial perforator of peaches.
[0010] The third objective of this invention is to provide a method for rapid detection of *Panthera solani*, a bacterial fungus causing peach leaf spot, using the above-mentioned detection system. The method is characterized by preparing a mixture of the above-mentioned detection system, reacting it in a 65°C water bath for 50-60 minutes, and then determining the negative or positive result of the amplification product using either of the following two methods: Method 1: Add SYBR Green I dye to the amplification product and judge the result by observing the color reaction of the amplification product. An orange reaction solution indicates a negative result, while a fluorescent green reaction indicates a positive result. Method 2: The amplification products are analyzed by gel electrophoresis. If the result shows a ladder-like pattern, it is a positive result; if there is no ladder-like pattern, it is a negative result.
[0011] The beneficial effects of this invention are: it targets the widespread occurrence of bacterial perforation pathogens in peaches. P. agglomerans By designing specific detection primer sets and applying LAMP technology to optimize the design of the detection system and detection method, rapid and accurate detection of peach bacterial leaf spot caused by the pathogen can be achieved in the field. This eliminates the need for expensive laboratory instruments such as PCR instruments and the need to extract plant tissue DNA, making rapid diagnosis before the onset of disease symptoms possible, with high accuracy and sensitivity. Attached Figure Description
[0012] Figure 1 This is a schematic diagram illustrating the specific detection results of *Plasmodium clumps* in peach bacterial perforation disease according to the present invention.
[0013] Figure 2The diagram shows the optimized reaction results of the LAMP reaction system for *Plasmodium clumps*, a bacterium causing bacterial leaf spot of peach, according to the present invention.
[0014] Figure 3 This is a schematic diagram showing the sensitivity detection results of the LAMP reaction system for *Plasmodium clumps*, a bacterium causing bacterial leaf spot of peach, according to the present invention.
[0015] Figure 4 This is a schematic diagram of LAMP detection results for the extract of pantothenic acid-infected tissue. Detailed Implementation
[0016] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.
[0017] The main reagents and instruments used in the following examples are: Bst 2.0® DNA Polymerase (New England Biolabs), 10× Isothermal Amplification Buffer (New England Biolabs), MgSO4 (New England Biolabs), dNTPs (Sangon Biotech), SYBR Green I dye (Solarbio), Green TaqMix (Novizan), deionized water, DNA Maker (Novizan), PCR instrument (BIO-RAD), constant temperature water bath (Hangzhou Mio Instrument Co., Ltd.), and ultra-micro spectrophotometer (Genova plus 198-1000nm).
[0018] All pathogens used below were validated for their accuracy using morphological and 16S sequence analysis. All bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit (Nanjing Novizan Biotechnology Co., Ltd.). Bacterial genomic DNA from the infected tissue used for detection was directly extracted from the diseased-healthy junction of diseased leaves, mixed with water, ground, and the extract was collected.
[0019] Example 1: Screening of conserved sequences and specific LAMP primer sets of *Panthera philoxeroides* clumps in peach bacterial leaf spot disease. (1) Screening conserved DNA sequences within the species of peach bacterial leaf spot pathogen, sequencing the whole genome sequence of the clustered pan-mycelium of peach bacterial leaf spot pathogen, and comparing it with that of pear fire blight pathogen. Erwinia amylovora Pantothecinia pineapple Pantoea ananatis and Xanthomonas arboreum var. praecox, a pathogenic species of plum. Xanthomonas arboricola pv. pruni Whole genome sequences were compared and screened out. E. amylovora , P. agglomerans and P. ananatisThe shared genes were identified, and then highly conserved target DNA fragments with a sequence length >170bp were screened using NCBI BLAST. The final screened target sequences are shown in SEQ NO. 1: gaagcgactgcgcttctcgcctcgcagttcgtttgcccgcaccctgctgctgatcgttaccctgctgtttgtcagcctggtaacgaccta tctggtggtgctgaacttcgccattcttcccagcctgcaacagttcaataaggtgctcgcttacgaagttcgtatgctgatgaccgacc.
[0020] (2) Screening for specific LAMP primers: Based on the conserved sequences mentioned above, LAMP primer sets were designed on the website https: / / lamp.neb.com / #! / . Amplification was performed by incubating the reaction solution at 65°C for 1 h. The initial reaction system included: 3.5 µl dNTP Mixture (1.4 mM), 1.5 µl MgSO4 (6.0 mM), 0.5 µl outer primer F3 / B3 (0.2 µM), 4.0 µl inner primer FIP / BIP (1.6 µM), 1.0 µl Bst 2.0® DNA Polymerase, 2.5 µl 10XI Othermal Amplification Buffer, 1.0 µl genomic DNA, and 6.5 µl ddH2O. Based on the experimental results, the following LAMP primer set specific to pantothenia gravis was found: External primers: F3: 5'-gaagcgactgcgcttctc-3'; B3: 5'-ggtcggtcatcagcatacg-3' Internal primer: FIP: 5'-ccaggctgacaaacagcaggg-cctcgcagttcgtttgcc-3'; BIP: 5'-aacgacctatctggtggtgctg-cttcgtaagcgagcacctta-3'.
