Anti-CD4 antibody and microsphere flow-type immunofluorescence luminescence detection kit and application thereof
By combining a double-antibody sandwich method with a combination of monoclonal antibodies that specifically recognize CD4 antigen, the sensitivity and specificity issues of CD4 antigen detection have been resolved, achieving high sensitivity and stable multi-index detection, which is suitable for multiplex immunoassay platforms.
Patent Information
- Application Number
- CN202511968501.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-24
- Publication Date
- 2026-03-20
AI Technical Summary
Existing CD4 antigen detection methods suffer from insufficient sensitivity and low specificity, making it impossible to perform multi-indicator joint detection. Magnetic fluorescent microsphere systems have high background noise, limited antibody epitope selection, and poor detection stability and signal output.
A double-antibody sandwich method was adopted, using two monoclonal antibodies, Anti-CD4-46C3 and Anti-CD4-41C7, to recognize different epitopes of the CD4 antigen. Combined with magnetic fluorescent microspheres, biotin-labeled detection antibodies, and fluorescein-labeled streptavidin, a highly sensitive detection system was formed.
It significantly improves the sensitivity and stability of CD4 antigen detection, reduces the false positive rate, enables multi-indicator joint detection, enhances signal intensity, is suitable for multiplex immunoassay platforms, is easy to operate, and has strong clinical applicability.
Smart Images

Figure CN121699012A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of immunodiagnostic technology, and relates to detection kits, particularly to a double-antibody sandwich microsphere flow cytometry fluorescence detection kit for high-sensitivity detection of CD4 antigen, as well as monoclonal antibodies for recognizing different epitopes of CD4 antigen and their applications. Background Technology
[0002] The CD4 antigen is a single-chain transmembrane glycoprotein found on the surface of human T helper cells (Th cells) and is an important member of the immunoglobulin superfamily. The CD4 antigen plays a crucial role in the body's immune response, promoting T cell activation through interaction with MHC class II molecules and acting as a major receptor mediating viral entry into cells during HIV infection. Besides T lymphocytes, the CD4 antigen is also distributed on the surface of some monocytes, dendritic cells, and brain cells.
[0003] Clinical studies have shown that the concentration of CD4 antigen in the body's blood is usually low (less than 125 pg / mL in healthy individuals), and it is of significant value in the auxiliary diagnosis of autoimmune diseases, immunodeficiency diseases, inflammatory states, and HIV infection. Therefore, high sensitivity and high specificity detection of CD4 antigen is an important requirement for immunodiagnostics.
[0004] However, existing detection methods still have significant limitations: 1. Enzyme-linked immunosorbent assay (ELISA): Limited sensitivity, making it difficult to reliably detect extremely low copies of CD4 antigen.
[0005] 2. Immunoturbidimetric assay, colloidal gold assay, and fluorescence chromatography: These methods have insufficient sensitivity, poor anti-interference ability, and cannot achieve high-throughput joint detection.
[0006] 3. Chemiluminescence immunoassay (CLIA): Although it has high sensitivity, it lacks the ability to detect multiple indicators simultaneously and is highly dependent on the instrument platform.
[0007] The rapidly developing microsphere flow cytometry fluorescence detection technology combines the advantages of immunological reactions and flow cytometry detection, and features: sensitivity down to the pg / mL level; simultaneous detection of multiple indicators (multi-indicator platform); high throughput and high degree of automation. The basic principle involves coupling capture antibodies to the surface of magnetic fluorescent microspheres, using a magnetic field to enrich and bind the antigen to be tested, and then forming a double-antibody "sandwich complex" with the detection antibody and streptavidin labeled with fluorescein. The fluorescence intensity is positively correlated with the antigen concentration, thus achieving accurate quantitative detection.
[0008] However, existing microsphere flow cytometry detection systems still lack the following for CD4 detection: paired antibodies that recognize different CD4 epitopes; magnetic fluorescent microsphere systems with good coupling efficiency and low background; detection antibody systems with high stability and high biotinylation efficiency; and blocking and buffering systems with low nonspecific binding and low background noise.
[0009] Therefore, given the above shortcomings, there is an urgent need for a CD4 antigen microsphere flow cytometry fluorescence detection kit with a well-defined structure, high specificity, high signal output, and the ability to perform multi-indicator detection. This invention addresses this need by providing a novel antibody composition, microsphere conjugation system, and detection kit. Summary of the Invention
[0010] To address the technical problems of insufficient sensitivity, low specificity, inability to perform multi-indicator joint detection, high background in magnetic microsphere systems, and limited antibody epitope selection in existing CD4 antigen detection methods, this invention provides an anti-CD4 antibody and its microsphere flow cytometry immunofluorescence detection kit and its applications. This invention provides a high-sensitivity CD4 antigen microsphere flow cytometry immunofluorescence detection kit based on a double-antibody sandwich method, as well as two monoclonal antibodies that recognize different epitopes of CD4 antigen and their applications. The solution of this invention can significantly improve the sensitivity, stability, and anti-interference ability of CD4 antigen detection and is suitable for multi-indicator joint detection platforms.
