Application of NMT2 and inhibitor alkannic acid thereof in treatment of metabolic dysfunction related steatohepatitis

Abstract

The invention discloses an application of NMT2 and an inhibitor alkannic acid thereof in treatment of metabolic dysfunction related steatohepatitis, and belongs to the technical field of medicines and disease treatment. The invention provides application of NMT2 as a target spot in preparation or screening of drugs for treating metabolic dysfunction related steatohepatitis. The invention further provides application of the reagent for specifically inhibiting the NMT2 in preparation of the medicine for treating the metabolic dysfunction related steatohepatitis. The reagent for specifically inhibiting the NMT2 comprises alkannic acid. Experiments prove that NMT2 gene knock-down can significantly relieve the progress of MASH in mice; the alkannic acid obtained through screening is an efficient specific inhibitor of NMT2, the protection effect of the alkannic acid depends on an NMT2 target spot, and the accuracy and the treatment potential of the alkannic acid serving as the inhibitor are proved. In conclusion, the invention provides a new target and a specific inhibitor for prevention and treatment of MASH, and has important clinical application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of drugs and disease treatment, in particular to the application of NMT2 and its inhibitor shikonin in treating metabolic dysfunction-associated steatohepatitis. BACKGROUND

[0002] Metabolic dysfunction-associated steatohepatitis (MASH) is the liver manifestation of metabolic syndrome and the most important growth cause of global end-stage liver disease. Its typical pathological features include hepatocyte steatosis with ballooning degeneration, inflammatory infiltration and progressive fibrosis, which can eventually develop into cirrhosis and hepatocellular carcinoma. Due to the limited existing treatment methods, it is urgent to analyze the molecular driving factors of MASH progression and develop new treatment strategies based on core targets.

[0003] N-myristoyltransferase 2 (NMT2) belongs to the N-acetyltransferase superfamily and mediates N-myristoylation modification. At the initiation stage of substrate protein translation, NMT2 adds myristic acid to the N-terminal glycine residue of the protein through a covalent amide bond to regulate protein kinetics and function. NMT2 is related to the occurrence and progression of various human diseases: NMT2 participates in vesicle transport by mediating the N-myristoylation process of ARF6; NMT2 is a prognostic biomarker for intermediate-risk acute myeloid leukemia; NMT2 regulates the N-myristoylation modification level of MARCKS and drives pathological cardiac remodeling; NMT2 plays a key role in cell death / survival balance and innate immune inflammation. The above studies highly indicate a treatment plan targeting NMT2, however, whether NMT2 is involved in MASH progression is currently unclear. SUMMARY

[0004] The purpose of the present application is to provide the application of NMT2 and its inhibitor shikonin in treating metabolic dysfunction-associated steatohepatitis, in order to solve the problems existing in the prior art. The present application provides a new target and specific inhibitor for the prevention and treatment of MASH, which has important clinical application value.

[0005] To achieve the above purpose, the present application provides the following scheme:

[0006] The present application provides the application of NMT2 as a target in the preparation of a drug for treating metabolic dysfunction-associated steatohepatitis.

[0007] Alternatively, NMT2 is inhibited to treat metabolic dysfunction-associated steatohepatitis.

[0008] The present application also provides the application of a specific NMT2 inhibitor in the preparation of a drug for treating metabolic dysfunction-associated steatohepatitis.

[0009] Optionally, the agent that specifically inhibits NMT2 comprises a natural active small molecule inhibitor of NMT2 or an adeno-associated virus that knocks down NMT2.

[0010] Preferably, the natural active small molecule inhibitor of NMT2 is shikimic acid.

[0011] The present application also provides the use of shikimic acid in the preparation of a medicament for treating metabolic dysfunction-related steatohepatitis, wherein the shikimic acid exerts the effect of treating metabolic dysfunction-related steatohepatitis by inhibiting NMT2.

[0012] The present application also provides a medicament for treating metabolic dysfunction-related steatohepatitis, wherein the medicament comprises an agent that specifically inhibits NMT2.

[0013] Optionally, the agent that specifically inhibits NMT2 comprises a natural active small molecule inhibitor of NMT2 or an adeno-associated virus that knocks down NMT2.

[0014] Preferably, the natural active small molecule inhibitor of NMT2 is shikimic acid.

[0015] Optionally, the medicament further comprises a pharmaceutically acceptable excipient.

