RPA primer, primer probe combination and kit for detecting sclerotium rolfsii and application

Abstract

The invention discloses an RPA primer for detecting sclerotium rolfsii, a primer probe combination, a kit and application, and belongs to the technical field of biological detection. The invention provides an RPA (recombinase polymerase amplification) primer for detecting sclerotium rolfsii. The RPA primer comprises primer sequences as shown in SEQ ID NO: 44 and SEQ ID NO: 52. According to the invention, the RPA technology is applied to the molecular detection of the sclerotium rolfsii of the coptis southern blight pathogen for the first time, and the method has the advantages of strong specificity, high sensitivity, simple reaction conditions, short reaction time and the like. According to the method, a PCR instrument, gel electrophoresis and an imaging system are not needed, the detection efficiency is greatly improved, and the problems that an existing conventional detection means needs long time, and the requirements for instrument and equipment conditions and experimenters are high are solved. The invention provides technical support for early detection and on-site detection of sclerotium rolfsii, and provides a basis for preventing and treating coptis chinensis sclerotium rolfsii.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, and in particular relates to an RPA primer, primer-probe combination, kit, and application for detecting Coptis chinensis var. chinensis. Background Technology

[0002] Coptis chinensis is an important traditional Chinese medicine. It is bitter and cold in nature, non-toxic, and has the effects of purging heat and detoxifying, clearing heat and drying dampness. In recent years, with the large-scale cultivation of Coptis chinensis, disease problems have become increasingly serious. Currently, white mold disease is a significant disease of Coptis chinensis, occurring in summer and autumn. It is more severe in fields with continuous cropping, leading to the death of the Coptis chinensis plants and loss of commercial value. White mold disease of Coptis chinensis is caused by *Sclerotium sclerotiorum* (…). Sclerotium rolfsii This is a fungal disease caused by [a specific pathogen, likely a fungus or fungus]. ​​The pathogen first infects the rootstock of the plant, causing it to turn brown. White, silky mycelium forms near the soil surface, and can extend from the petiole to the leaf blade. The petiole and leaf blade turn purplish-brown or orange-yellow after infection. In severe cases, the rootstock and petiole often become wet-rotted, leading to leaf wilting and eventually the death of the entire plant. In the later stages of the disease, numerous 2-3 mm reddish-brown, rapeseed-like sclerotia form within the mycelium.

[0003] The occurrence of white mold disease in Coptis chinensis is closely related to climate. The disease is more severe when temperatures exceed 25℃ and there is heavy rainfall and high humidity. The mycelium and sclerotia of the pathogen overwinter in diseased plant debris and soil, becoming the primary source of infection for the next growing season. Sclerotia germinate easily under high temperature and humidity conditions, spread through the field via water flow, and cause infection upon contact with plants. Symptoms are not apparent when the pathogen invades the host; only after the stem epidermis is damaged do symptoms such as leaf wilting appear, which poses a challenge to the prediction and forecasting of white mold disease. Current detection technologies for the pathogen of white mold disease in Coptis chinensis still have many limitations and cannot meet the practical needs of early warning and rapid on-site detection in the field. Traditional detection methods primarily rely on morphological identification of pathogens, requiring the isolation and culture of pure strains to determine their composition by observing hyphal morphology, sclerotium size, and color. This method is cumbersome, time-consuming, and cannot detect latent pathogens, easily missing the optimal control period. Furthermore, morphological identification demands a high level of expertise from operators and is prone to misjudgment due to interference from similar fungal morphologies, compromising accuracy. Current molecular biology detection technologies, primarily conventional PCR and real-time quantitative PCR, while offering improved sensitivity and accuracy compared to morphological identification, still rely on sophisticated and expensive PCR instruments. Subsequent validation requires gel electrophoresis, imaging systems, and other supporting equipment. The entire detection process must be completed in a specialized laboratory, making it unsuitable for grassroots agricultural extension stations and field planting sites lacking advanced equipment. Moreover, conventional PCR testing typically takes 2-3 hours or more. While real-time quantitative PCR can shorten the time, its high reagent costs, complex procedures, and stringent molecular biology skills make it difficult to widely apply in large-scale Coptis chinensis cultivation areas. Therefore, developing a detection technology for the pathogen of Coptis chinensis white rot that requires no complex instruments, is simple to operate, and provides rapid and accurate detection is of great significance for achieving precise control of Coptis chinensis white rot and reducing disease losses. This technology will solve the problems of early detection and field application of existing technologies. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide an RPA primer for detecting Coptis chinensis, which improves amplification efficiency, reduces non-specific amplification, and improves the sensitivity, accuracy and specificity of detection.