[0011] This invention aims to solve the following technical problems: 1. The lack of monoclonal antibody combinations that can simultaneously recognize different epitopes of CD4 leads to poor specificity or insufficient signal response in sandwich assays.
[0012] 2. Existing methods for coupling capture antibodies with magnetic microspheres suffer from low efficiency, high background, and unstable sedimentation, which affects the repeatability of detection.
[0013] 3. The antibody labeling efficiency of biotinylation detection fluctuates greatly, resulting in inconsistent signals.
[0014] 4. The fluorescence signal is weak or easily quenched, making it difficult to achieve the pg / mL level of sensitivity.
[0015] 5. There is a lack of stable buffering and sealing systems suitable for flow luminescence platforms.
[0016] To achieve the above objectives, the present invention adopts the following technical solution: This invention provides a monoclonal antibody capable of specifically recognizing the CD4 antigen, wherein the monoclonal antibody comprises Anti-CD4-46C3 and Anti-CD4-41C7; Anti-CD4-46C3 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes HCDR1-46C3, HCDR2-46C3 and HCDR3-46C3, and the light chain variable region includes LCDR1-46C3, LCDR2-46C3 and LCDR3-46C3. HCDR1-46C3 has the amino acid sequence shown in SEQ ID NO:1, HCDR2-46C3 has the amino acid sequence shown in SEQ ID NO:2, and HCDR3-46C3 has the amino acid sequence shown in SEQ ID NO:3. LCDR1-46C3 has the amino acid sequence shown in SEQ ID NO:4, LCDR2-46C3 has the amino acid sequence shown in SEQ ID NO:5, and LCDR3-46C3 has the amino acid sequence shown in SEQ ID NO:6. Anti-CD4-41C7 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes HCDR1-41C7, HCDR2-41C7 and HCDR3-41C7, and the light chain variable region includes LCDR1-41C7, LCDR2-41C7 and LCDR3-41C7. HCDR1-41C7 has the amino acid sequence shown in SEQ ID NO:9, HCDR2-41C7 has the amino acid sequence shown in SEQ ID NO:10, and HCDR3-41C7 has the amino acid sequence shown in SEQ ID NO:11. LCDR1-41C7 has the amino acid sequence shown in SEQ ID NO:12, LCDR2-41C7 has the amino acid sequence shown in SEQ ID NO:13, and LCDR3-41C7 has the amino acid sequence shown in SEQ ID NO:14.
[0017] As a preferred embodiment of the present invention, the heavy chain variable region of Anti-CD4-46C3 has a nucleotide sequence as shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 has a nucleotide sequence as shown in SEQ ID NO:8. The heavy chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:16.
[0018] As a preferred embodiment of the present invention, the heavy chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:8. The heavy chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:16.
[0019] The present invention also provides a dual antibody composition comprising the two monoclonal antibodies Anti-CD4-46C3 and Anti-CD4-41C7 described above, which recognize different epitopes of the CD4 antigen and jointly construct a dual antibody sandwich detection system.
[0020] This invention also provides a microsphere flow cytometry fluorescence detection kit for CD4 antigen, comprising: (1) Magnetic fluorescent microspheres coupled with the capture antibody Anti-CD4-46C3; (2) Biotin-labeled detection antibody Anti-CD4-41C7; (3) Fluorescein-labeled streptavidin; wherein the two antibodies recognize different epitopes of CD4 antigen and together form a double antibody sandwich structure to detect CD4 antigen concentration.
[0021] As a preferred embodiment of the present invention, the molar ratio of biotin to Anti-CD4-41C7 is 50-150:1.
[0022] In a preferred embodiment of the present invention, the active group of the magnetic fluorescent microspheres is -COOH.
[0023] As a preferred embodiment of the present invention, the magnetic fluorescent microspheres have an average particle size of 3-6 μm.
[0024] As a preferred embodiment of the present invention, the fluorescein-labeled streptavidin is SA-PE.
[0025] As a preferred embodiment of the present invention, the working concentration of fluorescein-labeled streptavidin is 500-3000 ng / mL.
[0026] As a preferred embodiment of the present invention, the biotinylation reaction time is 1-2 hours.
[0027] This invention also provides a magnetic fluorescent microsphere-antibody conjugate, wherein the microspheres are formed by combining Fe2O3 and / or Fe3O4 magnetic particles with a polymer material, with an average particle size of 2-8 μm, and the surface has -COOH and / or -CHO active groups, and are coupled with the aforementioned Anti-CD4-46C3 at a ratio of 1×10⁻⁶. 6 Microspheres were obtained by coupling 10-50 μg of antibody to a specific ratio.
