Saccharomyces cerevisiae and application thereof in hydroxylated soy isoflavone aglycone

Abstract

The application discloses a saccharomyces cerevisiae and application of the saccharomyces cerevisiae in hydroxylated soybean isoflavone aglycone, and belongs to the technical field of microorganisms. The saccharomyces cerevisiae is saccharomyces cerevisiae Sc45-32, and the preservation number is CGMCC No. 39082. The strain has the conversion capacity for soybean isoflavone aglycone, can take yellow pulp water as a culture medium, and converts the soybean isoflavone aglycone in the yellow pulp water into 4', 6, 7-trihydroxyisoflavone. The conversion mode is simple, low in cost, green and environment-friendly. Not only has great application prospect in the hydroxylated soybean isoflavone aglycone, but also can improve the utilization of waste resources rich in soybean isoflavone such as yellow pulp water, and has great economic value and social benefits.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of brewer's yeast and its application in hydroxylated soybean isoflavone aglycones. Background Technology

[0002] Soy isoflavones are flavonoid compounds widely found in soybeans and their processed products. Due to their various physiological functions, including antioxidant activity, prevention of cardiovascular disease, improvement of menopausal symptoms, and potential anticancer activity, they have become a highly sought-after natural active ingredient in the research and development of functional foods, health products, and pharmaceuticals. In soybeans, isoflavones mainly exist in the form of glycosides with lower biological activity (such as daidzein, genistein, and glycinin). However, during intestinal or in vitro fermentation, these glycosides can be hydrolyzed by microbial β-glucosidases, converting them into aglycone forms with higher biological activity, namely daidzein, genistein, and glycinin.

[0003] Further research has shown that hydroxylation modification of the above-mentioned aglycones to generate polyhydroxylated isoflavones (such as 4',6,7-trihydroxyisoflavone) can significantly improve their water solubility, bioavailability, and targeted bioactivity. Due to its unique "hydroxylation upgrade" structure, 4',6,7-trihydroxyisoflavone has been proposed as a lead compound for functional foods, topical skin preparations, or kinase inhibitors, possessing extremely high added value. However, this compound is found in very low amounts in nature, making direct extraction difficult.

[0004] Currently, methods for obtaining hydroxylated soybean isoflavone aglycones (especially 4',6,7-trihydroxyisoflavones) mainly rely on molecular biology techniques or chemical synthesis. For example, genetic engineering is used to heterologously express plant or microbial cytochrome P450 hydroxylases in microorganisms (such as yeast and Escherichia coli) to achieve targeted hydroxylation of specific substrates. Although these methods have clear transformation targets, they usually have the following shortcomings: (1) high technical barriers, involving complex gene cloning, expression system construction and optimization; (2) strict process control and high costs; (3) potential safety and regulatory restrictions on genetically engineered organisms. Chemical synthesis, on the other hand, is often cumbersome, requires the use of toxic reagents, and makes it difficult to guarantee the stereospecificity of the product, which is not in line with the concept of green and sustainable development.

[0005] On the other hand, the processing of soy products (such as tofu and dried bean curd sticks) generates a large amount of byproducts—soy whey (also known as soy water or soybean whey). Soy whey is rich in underutilized proteins, carbohydrates, and soy isoflavones in the form of glycosides. Currently, most soy whey is directly discharged, causing serious environmental pollution and wasting valuable isoflavone resources. Although some studies have attempted to use microorganisms (such as lactic acid bacteria and yeast) to ferment soy whey to enhance its value, their main objectives are usually to degrade anti-nutritional factors, improve flavor, or produce biomass. There are no reports of natural, non-genetically engineered microbial strains capable of using soy whey as a natural culture medium to directly and efficiently convert soy isoflavone aglycones into high-value-added hydroxylated products (especially 4',6,7-trihydroxyisoflavones).

[0006] Therefore, there is an urgent need in this field to develop a simple, low-cost, and environmentally friendly biotransformation technology that can utilize soybean processing waste such as soybean slurry to efficiently convert low-activity soybean isoflavone aglycones into high-value hydroxylated products through natural fermentation, thereby achieving the dual goals of resource utilization of waste and production of high-value products. Summary of the Invention

[0007] In view of the problems existing in the prior art, the purpose of this invention is to provide a brewing yeast strain and its application in hydroxylated soybean isoflavone aglycones.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] A strain of Saccharomyces cerevisiae, Sc45-32, with accession number CGMCC No. 39082.

[0010] The application of the above-mentioned brewer's yeast in hydroxylated soybean isoflavone aglycones.