[0005] Another objective of this invention is to provide an RPA primer-probe combination for detecting Coptis chinensis var. chinensis.

[0006] Another object of the present invention is to provide a kit for detecting Coptis chinensis var. chinensis.

[0007] Another object of the present invention is to provide the application of the RPA primers or the RPA primer-probe combination or the kit in the detection of Coptis chinensis var. chinensis.

[0008] Another object of the present invention is to provide a method for detecting Coptis chinensis var. chinensis.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution: The present invention provides an RPA primer for detecting Coptis chinensis var. chinensis, the RPA primer comprising the primer sequences shown in SEQ ID NO:44 and SEQ ID NO:52.

[0010] This invention also provides an RPA primer-probe combination for detecting *Sclerotium affine*, the RPA primer-probe combination comprising the RPA primers and the RPA probe; the RPA probe comprising the probe sequence shown in SEQ ID NO:22; starting from the first base at the 5' end, the T at position 31bp is a fluorescently modified T; the N at position 32bp is a tetrahydrofuran site; the T at position 33bp is a quencher modified T; the 3' end of the RPA probe is modified with a blocking group.

[0011] Preferably, the fluorescent group-modified T includes dT-FAM; the quenching group-modified T includes dT-BHQ1; and the blocking group includes C3-Spacer.

[0012] The present invention also provides a kit for detecting Coptis chinensis var. spp., the kit comprising the RPA primer-probe combination.

[0013] The present invention also provides the application of the RPA primers, the RPA primer-probe combination, or the kit in the detection of Coptis chinensis var. spp.

[0014] Preferably, the pathogen causing the white rot of Coptis chinensis includes Sclerotium sclerotiorum.

[0015] The present invention also provides a method for detecting *Sclerotium affine*, comprising the following steps: extracting DNA from the sample to be tested; using the extracted DNA as a template, performing an RPA amplification reaction using the RPA primer-probe combination or the kit; analyzing the RPA amplification product using a fluorescence detection device, and obtaining the DNA detection result by detecting the fluorescence signal.

[0016] Preferably, the conditions for the RPA amplification reaction include: reaction at 39~41℃ for 15~30 min.

[0017] Preferably, in the RPA amplification reaction system, the final concentration of the upstream primer is 420~700nM; the final concentration of the downstream primer is 420~700nM.

[0018] Preferably, the sample to be tested includes Coptis chinensis plants or soil; the Coptis chinensis plants include any one or more of the following: roots, stems, petioles, and leaves.

[0019] The beneficial effects of this invention are: This invention is the first to apply RPA technology to the molecular detection of *Sclerotium ligustum*, the pathogen causing *Sclerotium ligustum* in *Coptis chinensis*, offering advantages such as high specificity, high sensitivity, simple reaction conditions, and short reaction time. This invention eliminates the need for PCR instruments, gel electrophoresis, and imaging systems, significantly improving detection efficiency and solving the problems of long detection times and high requirements for equipment and personnel in existing conventional methods. This invention provides technical support for the early and on-site detection of *Sclerotium ligustum*, and provides a basis for the prevention and control of *Coptis chinensis*. Attached Figure Description