[0016] The excipient is any one or more of a diluent, an excipient, a disintegrant, a filler, a binder, a lubricant, a flavoring agent, a suspending agent, a surfactant, and a stabilizer.

[0017] Optionally, the administration form of the medicament comprises oral or non-oral administration.

[0018] The present application discloses the following technical effects:

[0019] 1. NMT2 protein is significantly up-regulated in MASH disease and is specifically distributed in liver parenchymal cells, suggesting that it can be used as a potential target for prevention and treatment of MASH.

[0020] 2. By constructing an NMT2 hepatocyte-specific gene intervention mouse model, it is proved that NMT2 gene knockdown can significantly alleviate the progression of MASH in mice, further supporting the feasibility of using it as a therapeutic target.

[0021] 3. By constructing an NMT2 natural active small molecule inhibitor screening system, it is obtained that shikimic acid can be used as a highly specific NMT2 inhibitor.

[0022] 4. The protective effect of shikimic acid disappears in NMT2 knockdown mice, which confirms that its effect depends on the NMT2 target and verifies the precision and therapeutic potential of the inhibitor.

[0023] In conclusion, the application provides a new target and specific inhibitor for the prevention and treatment of MASH, and has important clinical application value. BRIEF DESCRIPTION OF DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative effort.

[0025] Figure 1 NMT2 expression and cell distribution in MASH model; A: NMT2 protein level in mouse liver tissue; B: single cell RNA sequencing data of NMT2 in Human Protein Atlas; C: NMT2 immunohistochemical staining of mouse liver tissue;

[0026] Figure 2 Construction of hepatocyte-specific NMT2 knockdown model and application in MASH; A: schematic diagram of hepatocyte-specific NMT2 knockdown mouse model; B: mycoplasma detection of adeno-associated virus; C: NMT2 expression and knockdown efficiency verification; D: H&E staining, oil red O staining, and Sirius red staining of mouse liver tissue; E: liver function detection; F: liver TC and TG level detection.

[0027] Figure 3 High-throughput analysis process for screening NMT2 specific natural small molecule inhibitors from natural product library (4534 compounds) and traditional Chinese medicine monomer compound library (2906 compounds);

[0028] Figure 4 NMT2 activity inhibition efficiency detection (A) of 19 kinds of compounds and toxicology detection (B) of 9 kinds of compounds;

[0029] Figure 5 MST experiment for detecting the combination of NMT2 and LA (A) and the inhibition effect and IC50 detection of shikonin on NMT2 (B);

[0030] Figure 6 Inhibition effect of shikonin on NMT2 expression (A) and N-myristoylation level (B);

[0031] Figure 7 Verification of protective effect of shikonin; A: H&E staining, oil red O staining, and Sirius red staining of mouse liver tissue; B: liver function detection of mouse; C: liver TC and TG level detection of mouse;

[0032] Figure 8To verify the targeting specificity of shikonin; A: the influence of H&E staining, oil red O staining and Sirius red staining of mouse liver tissue; B: the influence of mouse liver function; C: the influence of mouse liver TC and TG levels. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be illustrative of certain aspects, features and embodiments of the present application, but not a limitation of the scope of the present application.

[0034] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, for a range of values of a parameter, unless otherwise stated, each intervening value of the parameter is also specifically included within the scope of the present application. The intervening values of the parameter are combined with a stated value of the parameter in range form. These are only examples of the various values of the parameter, which are encompassed by the present application. Other examples of the various values of the parameter are within the scope of the present application.

[0035] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the present specification will control.

[0036] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.

[0037] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0038] Example 1

[0039] This example studies the expression, distribution and function of NMT2 in MASH.

[0040] I. Experimental methods

[0041] 1. Construction of animal model

[0042] The NMT2 hepatocyte-specific gene intervention mouse animal model was constructed by an adeno-associated virus serotype 8 (AAV8) vector system provided by Hanheng Biotechnology Co., Ltd. (Shanghai, China), and the knockdown sequence was AAGGTATATTGCTGTTGACAGTGAGCGGGAGTCCGAGTGTCTTCAATAGTGAAGCCACAGATGTATTGAAGACACTCGGACTCCTGCCTACTGCCTCG (SEQ ID NO. 1). The specific method is as follows.