[0028] As a preferred embodiment of the present invention, the coupling reaction is carried out in MES buffer at pH 4.8-6.0.
[0029] As a preferred embodiment of the present invention, the sealing liquid comprises 1% BSA and 0.25% ethanolamine.
[0030] This invention also provides a method for detecting CD4 antigen, comprising the following steps: (1) Contact the sample to be tested with the above-mentioned coupled microspheres so that the CD4 antigen is captured; (2) Add biotin-labeled detection antibody Anti-CD4-41C7; (3) Add fluorescein-labeled streptavidin; (4) Use a flow cytometry platform to read the fluorescence signal and calculate the CD4 antigen concentration based on the calibration curve.
[0031] As a preferred embodiment of the present invention, the incubation time for the capture reaction is 20-40 minutes.
[0032] As a preferred embodiment of the present invention, the antibody incubation time is 20-40 minutes.
[0033] As a preferred embodiment of the present invention, the incubation time for fluorescein-labeled streptavidin is 10-20 minutes.
[0034] As a preferred embodiment of the present invention, the flow cytometry detection platform is a microsphere flow luminescence system.
[0035] This invention also provides a method for preparing a CD4 detection kit, comprising the following steps: (1) Anti-CD4-46C3 was coupled to magnetic microspheres in MES buffer using an EDC system; (2) Biotinylation of Anti-CD4-41C7 was achieved using NHS-biotin in a PBS system; (3) Prepare a working solution of fluorescein-labeled streptavidin; (4) Prepare coupling diluent, labeling diluent and blocking solution to form a complete reagent system.
[0036] As a preferred embodiment of the present invention, the amount of EDC added is 5-15 μL (10 mg / mL).
[0037] As a preferred embodiment of the present invention, the sealing step is carried out at room temperature for 1-3 hours.
[0038] As a preferred embodiment of the present invention, unreacted biotin is removed by ultrafiltration after biotinification.
[0039] The present invention also provides the use of the above-mentioned monoclonal antibody or the above-mentioned biclonal antibody composition in the preparation of a microsphere flow cytometry assay kit for detecting human CD4 antigen.
[0040] As a preferred embodiment of the present invention, the kit is used for the quantitative detection of CD4 antigen in serum or plasma samples.
[0041] As a preferred embodiment of the present invention, the antibody is used in a multiplex immunoassay system.
[0042] Compared with the prior art, the present invention has the following beneficial effects: 1) The dual epitope identification strategy significantly improves specificity and signal strength, and reduces the false positive rate.
[0043] 2) Magnetic fluorescent microsphere carriers enhance antibody immobilization efficiency and signal output capability.
[0044] 3) The biotinylated detection antibody and the SA-PE system have stable signals and high sensitivity, reaching the pg / mL level.
[0045] 4) The system is compatible with multi-index detection and can be used in multiplex immunoassay platforms.
[0046] 5) Excellent repeatability, CV value ≤10%.
[0047] 6) It is easy to operate, has little dependence on the instrument platform, and is highly applicable to clinical use.
[0048] 7) The CD4 antigen detection kit and its antibody combination provided by the present invention can significantly improve the sensitivity, stability, specificity and throughput of CD4 detection, and are applicable to multiple fields such as immune function assessment, autoimmune disease assessment, inflammatory disease research and HIV infection auxiliary diagnosis. Attached Figure Description
[0049] The accompanying drawings are provided to further understand the technical solutions of the present invention and constitute a general schematic illustration of the technical content of the present invention as part of the specification. Unless otherwise stated, the scale and dimensional relationships in the drawings are not intended to limit the actual scale of the present invention, and the same or similar reference numerals in the drawings correspond to the same or similar technical features.
[0050] Figure 1 This is a schematic diagram of the microsphere flow cytometry fluorescence detection principle for detecting CD4 antigen in this invention, illustrating the process of capturing antibody-coupled magnetic fluorescent microspheres, biotinylated detection antibody, and fluorescein-labeled streptavidin forming a double antibody sandwich complex.
[0051] Figure 2 This is a calibration curve obtained by the detection kit of the present invention at a series of CD4 standard concentrations, showing the linear relationship between fluorescence intensity and CD4 antigen concentration.
[0052] Figure 3 This is a schematic diagram of the structure of the monoclonal antibodies (Anti-CD4-46C3 and Anti-CD4-41C7) provided by the present invention, including the composition of the heavy chain variable region (VH), the light chain variable region (VL) and their CDR regions.
[0053] Figure 4 This is the linear regression equation of the present invention.