[0020] Figure 1 The results of the first round of screening and fixing of downstream primers for RPA primers in Example 1 are shown, where A is the amplification result of a negative sample and B is the amplification result of a positive sample. Figure 2 The results of the first round of screening and fixation of upstream primers for RPA primers in Example 1 are shown, where A is the amplification result of negative samples and B is the amplification result of positive samples. Figure 3 The results are the detection results of the second round of screening of downstream primers for RPA primers in Example 1. Figure 4 The results of the second round of screening to fix the upstream primers in Example 1; Figure 5 The results are the detection results of the third round of screening of downstream primers for RPA primers in Example 1. Figure 6 The results of the third round of screening to fix the upstream primers in Example 1; Figure 7 The results of primer amplification at different working concentrations in Example 2; Figure 8 The results of the detection of different pathogens in Example 3; Figure 9 The results are the sensitivity detection results using the positive plasmid as a template in Example 4; Figure 10 The results show the sensitivity detection of *Millettia sclerotiorum* genomic DNA as a template in Example 4. Figure 11 The results are for different Coptis chinensis plants and different soil samples in Example 5. Detailed Implementation

[0021] The present invention provides an RPA primer for detecting Coptis chinensis var. chinensis, the RPA primer comprising the primer sequences shown in SEQ ID NO:44 and SEQ ID NO:52.

[0022] This invention uses the cellobistose dehydrogenase (CDH) gene fragment of *Sclerotium sclerotiorum* as a template. Through three rounds of primer screening, primers with the highest amplification efficiency were obtained. The upstream primer sequence is shown in SEQ ID NO:44, and the downstream primer sequence is shown in SEQ ID NO:52. After RPA amplification using these primers, the positive amplification efficiency was the highest, and no negative background was produced, which can improve the sensitivity and accuracy of detection.

[0023] This invention also provides an RPA primer-probe combination for detecting *Sclerotium affine*, the RPA primer-probe combination comprising the RPA primers and the RPA probe; the RPA probe comprising the probe sequence shown in SEQ ID NO:22; starting from the first base at the 5' end, the T at position 31bp is a fluorescently modified T; the N at position 32bp is a tetrahydrofuran site; the T at position 33bp is a quencher modified T; the 3' end of the RPA probe is modified with a blocking group.

[0024] In this invention, the RPA probe contains an oligonucleotide sequence, a fluorescently modified base, a THF (tetrahydrofuran) site, a quencher-modified base, and a blocking group. The fluorescently modified T preferably includes dT-FAM; the quencher group can be any group sufficient to quench the fluorescent group, and in some embodiments, the quencher-modified T preferably includes dT-BHQ1; any base between the fluorescently modified T and the quencher-modified T is replaced by a tetrahydrofuran site; the blocking group can be any modifying group capable of preventing polymerase from synthesizing new bases, and in some embodiments, preferably includes C3-Spacer.

[0025] The present invention also provides a kit for detecting Coptis chinensis var. spp., the kit comprising the RPA primer-probe combination.

[0026] In this invention, the kit preferably further includes RPA reagent, a positive control, and a negative control. In some embodiments, the kit further includes reagents for extracting DNA from *Millettia sclerotiorum*.

[0027] The present invention also provides the application of the RPA primers, the RPA primer-probe combination, or the kit in the detection of Coptis chinensis var. spp.

[0028] In this invention, the pathogen causing the white rot of Coptis chinensis preferably includes Sclerotium sclerotiorum.

[0029] The present invention also provides a method for detecting *Sclerotium affine*, preferably comprising the following steps: extracting DNA from the sample to be tested; using the extracted DNA as a template, performing an RPA amplification reaction using the RPA primer-probe combination or the kit; analyzing the RPA amplification product using a fluorescence detection device, and obtaining the DNA detection result by detecting the fluorescence signal.

[0030] In this invention, the sample to be tested preferably includes Coptis chinensis plants or soil; the Coptis chinensis plants include any one or more of the following: roots, stems, petioles, and leaves. The DNA extraction method can employ conventional methods in the art.

[0031] In this invention, in the RPA amplification reaction system, the final concentration of the upstream primer in the system is preferably 420-700 nM, more preferably 500-700 nM, and even more preferably 700 nM; the final concentration of the downstream primer in the system is preferably 420-700 nM, more preferably 500-700 nM, and even more preferably 700 nM. Under these conditions, the primer amplification efficiency is the highest, and the negative background of the reaction is more stable.