[0021] Example 2: Pantothenia glutinosa-specific detection To verify the specificity of the LAMP primer set screened in Example 1, DNA from 13 bacterial strains isolated from disease samples across the country was used as templates. 1 µl of DNA solution was taken from each strain, and the specific LAMP reaction system finally optimized in Example 2 was used. The final banding results after SYBR Green I dye staining and 1% agarose gel electrophoresis are shown below. Figure 2 As shown. Based on the color reaction of the reaction system as the result judgment criterion, the LAMP reaction was carried out according to the system of Example 1. The reaction procedure was: water bath at 65°C for 60 min. The LAMP detection results showed that when using the DNA template of *Plasmodium spp.*, a cluster of peach bacterial perforator, a fluorescent green positive reaction was observed and a ladder-like band appeared on agarose gel electrophoresis. The color development results of the other 12 bacteria and sterile water were orange negative reactions, and no amplification bands were observed on agarose gel electrophoresis. Figure 1 A). Subsequently, DNA extracted from six clustered pan-yellow bacteria strains that can cause peach bacterial perforation disease, isolated from various parts of the country, was tested, and all results were positive. Figure 1 B).
[0022] Example 3: Optimization of the LAMP reaction system for clustered pantothenia To optimize the reaction system and screen for cost-effective and time-appropriate reaction conditions while ensuring positive results, this method focuses on the concentrations of dNTPs and MgSO4 in the LAMP reaction system. 4、 Gradient screening was performed using F3 / B3 primers, FIP / BIP primer concentrations, reaction temperatures, and reaction times. The initial reaction mixture was as follows: 3.5 µl dNTP Mixture (1.4 mM), 1.5 µl MgSO4 (6.0 mM), 0.5 µl outer primer F3 / B3 (0.2 µM), 4.0 µl inner primer FIP / BIP (1.6 µM), 1.0 µl Bst 2.0® DNA Polymerase, 2.5 µl 10X Isothermal Amplification Buffer, 1.0 µl genomic DNA, and 6.5 µl ddH2O.
[0023] dNTP concentrations were screened according to the following concentrations in the system: 0.4 mM, 0.8 mM, 1.2 mM, 1.4 mM, 1.6 mM, 2.0 mM, and 2.4 mM; MgSO4 concentrations were screened according to the following concentrations in the system: 3.0 mM, 4.0 mM, 5.0 mM, 6.0 mM, 7.0 mM, 8.0 mM, and 9.0 mM; F3 / B3 primers were screened according to the following concentrations in the system: 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, and 0.7 μM; FIP / BIP were screened according to the following concentrations in the system: 0.4 μM, 0.8 μM, 1.2 μM, 1.6 μM, 2.0 μM, 2.4 μM, and 2.8 mM. μM; Optimized reaction temperature: 61℃, 63℃, 64℃, 65℃, 66℃, 67℃, 69℃, 71℃; Optimized reaction time: 10 min, 20 min, 30 min, 40 min, 50 min, 60 min, 70 min, 80 min.
[0024] During real-time screening, a single variable is controlled, and optimization principles are followed to ensure positive results, reduce reagent usage, minimize reagent costs, and shorten reaction time. Finally, SYBR Green I dye is added to each reaction solution. A yellow-green positive reaction or a ladder-like band pattern on agarose gel electrophoresis can be observed by monitoring the color reaction of the amplification products. The reaction results are as follows: Figure 2 As shown, the final optimized LAMP reaction system was determined to be as follows (total volume 25 µl): 1.4 mM dNTP, 4.0 mM MgSO4, 0.1 µM F3 / B3 outer primer, 1.6 µM FIP / BIP inner primer, 1.0 µl Bst 2.0® DNAPolymerase, 2.5 µl 10X Isothermal Amplification Buffer, 1.0 µl test solution, and 6.5 µl lddH2O.
[0025] Example 4: LAMP sensitivity detection of clustered pantothenia To determine the sensitivity of the LAMP detection method, the concentration of extracted clump-forming pantothenic DNA was measured using an ultra-micro spectrophotometer, then serially diluted 10-fold with sterile water and stored at -20°C for later use. 1 μl of each serially diluted DNA concentration was used as a template for LAMP reaction in the system optimized in Example 3. The reaction procedure was: incubation at 65°C for 50 min. 5 μL of the amplification product was loaded and electrophoresed on a 1% agarose gel. The results showed that the LAMP method could detect a concentration of 10 pg / μl DNA; consistent with the results of the SYBR Green I colorimetric reaction. Figure 3A).
[0026] In contrast, PCR detection was performed using the following standard PCR primer set sequences: F: gaagcgactgcgcttctc; R:ggtcggtcatcagcatacg.