[0043] Step 1: Preparation of an adeno-associated virus vector (pHBAAV8-TBG-mir30-m-nmt2-Null)

[0044] (1) According to the vector digestion system shown in Table 1, each reagent was added in order, and placed in a 37°C water bath for 1-2 h; after enzyme digestion, agarose gel electrophoresis was performed, and the target fragment was recovered;

[0045] Table 1 Vector digestion system

[0046] Reagent Volume (μL) Vector DNA (1 μg / μL) 1 10* buffer 4 ddH2O 32 EcoRI 1.5 MIUI 1.5 co 40

[0047] (2) The primers shown in Table 2 were used to amplify the target fragment in a PCR instrument.

[0048] Table 2 Primer information

[0049] Primer name Sequence (5'-3') AAV-mir30-m-nmt2-E / M-F ACAgaattcAAGGTATATTGCTGTTGACAGTGAGCGGGAGTCCGAGTGTCTTCAATAGTGAAGCCACA (SEQ ID NO. 2) AAV-mir30-m-nmt2-E / M-R ACAacgcgtCGAGGCAGTAGGCAGGAGTCCGAGTGTCTTCAATACATCTGTGGCTTCACTATTGAAGA (SEQ ID NO. 3)

[0050] (3) The target fragment was ligated with the vector using HB infusionTM one-step cloning ligation system, and the reaction system shown in Table 3 was prepared in an ice water bath.

[0051] Table 3 Reaction system

[0052] Component name Volume (μL) Gene fragment of interest 2 (> 100 ng) Linearized vector 1 (> 50 ng) 2x HB infusion™ Master mix 10 ddH2O 7（=10-2-1） Total volume 20

[0053] (4) Transform into DH5α / Stbl3 competent cells and culture on plates. Single colonies were picked for colony PCR / digestion verification, and positive clones were sequenced. The correct clones were subjected to plasmid extraction.

[0054] Step 2: Adeno-associated virus packaging and quality detection: the three plasmids (vector plasmid carrying shRNA, pAAV-RC vector plasmid and pHelper vector plasmid, mass ratio 1:1:2) were used to transfect 293A cells using Lipofiter TMAAV-293 cells were co-transfected with transfection reagent. Cell pellets were collected 72 h post-transfection. High titer AAV stock was obtained by column purification. AAV8-TBG-sh-NMT2 was obtained, and mycoplasma detection and virus titer detection of AAV were performed.

[0055] Step 3: AAV8-TGB-NC (1.6 x 10 12 vg / mL) or AAV8-TBG-sh-NMT2 (1.2 x 10 12 vg / mL) was injected into mice (100 μL / mouse) via tail vein. After 3 weeks, the knockdown efficiency was identified by Western Blot.

[0056] NMT2 hepatocyte-specific gene intervention mice and mice injected with AAV8-empty vector were fed methionine-choline-deficient (MCD) or methionine-choline-sufficient (MCS) diets for 8 weeks to establish a model of nonalcoholic steatohepatitis (MASH) and a control group.

[0057] 2, Western Blot

[0058] Total protein quantification was performed using a BCA protein concentration assay kit (Bi Yun Tian Biotechnology Institute, Shanghai, China). Subsequently, protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and incubated with NMT2 primary antibody (Zheng Neng Biotechnology, Chengdu, China) overnight at 4°C after being transferred to a membrane. Gray value analysis of protein bands was completed using Image J (National Institutes of Health, USA) software.

[0059] 3, Immunohistochemistry experiment

[0060] After embedding and sectioning, liver tissue samples were deparaffinated with xylene and then hydrated with gradient ethanol. The sections were placed in 10 mM sodium citrate buffer and heated at 100°C for 15 minutes. After natural cooling to room temperature, they were washed with PBS. Endogenous peroxidase activity was quenched by incubating with 3% H2O2 at room temperature for 10 minutes. Anti-NMT2 primary antibody (Zheng Neng Biotechnology, Chengdu, China) was added dropwise and incubated overnight. Horseradish peroxidase (HRP)-conjugated secondary antibody was used for incubation at room temperature for 1 hour. DAB developing solution was added dropwise, and the reaction was performed in the dark for 10 minutes.

[0061] 4, Histopathological analysis

[0062] After being fixed with 4% neutral formaldehyde, liver tissue samples were embedded with paraffin and prepared into 4 μm thick sections. After deparaffination and gradient ethanol rehydration, the sections were subjected to hematoxylin-eosin (H&E) staining to observe tissue structure, oil red O staining to analyze lipid deposition, and sirius red staining to evaluate collagen fiber distribution.