[0032] In some embodiments of this invention, the RPA amplification reaction system, in 50 μL increments, preferably comprises: 3.5 μL of an upstream primer at a concentration of 10 μmol / L, 3.5 μL of a downstream primer, 0.6 μL of a 10 μM probe, 1 μL of template DNA, 29.5 μL of RPA reaction buffer, and 0.5 M MgSO₄. 2+ Add 1.4 μL of lyophilized enzyme tablet and ddH2O to a final volume of 50 μL.

[0033] In this invention, the preferred conditions for the RPA amplification reaction include: reaction at 39~41℃ for 15~30 min; the preferred reaction temperature is 39, 40 or 41℃, and the preferred reaction time is 15, 20, 25 or 30 min.

[0034] In this invention, a fluorescence detection device is preferably used to analyze the reaction products. DNA detection results are obtained by detecting the fluorescence signal. The probe used is a fluorescently labeled probe, and the reaction products can be analyzed by detecting the increment of the fluorescence signal during the amplification reaction and the minimum time (Tt value) required to reach a threshold. The threshold is a fluorescence signal increment of 100.

[0035] The primer and probe composition of this invention can accurately distinguish *Sclerotium regia* from other common soil fungi, exhibiting high specificity. It can detect target nucleic acids as low as 630 copies against positive plasmid templates and achieves high sensitivity against *Sclerotium regia* genomic DNA, with a detection limit as low as 0.0001 ng / µL. The detection method of this invention features simple reaction conditions and a short reaction time, eliminating the need for PCR instruments, gel electrophoresis, and imaging systems, thus greatly improving detection efficiency and solving the problems of long reaction times and high requirements for equipment and personnel in existing conventional detection methods. This invention provides technical support for the early detection and on-site detection of *Sclerotium affine*, the causal agent of *Sclerotium affine*, and provides a basis for the prevention and control of this disease.

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Unless otherwise specified, the following embodiments are all conventional methods.

[0038] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0039] Example 1: Screening of RPA primers targeting the CDH gene of *Sclerotium moniliforme* I. First round of RPA primer screening 1. Design of primary candidate primer sets Based on the cellobiose dehydrogenase (CDH) gene fragment of *Sclerotium regnans*, upstream and downstream primer sets were designed with a fixed length of 32 bp using the CDH sequence as a template, with each primer within the set separated by 10 bp. The upstream primer set consisted of CDH-f1 to CDH-f10, and the downstream primer set consisted of CDH-r1 to CDH-r10 (Table 1).

[0040] Table 1 Candidate Primers for the First Round

[0041] 2. Construction of positive template plasmid pMD19T-CDH The CDH gene fragment (as shown in SEQ ID NO:21) was ligated into the pMD19T vector to construct a positive template plasmid, named pMD19T-CDH. The extracted plasmid template was diluted to 2 ng / μL, corresponding to a plasmid copy number of approximately 6 × 10⁻⁶. 8 Copy / μL.

[0042] AAACAAATGATACGTCTCTCGGTCCCAATGGGGTAATACCTTTGACCAAGAATGGCCGTGTTATACTTTCTGCTGGCTCTCTGAGCTCTCCTCGTATTTTGTTCCAAAGTGGAATTGGGCCAACCGACATGCTCACACTTGTCCAGAATAATCCTACAGC CTCGGCCAACTTGCCTTCTCAGTCTCAATGGATCAATTTACCGGTCGGATACAATGTTGCCGACGCCCCATCCATCAATGTATGTCTCTCGAGTCGATCAATTCCAAAAATTTCTAATGACGAGGACATAACAGTTCGTCTTCACCCATCCTAGTA (SEQ ID NO:21) 3. Detection of the first round of RPA amplification efficiency Probe sequence: AAGGCAAGTTGGCCGAGGCTGTAGGATTAT(dT-FAM)(THF)(dT-BHQ1)GGACAAGTGTGAGCA(C3Spacer) (SEQ ID NO: 22).