[0027] 1 μl of each F / R primer set, 1 μl of DNA template (different concentrations: 1 ng / µl, 100 pg / µl, 10 pg / µl, 1 pg / µl, 100 fg / µl, 10 fg / µl, 1 fg / µl), 12.5 μl of Green Taq Mix enzyme (Novizan), and ddH2O to a final volume of 25 μl. PCR amplification conditions were: 95℃ for 3 min, 95℃ for 30 s, 56℃ for 30 s, 72℃ for 30 s, 36 cycles, 72℃ for 10 min. Each serially diluted DNA buffer was used as a template for PCR. The results showed that the PCR detection concentration was 100 pg / µl (… Figure 3 B).
[0028] Example 5: LAMP detection of diseased tissue extract Artificial inoculation of *Plasmodium globosum* and *Xanthomonas arboreum* var. *mairei* was performed on peach tree leaves. Seven days later, samples were taken, the surface was rinsed and disinfected, and tissue from the diseased-healthy boundary was collected. 200 μL of sterile water was added, and the mixture was ground. After standing at room temperature for 30 minutes, 1 μL of the supernatant was used as a template, with sterile water as a blank control. An optimized LAMP reaction system was used for detection. Results are as follows: Figure 4 As shown, the LAMP reaction result of the extract of peach leaf tissue with bacterial spot disease caused by Pantotheca cumulus was positive, while the results of the extract of healthy peach leaves, the extract of peach leaf with bacterial spot disease caused by Xanthomonas aurea species of plum, and sterile water were negative. Figure 4 In the table, 1-6 are extracts of peach leaves infected with Pantotheca acuminata; 7 is an extract of peach leaves infected with Xanthomonas arboreum var. truncatum; CK is an extract of healthy peach leaves; Positive is... P. agglomerans Genome.
[0029] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions of the foregoing embodiments, or equivalent substitutions can be made to some of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A LAMP specific primer for detection of Pseudomonas syringae pv. morsprunorum, characterized by, The base sequence of the LAMP specific primer is: Outer primer: F3: 5'-gaagcgactgcgcttctc-3'; B3: 5'-ggtcggtcatcagcatacg-3' Inner primer: FIP: 5'-ccaggctgacaaacagcaggg-cctcgcagttcgtttgcc-3'; BIP: 5'-aacgacctatctggtggtgctg-cttcgtaagcgagcacctta-3'.
2. The LAMP specific primers for detection of Pseudomonas syringae pv. morsprunorum 22a according to claim 1, characterized in that, The conserved target sequence of the peach bacterial boring pathogen Pantoea agglomerans is as shown in SEQ ID NO. 1, the complete gene of which is numbered as GL000358 in the whole genome database; and the encoded protein is a signal transduction histidine kinase.
3. The LAMP specific primers for detection of Pseudomonas syringae pv. morsprunorum 22(Atzenang et al., 2001) according to claim 2, characterized in that, The conserved target sequences were screened using the following method: the whole genome sequence of *Pantotheca acuminata*, the bacterial causal agent of peach perforation, was sequenced and compared with that of *Pyrus pyriformis*, the causal agent of pear fire blight. Erwinia amylovora Pantothecinia pineapple Pantoea ananatis and Xanthomonas arboreum var. praecox, a pathogenic species of plum. Xanthomonas arboricola pv. pruni Whole genome sequences were compared and screened out. E. amylovora , P. agglomerans and P. ananatis The common genes were identified, and then NCBI BLAST was used to screen for highly conserved target DNA fragments within the clustered pan-bacterial species, with fragment sequence lengths >170bp.
4. A detection system for Pseudomonas syringae pv. actinidiae comprising the LAMP-specific primers according to claim 1, characterized by, The detection system includes 1.4 mM dNTP, 4.0 mM MgSO4, 0.1 µM F3 / B3 outer primer, 1.6 µM FIP / BIP inner primer, 1.0 µl Bst 2.0® DNA Polymerase, 2.5 µl 10×Isothermal Amplification Buffer, 1.0 µl sample to be tested, and 6.5 µl ddH2O, in an amount of 25 µl based on the total volume of the system.
5. The detection system of LAMP specific primers for Pseudomonas syringae pv. actinidiae according to claim 4, characterized in that, The sensitivity of the detection system for detecting the peach bacterial boring pathogen Pantoea agglomerans reaches 10 pg / µl.
6. A method for rapid detection of Pseudomonas syringae pv. actinidiae based on the detection system of claim 4, characterized in that, The detection system mixture of claim 4 is prepared, and then reacted at 65°C in a water bath for 50-60 min, and then the negative or positive results of the amplification product are determined by any one of the following two methods: Method 1: SYBR Green Ⅰ dye is added to the amplification product, and the results are determined by observing the color reaction of the amplification product; the reaction solution is orange for a negative result, and green for a positive result; Method 2: The amplification product is subjected to gel electrophoresis analysis, and if the result shows a ladder-like band, it is a positive result, and if there is no ladder-like band, it is a negative result.