[0063] 5. Biochemical testing

[0064] Serum levels of total cholesterol (TC), triglycerides (TG), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) were measured using a kit (Nanjing Jiancheng Biotechnology Institute, China).

[0065] 6. Search the Human Protein Atlas public database

[0066] Select "single+cell" to search on https: / / www.proteinatlas.org / ENSG00000152465-NMT2.

[0067] II. Experimental Results

[0068] 1. NMT2 expression is upregulated in MASH.

[0069] NMT2 protein levels were significantly elevated in liver tissue of the MASH mouse model. Figure 1 (A); Single-cell sequencing data from the Human ProteinAtlas public database and mouse liver immunohistochemical results showed the hepatocyte localization of NMT2 ( Figure 1 (Middle B and 1 Middle C).

[0070] 2. NMT2 deficiency in hepatocytes can alleviate MASH progression.

[0071] A hepatocyte-specific NMT2 gene intervention mouse model was successfully constructed using the AAV8 vector, and adeno-associated virus (AAV) was free of mycoplasma infection. Figure 2 China A- Figure 2 (C) Compared with other groups of mice, hepatocyte-specific NMT2 gene knockdown mice induced by MCD diet showed significantly reduced hepatic lipid deposition, inflammatory infiltration, and fibrosis, while liver function indicators (ALT, AST) and TC and TG levels were significantly improved. Figure 2 D-2 (F)

[0072] The above results indicate that NMT2 is a key regulatory factor for MASH.

[0073] Example 2

[0074] Because synthetic small molecule chemical inhibitors have low specificity, are prone to drug resistance, and are prone to off-target effects, this embodiment screens for novel drugs that can effectively inhibit NMT2 expression and activity.

[0075] I. Experimental Methods

[0076] 1. Virtual high-throughput screening technology

[0077] The structure of human NMT2 protein (PDB: 6PAU) was optimized by the "Protein Preparation Wizard" module in Schrodinger software. The structure was subjected to restrained energy minimization by OPLS4 force field to eliminate the interatomic conflicts (Specifically: the NMT2_HUMAN protein 6PAU structure was subjected to bond level optimization using the Protein Preparation Wizard module in Schrodinger software, protonation was performed at pH 7.0 using the PROPKA method; the structure was subjected to restrained energy optimization using the OPLS4 force field to eliminate interatomic conflicts in the structure, and the RMSD of heavy atoms was converged to 0.3 Å, and the side chain position was optimized to obtain a good side chain structure). The prepared structure was used as the receptor file for subsequent virtual screening. The compound library was processed using the "LigPrep" module in Schrodinger software (LigPrep, Schrodinger, LLC, New York, NY). The Epik method was used for protonation, desalination and isomer generation at a pH of 7.0 ± 2.0, while the original atomic chirality was retained. In order to maintain the global conformation of small molecules during virtual screening, conformation generation was performed on each small molecule, and up to 32 conformations were generated for each molecule. The prepared receptor and ligand files were imported, and then the small molecule compounds in the L6810 and L6000 databases were subjected to molecular docking using the SP (standard precision mode) screening mode.

[0078] 2. NMT2 enzyme activity assay

[0079] 10 nM of human purified NMT2 (Biogradetech, USA) and 100 μM of test ligand (TargetMol, USA) were mixed in 60 μL of assay buffer (20 nM potassium phosphate, 0.5 mM EDTA, 0.01% Triton-X100, pH 8.0) for 10 minutes at room temperature. The reaction was initiated by adding 4 μM Myristoyl coenzyme A (ChemeGen, China), 4 μM pp60src 2-9 peptide (Genscript, China) and 8 μM CPM fluorophore (Solarbio Bioscience, China), and the final volume was adjusted to 100 μL with assay buffer, followed by incubation for 30 minutes. The reaction was terminated after 5 minutes with 60 μL of 0.1M sodium acetate (pH 4.75), and the fluorescence was measured (excitation wavelength / emission wavelength = 380 / 470 nm).