[0043] RPA recombinase polymerase amplification: Recombinase polymerase isothermal amplification was performed using the primers in Table 1 with the TwistDx RPA-nfo kit. The total volume of the RPA reaction system was 50 μL: 2.1 μL of 10 μmol / L upstream primer, 2.1 μL of downstream primer, 0.6 μL of 10 μM probe, 1 μL of 2 ng / μL pMD19T-CDH plasmid DNA, 29.5 μL of RPA reaction buffer, and 0.5 M MgSO4. 2+ Add 1.4 μL of lyophilized enzyme tablet and bring the volume to 50 μL with ddH2O. The amplification system is shown in Table 2.

[0044] Table 2 RPA amplification system (50 μL)

[0045] The RPA amplification reaction procedure is as follows: amplify at 39℃ for 30 minutes.

[0046] Positive determination threshold: fluorescence signal increment is 100; Tt value is the minimum time required to reach the threshold.

[0047] Primer amplification efficiencies were compared using a fluorescent probe method, and primer pairs with the highest positive amplification efficiency and valid negative controls were selected. The specific screening scheme is as follows: (1) Eliminate amplification primers that are prone to producing negative background. First, fix the downstream primer CDH-r5 and pair it with the upstream primer. Use the amplification reagents and conditions described above, and use ultrapure water as the template. Compare the positive signal activation during amplification. If a positive signal appears, this primer is excluded. See below for specific results. Figure 1 In step A, using the same method, the upstream primer CDH-f5 was fixed and paired with the downstream primers. The same amplification conditions and template were used, and the results are shown in [Figure A]. Figure 2 A.

[0048] It can be seen that when CDH-r5 is fixed, none of the upstream primers will produce a negative background; when CDH-f5 is fixed, downstream primers r6, r7, r8 and r10 will have a certain degree of negative background problem, and therefore they were excluded in subsequent work.

[0049] (2) Select the primer pairs with the highest amplification efficiency. Since some primers that easily produce negative background have been eliminated, the remaining primers are used for further comparison of positive amplification. First, the downstream primer CDH-r5 is fixed and paired with the upstream primers. Amplification is performed using the same amplification conditions and the positive DNA plasmid pMD19T-CDH template. The results are shown in [Figure number missing]. Figure 1 In section B, by comparing information such as the positive jump time (Tt value) and fluorescence signal intensity during the amplification process, the upstream primer with the highest amplification efficiency was determined. It can be seen that when amplifying positive samples, CDH-f9 is the upstream primer with the highest amplification efficiency, with a corresponding Tt value of 18 and a fluorescence increment of 2454.

[0050] Subsequently, CDH-f9, which had the highest amplification efficiency, was fixed and paired with the remaining downstream primers. Amplification was then performed using the same amplification conditions and positive DNA plasmid template. The results are shown below. Figure 2 By comparing information such as the positive jump time (Tt value) and fluorescence signal intensity during the amplification process, the downstream primer with the highest amplification efficiency was determined. It can be seen that when amplifying positive samples, CDH-r1 is the upstream primer with the highest amplification efficiency, with a corresponding Tt value of 15.5 and a fluorescence increment of 3359.

[0051] In the first round of screening, the optimal primer pair was CDH-f9 and CDH-r1, which can be used in the next round of screening.

[0052] II. Second round of RPA primer screening 1. Primer design Based on the first round of optimal primer pairs, while keeping the primer length unchanged at 32 bp, the primers were shifted by about 2 bp to obtain a new set of upstream and downstream primers, the sequences of which are shown in Table 3.

[0053] Table 3. Second Round Candidate Primers

[0054] 2. Detection of the second round of RPA amplification efficiency The amplification reaction system and conditions for this round are the same as those for the first round of primer screening.

[0055] 3. Experimental Results CDH-r1 was fixed and amplified by pairing it with upstream primers. When amplifying negative samples, no negative background was produced by any primers; when amplifying positive samples, the results were as follows: Figure 3 As shown, CDH-f95 is the upstream primer with the highest amplification efficiency, with a corresponding Tt value of 22 and a fluorescence increment of 743.