[0054] The accompanying drawings are used to illustrate the principles and embodiments of the present invention and do not constitute a limitation on the scope of protection of the present invention. Those skilled in the art can adjust or modify the structural details based on the drawings without departing from the spirit and essence of the present invention, and all such adjustments or modifications should fall within the scope of protection of the present invention. Detailed Implementation
[0055] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0056] See Figure 1 and Figure 3 This invention provides a schematic diagram of the microsphere flow cytometry fluorescence detection principle for detecting CD4 antigen, illustrating the process of capturing antibody-coupled magnetic fluorescent microspheres, biotinylated detection antibody, and fluorescein-labeled streptavidin forming a double antibody sandwich complex.
[0057] This invention provides two monoclonal antibodies, comprising Anti-CD4-46C3 and Anti-CD4-41C7. Anti-CD4-46C3 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes HCDR1-46C3, HCDR2-46C3 and HCDR3-46C3, and the light chain variable region includes LCDR1-46C3, LCDR2-46C3 and LCDR3-46C3. HCDR1-46C3 has the amino acid sequence shown in SEQ ID NO:1, HCDR2-46C3 has the amino acid sequence shown in SEQ ID NO:2, and HCDR3-46C3 has the amino acid sequence shown in SEQ ID NO:3. LCDR1-46C3 has the amino acid sequence shown in SEQ ID NO:4, LCDR2-46C3 has the amino acid sequence shown in SEQ ID NO:5, and LCDR3-46C3 has the amino acid sequence shown in SEQ ID NO:6. Anti-CD4-41C7 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes HCDR1-41C7, HCDR2-41C7 and HCDR3-41C7, and the light chain variable region includes LCDR1-41C7, LCDR2-41C7 and LCDR3-41C7. HCDR1-41C7 has the amino acid sequence shown in SEQ ID NO:9, HCDR2-41C7 has the amino acid sequence shown in SEQ ID NO:10, and HCDR3-41C7 has the amino acid sequence shown in SEQ ID NO:11. LCDR1-41C7 has the amino acid sequence shown in SEQ ID NO:12, LCDR2-41C7 has the amino acid sequence shown in SEQ ID NO:13, and LCDR3-41C7 has the amino acid sequence shown in SEQ ID NO:14.
[0058] The heavy chain variable region of Anti-CD4-46C3 has the nucleotide sequence shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 has the nucleotide sequence shown in SEQ ID NO:8. The heavy chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:16.
[0059] The heavy chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:8. The heavy chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:16.
[0060] In a preferred embodiment, the heavy and light chain sequences of the two antibodies have mutant sequences with ≥80%, 85%, 90%, 95%, and 98% homology, respectively.
[0061] Both antibodies can be used as capture or detection antibodies to construct a double-antibody sandwich system.
[0062] 2. Microsphere Flow Cytometry Detection Kit The kit of the present invention comprises at least: 1. Magnetic fluorescent microspheres coupled with Anti-CD4-46C3; 2. Biotin-labeled Anti-CD4-41C7 detection antibody; 3. Fluorescein-labeled streptavidin (preferably SA-PE); 4. Specialized diluent, reaction buffer, blocking solution, and preservative system.
[0063] The magnetic fluorescent microspheres have the following characteristics: the microspheres are formed by combining nano-sized Fe2O3 and / or Fe3O4 magnetic particles with polymer materials; the average particle size is 2-8 μm; the surface contains active groups (e.g., -CHO, -COOH) to improve coupling efficiency; and the coupling ratio is 1×10⁻⁶. 6 Each magnetic bead contains 10-50 μg of capture antibody.
[0064] The biotinylated detection antibody has the following characteristics: a biotin to antibody molecule ratio of 50-200:1; labeling is performed in a PBS buffer system; and the labeling reaction time is 1-2 hours.
[0065] The preferred fluorescein-labeled streptavidin is SA-PE (phycoerythrin-labeled streptavidin) to obtain high quantum yield, strong signal and stability.
[0066] 3. Detection Method This invention provides a method for detecting CD4 antigen in a sample using the above-mentioned kit, comprising the following steps: 1. Add magnetic fluorescent microspheres conjugated with antibodies to capture CD4 antigen; 2. Add biotinylated detection antibody, which binds to another epitope of the CD4 antigen; 3. Add SA-PE to allow it to specifically bind with biotin to form a fluorescent complex; 4. Fluorescence intensity was read using flow cytometry; 5. Calculate the CD4 antigen concentration based on the calibration curve.
[0067] This method has the advantages of fast response speed, simple operation, high sensitivity and strong anti-interference ability.