[0080] 3. Microcalorimetric flux experiment

[0081] Microscale thermophoresis experiment used wild type NMT2 with GFP fluorescent protein tag and its double point mutants. First, E. coli BL21 (DE3) overnight culture containing corresponding plasmid was transferred to 1 L Luria-Bertani medium at a ratio of 1:50, cultured at 37°C, 220 rpm for 2.5 hours, then the temperature was reduced to 16°C and 0.4 mM isopropyl-β-D-thiogalactoside (IPTG) was added to induce the expression of the target protein overnight, and then the bacteria were collected by centrifugation at 5000 rpm for 15 minutes. After high pressure crushing of the bacteria at 4°C, the supernatant was sequentially purified by nickel column affinity chromatography and molecular sieve chromatography. Finally, the purified protein with a fixed concentration was mixed with a gradient dilution of shikimic acid solution, and the binding was detected using Monolith NT.115 MST instrument of German NanoTemper Technologies.

[0082] 4. Construction of in vitro MASH model

[0083] 400 μM palmitic acid oleic acid PAOA (PA:OA=1:2) was added to mouse normal hepatocytes (AML12 cells) to incubate for 24 hours to establish an in vitro MASH model.

[0084] II. Experimental results

[0085] 1. Screening process of natural small molecule inhibitors of NMT2

[0086] (1) The binding site of small molecule compounds and NMT2 structure was predicted using MOE software, and the results showed that NMT2 had a good docking pocket, which was suitable for structure-based virtual screening. Subsequently, high-throughput virtual screening was performed on NMT2 using the LigPrep module in Schrodinger software, and the L6000 natural product library (4534 compounds) and L6810 Chinese medicine monomer compound library (2906 compounds) of Targetmol were used. Among these libraries, 2954 and 2384 compounds that produced protein-ligand binding with NMT2 were screened from L6000 and L6810, respectively. DDD85646 and IMP-1088 were docked at the same time, with scores of -7.9114 and -6.6837 kcal / mol, respectively. In order to identify active molecules with higher binding affinity than these chemical inhibitors from traditional Chinese medicine, the present application selected 155 and 128 compounds with an affinity greater than -8 kcal / mol from L6000 and L6810, resulting in 73 overlapping compounds. Jarvis-Patrick cluster analysis was performed on these overlapping compounds, and finally 17 candidate molecules were selected for subsequent protein-ligand interaction fingerprint analysis and in vitro pharmacodynamics screening experimentsFigure 3 );

[0087] (2) In the NMT2 activity inhibition rate experiment, 7 candidate molecules were successfully screened ( Figure 4 (A). Subsequently, cytotoxicity tests of seven candidate molecules were conducted in AML12 cells at a concentration set at 100 μM. Finally, a compound called shikonin bound to NMT2 and showed the least cytotoxicity to AML12 cells. Figure 4 (B) will be used as the most promising natural small molecule inhibitor of NMT2 for further research.

[0088] 2. Shisonic acid inhibits NMT2 enzyme activity and protein expression.

[0089] (1) According to the molecular docking calculation model, shikonin binds to amino acids at positions 180-184 of NMT2 to form steric hindrance, forms hydrogen bond interactions with the S405 and Q496 sites of NMT2, and also forms a "solvent contact" effect around the catalyst platform centered on T282. This arrangement helps shikonin inhibit NMT2 activity by regulating the "Ab-loop" conformational switch and its binding with MyrCoA / substrate. Figure 5 (A)

[0090] (2) Shisonic acid formed a high-affinity binding with purified wild-type NMT2 protein, with a Kd value of 56.72 ± 9.94 μM ( Figure 5 (Middle B)

[0091] (3) In AML12 cells, shikonin showed good inhibitory activity against endogenous NMT2, with a half-inhibitory concentration (IC50) of 1,000%. 50 The value is 185.6 nM. Figure 6 (A)

[0092] (4) PAOA leads to increased NMT2 protein expression and overall N-myristylation levels, while shikonin inhibits this phenomenon. Figure 6 (B)

[0093] The above results indicate that shikonin is a novel inhibitor of NMT2, which can inhibit NMT2 activity and expression.

[0094] Example 3

[0095] This embodiment studies the anti-MASH effect and target specificity of shikonin.