[0011] Based on the above scheme, it is used to prepare 4',6,7-trihydroxyisoflavone.

[0012] Based on the above scheme, yellow slurry was used as the culture medium, and fermentation was carried out using Saccharomyces cerevisiae Sc45-32 with preservation number CGMCC No.39082.

[0013] Based on the above scheme, the fermentation conditions are: fermentation culture for 18-48 hours at 28-30℃ and 150-200 r / min.

[0014] Based on the above scheme, the inoculum size of Saccharomyces cerevisiae Sc45-32 with preservation number CGMCC No.39082 in the culture medium is 0.5-5%.

[0015] Based on the above scheme, the yellow liquid is soybean product yellow liquid.

[0016] Based on the above scheme, the soy product yellow liquid is a liquid byproduct produced during the production of soy products from soybeans after pressing or filtration.

[0017] Based on the above scheme, the soy product is tofu or dried bean curd sticks.

[0018] Advantages of the technical solution of this invention:

[0019] This invention discloses a brewing yeast strain obtained from the sour whey produced during tofu pressing. This strain possesses the ability to transform daidzein (Glycitein, Daidzein, Genistein) into hydroxylated daidzein (4',6,7-Trihydroxyisoflavone) using sour whey as a culture medium. Currently, the hydroxylation of daidzein largely relies on molecular methods. The brewing yeast Sc45-32 of this invention can hydroxylate daidzein to 4',6,7-Trihydroxyisoflavone through natural fermentation. The transformation method is simple, low-cost, and environmentally friendly. It not only has great application potential in the hydroxylation of daidzein but also improves the utilization of waste resources rich in daidzein, such as soy whey, resulting in significant economic and social benefits. Attached Figure Description

[0020] Figure 1 Colony morphology of Saccharomyces cerevisiae D10;

[0021] Figure 2 Phylogenetic tree of Saccharomyces cerevisiae D10;

[0022] Figure 3 Results of the saccharin colorimetric assay for Saccharomyces cerevisiae Sc45-32 (left image is the negative control, right image is the colorimetric result of saccharomyces cerevisiae Sc45-32 through puncture).

[0023] Figure 4 Image of the appearance of the yellow liquid culture medium;

[0024] Figure 5 Determination of the ability of yeast in yellow sap to convert isoflavone glycosides;

[0025] Figure 6The results are the assay results of hydroxylase activity in Saccharomyces cerevisiae Sc45-32;

[0026] Figure 7 Mass spectrum of non-target metabolite 4',6,7-Trihydroxyisoflavone;

[0027] Figure 8 Extraction ion chromatogram of 4',6,7-trihydroxyisoflavone detected in targeted metabolic analysis (where RT=5.269 is the peak time of the main peak; at this moment, the concentration of the target substance is the highest; RT=5.624 is the labeling time of a small peak to the right of the main peak and the tail; Q271.00>168.9(+), Q is the ion pair, 271.00 > 168.90 is the ion transition / mass-charge ratio conversion, 271.00 is the mass of the parent ion, > represents the fragmentation process, 168.90 is the mass of the daughter ions produced after fragmentation, (+) is the positive ion mode).

[0028] Figure 9 The content of soybean isoflavone aglycones in fermented yellow water by strain D10 (where CK is unfermented yellow water culture medium, and D10 is fermented yellow water culture medium by Saccharomyces cerevisiae Sc45-32. Black dots: correspond to 3 independent measurements of the CK group. Purple dots: correspond to 3 independent measurements of the D10 group).

[0029] Figure 10 The content of 4',6,7-Trihydroxyisoflavone in fermented yellow water by strain D10 (where CK is unfermented yellow water medium, and D10 is fermented yellow water medium by Saccharomyces cerevisiae Sc45-32. Black dots: correspond to 3 independent measurements of the CK group. Purple dots: correspond to 3 independent measurements of the D10 group).

[0030] Figure 11 The growth curve of strain D10 in yellow sap water is shown. Detailed Implementation

[0031] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. The following embodiments are merely illustrative and are not intended to limit the scope of the invention in any way.

[0032] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the experimental materials, reagents, and chemicals used in the following embodiments can be obtained through general channels.