[0068] 4. Preparation method of the reagent kit This invention provides a method for preparing a reagent kit, comprising: 1. Coupling steps of magnetic microspheres with Anti-CD4-46C3: Activation and coupling were performed in MES buffer via an EDC system; 2. Antibody biotinylation detection step: Biotin-NHS was used for labeling in PBS, and free biotin was removed by ultrafiltration; 3. Preparation of SA-PE working solution; 4. Prepare necessary reagents such as coupling diluent, labeling diluent, and blocking solution.
[0069] Example 1 (I) Preparation and characteristics of anti-CD4 monoclonal antibodies The present invention provides two monoclonal antibodies, Anti-CD4-46C3 and Anti-CD4-41C7, which recognize different epitopes of the CD4 antigen and are used to construct a double-antibody sandwich detection system. Both antibodies were prepared using cell fusion technology, and stable antibody-secreting hybridoma cell lines were obtained through subcloning. The antibodies were purified by protein A / G chromatography, and the buffer system was adjusted to PBS (pH 7.4) to finally obtain a monoclonal antibody solution with a purity ≥95%.
[0070] The heavy chain variable region of Anti-CD4-46C3 has the nucleotide sequence shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 has the nucleotide sequence shown in SEQ ID NO:8. The heavy chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:16.
[0071] The heavy chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:8. The heavy chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:16.
[0072] The present invention also includes functionally intact mutants whose sequences have ≥80%, 85%, 90%, 95% or ≥98% homology with the above-mentioned amino acid sequences.
[0073] (II) Preparation of magnetic fluorescent microspheres and antibody conjugation 1. Microsphere materials This invention utilizes nanoscale Fe2O3 / Fe3O4 magnetic particles combined with polymer materials (such as polystyrene) to form microspheres with an average particle size of 2-8 μm. The surface of the microspheres contains -COOH or -CHO active groups, which can be directly used for covalently coupling antibodies.
[0074] The microspheres have the following performance requirements: rapid magnetization under an applied magnetic field, with near-zero remanence after the magnetic field is removed; strong dispersibility and moderate settling rate, without forming obvious aggregation; and suitable surface carboxyl group density to ensure efficient low-background coupling.
[0075] 2. Coupling buffer A 0.01-0.05 mol / L MES buffer (pH 4.8-6.0) is preferred. Its function is to maintain optimal conditions for the carboxyl activation reaction and improve coupling efficiency.
[0076] 3. Coupling steps (Anti-CD4-46C3) (1) Take 100 μL (1×10 7 Add 1 mL of MES buffer to magnetic fluorescent microspheres (number per mL), allow them to settle magnetically, discard the supernatant, and repeat the washing process 3-5 times.
[0077] (2) Add 10-50 μg Anti-CD4-46C3, mix and incubate at 37°C for 30 min to allow the antibody to fully bind to the microspheres.
[0078] (3) Add EDC as an activator (e.g., 10 μL, 10 mg / mL) and continue the reaction at 37 °C for 2 h to activate the carboxyl group and cross-link it with the antibody amino group.
[0079] (4) Add blocking solution (1% BSA + 0.25% ethanolamine + borate buffer) and block at room temperature for 2 hours to reduce non-specific adsorption.
[0080] (5) Wash with coupling diluent 3-5 times and then resuspend. Store at 4°C for later use.
[0081] (iii) Detection of antibody biotinylation 1. Buffer system Antibody biotinylation is preferably performed using PBS buffer with a pH of 7.2-7.4.
[0082] 2. Biotin reagent Using NHS-activated biotin allows for specific binding to lysine residues of the antibody. The preferred biotin:antibody molar ratio is 50-200:1 to obtain the optimal labeling density.
[0083] 3. Biotinylation step (Anti-CD4-41C7) (1) Place the antibody in a dialysis device and dialyze with a large amount of PBS for 12-24 hours to ensure that there are no amine substances in the system that may interfere with the reaction.
[0084] (2) Add an appropriate amount of NHS-biotin (e.g., 1.6 μL of 10 mM solution) to 0.5 mL of antibody solution, and incubate in the dark at room temperature for 1-2 h.
[0085] (3) Use an ultrafiltration device (4000×g) to wash 2-3 times to remove free biotin.
[0086] (4) Add the marked diluent to make up the volume, and store at 4°C for later use.
[0087] (iv) Preparation of SA-PE fluorescence system and diluent 1. SA-PE working solution Phycoerythrin-labeled streptavidin (SA-PE) was diluted to 2000 ng / mL with PBS (pH 7.2) and stored away from light.
[0088] 2. Diluent and Preservative The preferred system of this invention is as follows: Coupling diluent: Tris buffer + BSA + Tween-20; Labeling diluent: PBS; Preservative: Proclin 300, with a concentration of 0.05-0.1%.