[0056] CDH-f95 was fixed and paired with downstream primers for amplification. When amplifying negative samples, no negative background was produced by any primers; when amplifying positive samples, the results were as follows: Figure 4 As shown, CDH-r18 is the downstream primer with the highest amplification efficiency, with a corresponding Tt value of 21.5 and a fluorescence increment of 948.

[0057] In the second round of screening, the best primer pair was CDH-f95 and CDH-r18.

[0058] III. Third round of RPA primer screening 1. Primer design Based on the second round of optimal primer pairs, a new set of upstream and downstream primers was obtained by increasing or decreasing the primer length by 1 bp, and their sequences are shown in Table 4.

[0059] Table 4. Candidate primers for the third round of testing

[0060] 2. Detection of the third round of RPA amplification efficiency The amplification reaction system and conditions for this round are the same as those for the first round of primer screening.

[0061] 3. Experimental Results CDH-r18 was fixed and amplified by pairing it with the upstream primer. When amplifying a positive sample, the results were as follows: Figure 5 As shown, CDH-f956 is the upstream primer with the highest amplification efficiency, with a corresponding Tt value of 12 and a fluorescence increment of 2346. Although CDH-f953 showed a higher fluorescence increment, it exhibited a certain background value during negative amplification and was therefore directly excluded.

[0062] CDH-f956 was then fixed and paired with downstream primers for amplification. To better differentiate primer efficiencies, the amount of positive template was reduced by 10-fold, and the results are as follows. Figure 6 As shown, CDH-r187 is the downstream primer with the highest amplification efficiency, with a corresponding Tt value of 15.5, a fluorescence increment of 1047, and a negative background.

[0063] In the third round of screening, the best primer pair was CDH-f956 and CDH-r187.

[0064] Example 2: Screening for the optimal working concentration of the CDH-f956 / CDH-r187 primer pair Following the amplification system and reaction conditions of Example 1, amplification was performed using CDH-f956 and CDH-r187. During the amplification reaction, primers were set at working concentrations of 400 nM, 500 nM, 600 nM, and 700 nM. The positive plasmid template used was 6.3 × 10⁻⁶. 2 Copying was performed using ultrapure water for the negative group template. The Tt values ​​of positive amplification and the background signal of negative amplification were detected, and the working concentration of the primers with the highest efficiency was selected.

[0065] The results are as follows Figure 7 As shown, when primer concentrations are used in the range of 500–700 nM, the Tt value and fluorescence increment of the amplification reaction are close. However, when using 700 nM, the negative background of the reaction is more stable. Therefore, 700 nM is used as the optimal primer concentration.

[0066] Example 3 Specificity Detection DNA was extracted from 14 common soil fungi, including Sclerotium sclerotiorum. Using the extracted soil fungal DNA as templates, amplification was performed using the TwistDx RPA-nfo kit with CDH-f956 and CDH-r187 primers and the probes described below.

[0067] Probe sequence: AAGGCAAGTTGGCCGAGGCTGTAGGATTAT(dT-FAM)(THF)(dT-BHQ1)GGACAAGTGTGAGCA(C3Spacer).

[0068] The total volume of the RPA reaction system was 50 μL: 3.5 μL of 10 μmol / L upstream primer (CDH-f956), 3.5 μL of 10 μmol / L downstream primer (CDH-r187), 0.6 μL of 10 μmol / L probe, 1 μL of template DNA, 29.5 μL of RPA reaction buffer, and 0.5 M MgSO4. 2+Add 1.4 μL of lyophilized enzyme tablet and ddH2O to a final volume of 50 μL.

[0069] The results showed that only *Sclerotium sclerotiorum* was successfully detected (i.e., the test was positive), while other fungi were all negative. Figure 8 This indicates that the primer-probe combination of the present invention has high specificity and can accurately distinguish *Sclerotium sclerotiorum* from other common soil fungi.