[0096] I. Experimental Methods

[0097] 1. Animal model construction

[0098] MCD or MCS-fed for 4 weeks, wild-type mice or mice with hepatocyte-specific NMT2 gene intervention were given lavage with lithospermic acid (T3683, TargetMol Chemicals Inc, Boston, MA, USA) or solvent control (SC, 1% DMSO and 0.5% Tween 80 containing saline solution) at a dose of 20 or 40 mg / kg / day for 4 weeks. The specific grouping is as follows:

[0099] MCS+SC: After 4 weeks of MCS feeding, wild-type mice were given an equal volume of solvent control solution;

[0100] MCS+LA(High): After 4 weeks of MCS feeding, wild-type mice were given 40 mg / kg / day of lithospermic acid;

[0101] MCD+SC: After 4 weeks of MCD feeding, wild-type mice were given an equal volume of solvent control solution;

[0102] MCD+LA(Low): After 4 weeks of MCD feeding, wild-type mice were given 20 mg / kg / day of lithospermic acid;

[0103] MCD+LA(High): After 4 weeks of MCD feeding, wild-type mice were given 40 mg / kg / day of lithospermic acid;

[0104] MCD+AAV8-TGB-NC+SC: After 4 weeks of MCD feeding, mice injected with AAV8-TGB-NC were given an equal volume of solvent control solution;

[0105] MCD+AAV8-TGB-sh-NMT2+SC: After 4 weeks of MCD feeding, mice injected with AAV8-TGB-sh-NMT2 were given an equal volume of solvent control solution;

[0106] MCD+AAV8-TGB-sh-NMT2+LA: After 4 weeks of MCD feeding, mice injected with AAV8-TGB-sh-NMT2 were given 40 mg / kg / day of lithospermic acid.

[0107] 2. Histopathological analysis

[0108] The same as Example 1.

[0109] 3. Biochemical tests

[0110] The same as Example 1.

[0111] II. Experimental results

[0112] 1. Lithospermic acid significantly inhibits the progression of MASH

[0113] (1) To evaluate the therapeutic potential of LA in MASH, mice fed with MCS or MCD diet were continuously fed with LA at increasing doses for 4 weeks. High dose of LA (MCS+LA(High)) did not have any adverse effect on liver function compared to MCS+SC group. MCD diet increased collagen deposition, inflammatory infiltration, and lipid accumulation in the liver of mice, while LA significantly inhibited these pathological phenomena (Fig. 1A); Figure 7

[0114] (2) MCD diet increased the levels of AST, ALT, TC and TG in serum of mice, while LA significantly reduced the levels of these markers of liver injury enzymes (Fig. 1B and 1C). Figure 7 Figure 7

[0115] 2. LA exerts anti-MASH effect by inhibiting NMT2.

[0116] Compared to AAV8-TGB-NC group, LA administration had little effect on liver function impairment, fibrosis progression, lipid accumulation, and inflammation levels in mice with NMT2 knockdown (Fig. 2). Figure 8

[0117] The above results show that LA significantly improves MASH symptoms by targeting the inhibition of NMT2.

[0118] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the present application as defined by the claims.​​​​

Claims

1. Application of NMT2 as a target in the preparation of drugs for the treatment of metabolic dysfunction-related steatohepatitis.

2. The application as described in claim 1, characterized in that, Inhibiting NMT2 to treat metabolic dysfunction-related steatohepatitis.

3. Application of reagents that specifically inhibit NMT2 in the preparation of drugs for treating metabolic dysfunction-related steatohepatitis.

4. The application as described in claim 3, characterized in that, The reagents that specifically inhibit NMT2 include naturally active small molecule inhibitors of NMT2 or adeno-associated viruses that knock down NMT2.

5. The application as described in claim 4, characterized in that, The natural active small molecule inhibitor of NMT2 is shikonin.

6. The application of shikonin in the preparation of drugs for treating metabolic dysfunction-related steatohepatitis, characterized in that, Shicolic acid exerts its therapeutic effect on metabolic dysfunction-related steatohepatitis by inhibiting NMT2.

7. A drug for treating metabolic dysfunction-related steatohepatitis, characterized in that, The drug contains an agent that specifically inhibits NMT2.

8. The drug as described in claim 7, characterized in that, The reagents that specifically inhibit NMT2 include naturally active small molecule inhibitors of NMT2 or adeno-associated viruses that knock down NMT2.

9. The drug as described in claim 7, characterized in that, The small molecule inhibitor of NMT2 is shikonin.

10. The medicament as claimed in claim 7, characterized in that, The drug also contains pharmaceutically acceptable excipients.

Images