[0089] (v) Detection methods for CD4 antigen The detection method provided by this invention includes the following steps: (1) Add 50 μL of the sample to be tested and 10 μL of the coupled microspheres to the reaction vessel, mix well, and incubate for 30 min.
[0090] (2) Add 50 μL of biotinylated detection antibody and continue incubation for 30 min.
[0091] (3) Add 50 μL of SA-PE solution and incubate for 10-15 min.
[0092] (4) Magnetic adsorption sedimentation, discard the supernatant and add sample for determination.
[0093] (5) Use flow cytometer to read fluorescence intensity and calculate CD4 antigen content based on calibration curve.
[0094] Technical performance evaluation (1) Prepare a calibration curve using CD4 antigen as the standard, and perform detection at the labeled concentration (see [reference]). Figure 2 (See Table 1).
[0095] Table 1. Calibration Curves Labeled concentration (ng / ml) signal value 0 716 0.05 2405 0.25 8300 1.25 39941 6.25 214971 31.25 775450 (2) Blank limit test: The kit is tested with blank (zero value enterprise calibrator) as sample. The test is repeated 10 times. The mean value X1 and the standard deviation of blank response (SD) are calculated. X1 (mean value of blank response) + 2SD (standard deviation of blank response) are substituted into the calibration curve to calculate the sensitivity. See Table 2.
[0096] Table 2. Blank Limit Test Data Test 1 Test 2 Test 3 Test 4 Test 5 Test 6 Test 7 Test 8 Test 9 Test 10 797 803 676 712 677 640 639 650 624 694 EVA+2SD=818, and the result of curve fitting is 0.0039 ng / mL.
[0097] (3) Precision test: Use the same batch of kits to test two samples with concentrations in the high-value quality control range and the low-value quality control range, repeat the test 10 times each, calculate the CV value, and the result should be ≤10%, see Table 3.
[0098] Calculation formula: .
[0099] Note: Standard deviation , This represents the average value of the test data.
[0100] Table 3. Precision Test Data Test 1 Test 2 Test 3 Test 4 Test 5 Test 6 Test 7 Test 8 Test 9 Test 10 Repeatability 0.25 0.24 0.25 0.24 0.25 0.24 0.23 0.24 0.25 0.23 3.26% 7.63 7.78 8.37 8.58 8.35 7.96 8.09 7.51 7.88 7.62 4.55% The CV values for both high and low quality control measurements were less than 10%.
[0101] (4) Linear range test: Measure the linear range using gradient samples, calculate the average value, and fit the measured average value and the theoretical value using the least squares method to obtain the linear regression equation. Calculate the linear correlation coefficient r, which should not be less than 0.975. See [link to relevant documentation]. Figure 4 .
[0102] Correlation coefficient calculation formula: , Note: In the formula, -1 ≤ γ ≤ 1. = , The linear correlation coefficient is greater than 0.975.
[0103] (5) Accuracy test: Add a high level of analyte A of known concentration to a low concentration of serum B. The volume ratio of analyte A to serum B is 1:9. Repeat the test 3 times and take the average value. Calculate the recovery rate according to the formula. It should be between 85% and 115%. See Table 5.
[0104] Calculation formula: * 100% In the formula: R -- Recovery rate; C -- The average concentration measured after adding solution A to solution B; V0 -- Liquid volume of B; Vs -- Volume of liquid A; C0 -- the average concentration of solution B; Cs -- the average concentration of solution A.
[0105] Table 5. Accuracy Test Data Cs C0 C Recovery rate 25.86 1.13 3.61 100.27% The recovery rate was 100.27%.
[0106] (vii) Explanation of applicability and extensibility This invention's kit is suitable for sample types such as serum, plasma, and cell culture supernatant, and can be extended to multiplex assays. The conjugated microsphere and antibody system is compatible with different flow cytometry platforms, including but not limited to traditional flow cytometers and microsphere flow cytometry platforms.
[0107] sequence list The amino acid and nucleotide sequences involved in this invention are shown below, and are used to support the accuracy of antibody structure definition, CDR region definition, and the scope of protection of the claims.
[0108] (a) CDR amino acid sequence (46C3, SEQ ID NO:1-6) SEQ ID NO: 1 (HCDR1-46C3): GYAIS.
[0109] SEQ ID NO: 2 (HCDR2-46C3): IIETGGSTYYANWAKG.
[0110] SEQ ID NO: 3 (HCDR3-46C3): GVSSSSGNLHDYGMDL.
[0111] SEQ ID NO:4 (LCDR1-46C3): QASHSISSQLV.
[0112] SEQ ID NO: 5 (LCDR2-46C3): KASTLAS.
[0113] SEQ ID NO:6 (LCDR3-46C3): QETYDSTNVDNA.