[0070] Example 4 Sensitivity Measurement 1. The positive template plasmid pMD19T-CDH plasmid is the sample to be tested. The positive plasmid template was serially diluted to 6.3 × 10⁻⁶. 3 6.3×10 2 6.3×10 1 and 6.3×10 0 The concentration was set at 1 copy / μL, and then 1 μL was added as a template in the reaction. The remaining amplification conditions were the same as in Example 3. The sensitivity of this method was then tested. The results are as follows: Figure 9 As shown in the figure, this method can detect approximately 630 copies of the target nucleic acid.

[0071] 2. Neat genomic DNA of *Sclerotium sclerotiorum* was used as the test sample. Following the above method, different concentrations of *Sclerotium reganeum* genomic DNA were selected as detection samples. Concentration gradients were set at 50 ng / µL, 10 ng / µL, 1 ng / µL, 0.1 ng / µL, 0.01 ng / µL, 0.001 ng / µL, 0.0001 ng / µL, and 0.00001 ng / µL. The results showed that the detection level of *Sclerotium reganeum* genomic DNA was as low as 0.0001 ng / µL. Figure 10 This indicates that the primer-probe combination of the present invention has high sensitivity.

[0072] Example 5: Soil and Plant Sample Detection Leaves from infected (Dysplasia sclerotium) Coptis chinensis plants, leaves from healthy Coptis chinensis plants, surface soil from infected plots, and surface soil from healthy control plots were used as test samples. DNA was extracted from each sample, and the samples were tested according to the amplification system and reaction conditions of Example 3. Water was used as a negative control. The results are as follows: Figure 11 As shown.

[0073] It can be seen that only the infected Coptis chinensis plants and the soil from the infected plots were positive, while all other samples were negative.

[0074] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A RPA primer for detecting Cephalotaxus fortunei white thread blight, characterized in that, The RPA primer comprises a primer sequence shown in SEQ ID NO: 44 and SEQ ID NO:

52.

2. A RPA primer probe combination for detecting Cephalotaxus fortunei Ann., characterized in that, The RPA primer probe combination comprises the RPA primer and the RPA probe according to claim 1; the RPA probe comprises a probe sequence shown in SEQ ID NO: 22; from the 1st base at the 5' end, T at the 31st position is a T modified by a fluorescent group; N at the 32nd position is a tetrahydrofuran site; T at the 33rd position is a T modified by a quenching group; and the 3' end of the RPA probe is modified by a blocking group. The T modified by the fluorescent group comprises dT-FAM; the T modified by the quenching group comprises dT-BHQ1; and the blocking group comprises C3-Spacer.

3. The RPA primer probe combination of claim 2, wherein, The kit comprises the RPA primer probe combination according to any one of claims 2-3.

4. A kit for detecting Cephalosporium berberi, characterized by comprising the polynucleotide of claim 1 or 2.

5. Application of the RPA primer according to claim 1, the RPA primer probe combination according to any one of claims 2-3, or the kit according to claim 4 in detection of Cytospora arctostaphyli. The Cytospora arctostaphyli comprises Sclerophthora arctostaphyli.

6. Use according to claim 5, characterized in that, The method comprises the following steps:

7. A method for detecting Cephalosporium anguicidum, characterized by, extracting DNA from a sample to be detected; using the extracted DNA as a template, performing RPA amplification reaction by using the RPA primer probe combination according to any one of claims 2-3 or the kit according to claim 4; using a fluorescence detection device to analyze the RPA amplification product, and obtaining a DNA detection result by detecting a fluorescence signal. The RPA amplification reaction is performed under the following conditions: 39-41℃ for 15-30 min.

8. The method of claim 7, wherein, In the RPA amplification reaction system, the final concentration of the upstream primer is 420-700 nM; and the final concentration of the downstream primer is 420-700 nM.

9. The method of claim 7, wherein, The sample to be detected comprises a plant of Coptis chinensis or soil; and the plant of Coptis chinensis comprises any one or several of roots, stems, petioles and leaves of Coptis chinensis.

10. The method of claim 7, wherein, ​

Images