[0114] (ii) Nucleotide sequence of the variable region of heavy and light chains (46C3, SEQ ID NO:7-8) SEQ ID NO:7 (46C3 heavy chain VH nucleic acid sequence): ATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCTGTGCTCAAAGGTGTCCAGTGTCAGGAGCAGCTGAAGGAGCGGGGGAGACCTGGTCACGCCTGGGACACCCCTGACACTCACCTGCACAGTCTCTGGAATCGACCTCAGTGGCTATGCAATAAGCTGGGTCCGCCAGTCCAGGGAAGGGGCTGGAATGGATCGGCATCATTGA GACTGGTGGTAGCACATACTACGCGAACTGGGCGAAAGGCCGATTCACCATTTCCAAAACCTCGACCACGGTGGATCTGAAAATCACCAGTCCGACAACCGAGGACACGCCACGTATTTCTGTGCCAGAGGTGTTAGTAGCAGTGGTAACCTCCATGACTACGGCATGGACCTCTGGGGCCCAGGGACCCTCGTCACCGTCTCTTCA.
[0115] SEQ ID NO:8 (46C3 light chain VL nucleic acid sequence): ATGGACACGAGGGCCCCCACTCAGCTGCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCAGGTGTGCATTCGAGATGACCCAGACTCCAGCCTCCGTTGCAGCTGTGGGAGGCACAGTCACCATCAAGTGCCAGGCCAGTCACAGCATTAGTAGTCAATTAGTCTGGTATCAACAGAAACCAGGGCAGCCTCCC AAGCTCCTGATCTACAAGGCATCCACTCTGGCATCTGGGGTCTCATCGCGGTTCAAAGGCAGTGGATCTGGGACACAGTTCACTCTCACCATCAGCGGCGTGGAGTGTGCCGATGCCACTTACTGTCAAGAAACTTATGACAGTACTAATGTTGATAATGCTTTCGGCGGAGGGACCGAGGTGGTGGTCAAA.
[0116] (iii) CDR amino acid sequence (41C7, SEQ ID NO:9-14) SEQ ID NO:9 (HCDR1-41C7): TYGVT.
[0117] SEQ ID NO: 10 (HCDR2-41C7): IISFDNNAFYASWAKG.
[0118] SEQ ID NO: 11 (HCDR3-41C7): HESDWYYVL.
[0119] SEQ ID NO: 12 (LCDR1-41C7): QASQSIGSSLA.
[0120] SEQ ID NO: 13 (LCDR2-41C7): DASDLAS.
[0121] SEQ ID NO: 14 (LCDR3-41C7): QNYFGITTFGGA.
[0122] (ii) Nucleotide sequences of the variable regions of the heavy and light chains (41C7, SEQ ID NO:15-16) SEQ ID NO:15 (41C7 heavy chain VH nucleic acid sequence): ATGGAGACTGGGCTGCGCTGGCTTCTCCTGGTCGCTGTGCTCAAAGGTGTCCAGTGTCAGTCGGTGGAGGAGTCCGGGGGTCGCCTGACGCCTGGGACACCCCTGACACTCACCTGCACAGTCTCTGGATTCTCCCTCAATACCTATGGAGTGACCTGGGTCCGCCAGGCTCCAGAGGGGCTGGAATACATCGGAATCATTAGTTTTGATAATAATGCATTTTACGCGAGCTGGGCGAAAGGGCGATTCATCTCCAAGACCTCGACCACGGTGGTGCTGAGAATCACCAGTCCGACAACCGAGGACACGGCCACCTATTTCTGTGCCAGACATGAAAGTGACTGGTATTATGTCTTGTGGGGCCCAGGCACCCTGGTCACCGTCTCCTCA。
[0123] SEQ ID NO:16 (41C7 light chain VL nucleic acid sequence): ATGGACACGAGGGCCCCCACTCAGCTGCTGGGGCTCCTGCTGCTCTGGCTCCCAGGTGCCAGATGTGCATTCGAATTGACCCAGACTCCATCCCCGTGGAGGCAGCTGTGGGAGGCACAGTCACCATCAAGTGCCAGGCCAGTCAGAGCATTGGTAGTAGCTTAGCCTGGTATCAGCAGAAACCAGGCAGCGTCCCAAGCTCCTGATCTATGATGCATCCGATCTGGCATCTGGGGTCCCATCGCGGTTAAGGGCAGTGGATCTGGGACAGAGTTCACTCTCACCATCAGCGACCTGGAGTGTGCCGATGCCACTTACTACTGTCAAAACTATTTTGGTATTACTACTTTTGGAGGGGCTTTCGGCGGAGGGACCGAGGTGGTGGTCAAG。
[0124] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A monoclonal antibody capable of specifically recognizing CD4 antigen, characterized in that, The monoclonal antibodies mentioned include Anti-CD4-46C3 and Anti-CD4-41C7; Anti-CD4-46C3 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes HCDR1-46C3, HCDR2-46C3 and HCDR3-46C3, and the light chain variable region includes LCDR1-46C3, LCDR2-46C3 and LCDR3-46C3. HCDR1-46C3 has the amino acid sequence shown in SEQ ID NO:1, HCDR2-46C3 has the amino acid sequence shown in SEQ ID NO:2, and HCDR3-46C3 has the amino acid sequence shown in SEQ ID NO:
3. LCDR1-46C3 has the amino acid sequence shown in SEQ ID NO:4, LCDR2-46C3 has the amino acid sequence shown in SEQ ID NO:5, and LCDR3-46C3 has the amino acid sequence shown in SEQ ID NO:
6. Anti-CD4-41C7 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes HCDR1-41C7, HCDR2-41C7 and HCDR3-41C7, and the light chain variable region includes LCDR1-41C7, LCDR2-41C7 and LCDR3-41C7. HCDR1-41C7 has the amino acid sequence shown in SEQ ID NO:9, HCDR2-41C7 has the amino acid sequence shown in SEQ ID NO:10, and HCDR3-41C7 has the amino acid sequence shown in SEQ ID NO:
11. LCDR1-41C7 has the amino acid sequence shown in SEQ ID NO:12, LCDR2-41C7 has the amino acid sequence shown in SEQ ID NO:13, and LCDR3-41C7 has the amino acid sequence shown in SEQ ID NO:
14.
2. The monoclonal antibody capable of specifically recognizing CD4 antigen according to claim 1, characterized in that, The heavy chain variable region of Anti-CD4-46C3 has the nucleotide sequence shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 has the nucleotide sequence shown in SEQ ID NO:
8. The heavy chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 has the nucleotide sequence shown in SEQ ID NO:
16.
3. The monoclonal antibody capable of specifically recognizing CD4 antigen according to claim 2, characterized in that, The heavy chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:7, and the light chain variable region of Anti-CD4-46C3 contains 80-99% homology of the nucleotide sequence shown in SEQ ID NO:
8. The heavy chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:15, and the light chain variable region of Anti-CD4-41C7 contains a mutant with nucleotide sequence homology ≥85% as shown in SEQ ID NO:
16.
4. A dual antibody composition, characterized in that, It comprises the two monoclonal antibodies Anti-CD4-46C3 and Anti-CD4-41C7 as described in any one of claims 1-3, which recognize different epitopes of the CD4 antigen and jointly construct a double-antibody sandwich detection system.
5. A microsphere flow cytometry fluorescence detection kit for CD4 antigen, characterized in that, include: (1) Magnetic fluorescent microspheres coupled with the capture antibody Anti-CD4-46C3; (2) Biotin-labeled detection antibody Anti-CD4-41C7; (3) Fluorescein-labeled streptavidin; wherein the two antibodies recognize different epitopes of CD4 antigen and together form a double antibody sandwich structure to detect CD4 antigen concentration.
6. The CD4 antigen microsphere flow cytometry fluorescence detection kit according to claim 5, characterized in that, The molar ratio of biotin to Anti-CD4-41C7 is 50-150:
1.
7. A magnetic fluorescent microsphere-antibody conjugate, characterized in that, The microspheres are formed by combining Fe2O3 and / or Fe3O4 magnetic particles with polymer materials, with an average particle size of 2-8 μm and -COOH and / or -CHO active groups on the surface, and are made of Anti-CD4-46C3 as described in any one of claims 1-3 at a ratio of 1×10⁻⁶. 6 Microspheres were obtained by coupling 10-50 μg of antibody to a specific ratio.
8. A method for detecting CD4 antigen, characterized in that, Includes the following steps: (1) The sample to be tested is brought into contact with the coupled microspheres of claim 6 so that the CD4 antigen is captured; (2) Add biotin-labeled detection antibody Anti-CD4-41C7; (3) Add fluorescein-labeled streptavidin; (4) Use a flow cytometry platform to read the fluorescence signal and calculate the CD4 antigen concentration based on the calibration curve.
9. A method for preparing a CD4 detection kit, characterized in that, Includes the following steps: (1) Anti-CD4-46C3 was coupled to magnetic microspheres in MES buffer using an EDC system; (2) Biotinylation of Anti-CD4-41C7 was achieved using NHS-biotin in a PBS system; (3) Prepare a working solution of fluorescein-labeled streptavidin; (4) Prepare coupling diluent, labeling diluent and blocking solution to form a complete reagent system.
10. Use of the monoclonal antibody according to any one of claims 1-3 or the biclonal antibody composition according to claim 4 in the preparation of a microsphere flow cytometry assay kit for detecting human CD4 antigen.