[0033] Example 1

[0034] Isolation, purification and identification of strains

[0035] (1) Isolation and purification of the strain: Using 50 mL sterile centrifuge tubes, naturally fermented sour whey (yellow whey produced by pressing tofu, naturally fermented, taken from Laiwu, Jinan, Shandong) was collected and brought back to the laboratory at 4℃. It was immediately diluted with sterile water to a concentration of 10. -3 10 -4 10 -5 10 -6 10 -7 Dilute the acid solution to a concentration of 1:1 and spread it onto YPD agar plates, then incubate at 28°C for 48 h. Select suspected colonies based on their morphology and streak them onto a plate for isolation. Repeat this process 2-3 times until pure single colonies are obtained. Store the purified single colonies in glycerol tubes at -80°C for later use.

[0036] (2) Identification of strains

[0037] Morphological identification: The colony morphology of the isolated yeast D10 is as follows: Figure 1 As shown, yeast D10 colonies are round or irregular in shape, with a raised center, a height of about 0.5-2 mm, milky white, and a diameter of about 1-5 mm; the cell morphology is oval or spherical, which is clearly different from that of bacteria.

[0038] Molecular biological identification: The selected yeast strain D10 was activated to the logarithmic growth phase, RNA was extracted, and reverse transcribed into cDNA. Using cDNA as a template, its 26S rDNA sequence was amplified by PCR, and the obtained sequence is shown in SEQ ID NO:1. The 26S rDNA gene sequence was compared for homology using the NCBI BLAST database to obtain homologous strains of strain D10. A phylogenetic tree was constructed using strains with high homology to D10 to determine their species classification.

[0039] SEQ ID NO:1 (5'→3')

[0040] ACTGACCTGCGGAGGTCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAACATACAAGGGGGGGGGGAGAGAGAGAGAGGGGTTTT

[0041] The phylogenetic tree of Saccharomyces cerevisiae D10 is as Figure 2As shown, the BLAST database alignment results indicate that yeast D10 shares the highest homology with *Saccharomyces cerevisiae* strain HBUAS61417, with a sequence similarity of 99.75%. Based on morphological and physiological-biochemical characteristics, strain D10 was identified as *Saccharomyces cerevisiae*, named *Saccharomyces cerevisiae* Sc45-32. This strain was deposited on December 10, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 39082. The recommended classification name is *Saccharomyces cerevisiae*. The deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0042] Example 2

[0043] Identification of the ability of Saccharomyces cerevisiae Sc45-32 to hydrolyze soybean isoflavone glycosides

[0044] (1) Cellobiose plate method

[0045] YPD-cellobiose agar medium with cellobiose as the carbon source was prepared: Sugar-free YPD agar medium supplemented with 2% cellobiose as the carbon source was sterilized at 121℃ for 20 min. Saccharomyces cerevisiae Sc45-32 colonies were streaked onto the cellobiose medium for isolation and incubated at 37℃ for 24-48 h. The growth of Saccharomyces cerevisiae Sc45-32 on the cellobiose plates was observed. In cellobiose plates, cellobiose is the only carbon source, and β-glucosidase can hydrolyze cellobiose into glucose. Therefore, only strains that secrete β-glucosidase can grow on cellobiose plates. The fact that Saccharomyces cerevisiae Sc45-32 can grow on cellobiose plates indicates that Saccharomyces cerevisiae Sc45-32 can produce β-glucosidase.

[0046] Conclusion: Saccharomyces cerevisiae Sc45-32 can grow on cellobiose plates and has the ability to produce β-glucosidase.

[0047] (2) Screening by aescin colorimetric method

[0048] The activity of β-glucosidase produced by Saccharomyces cerevisiae strain Sc45-32 was further confirmed by the aescin colorimetric method.

[0049] Preparation of aescin chromogenic medium: YPD agar medium supplemented with 0.3% aescin and 0.05% ferric citrate, respectively. Saccharomyces cerevisiae Sc45-32 was subjected to chromogenic reaction on the aescin chromogenic medium using the toothpick puncture method. Results are as follows: Figure 3As shown, strains secreting β-glucosidase can hydrolyze aescin in the culture medium to produce glucose and esculin. The generated esculin reacts with the iron ions from ferric citrate added beforehand in the culture medium to form a dark brown or black ferrophenolic complex. The larger the black circle and the darker the color, the stronger the enzyme production capacity. Figure 3 As shown, the presence of a distinct black halo with a dark brown edge around the *Saccharomyces cerevisiae* Sc45-32 indicates its strong ability to produce β-glucosidase.

[0050] (3) β-glucosidase activity assay

[0051] Microbial fermentation broth: Saccharomyces cerevisiae Sc45-32 was ultrasonically disrupted (ice bath, power 20% or 200 W, sonication for 3 seconds, 10-second intervals, repeated 30 times), centrifuged at 2-8℃ for 20 minutes (5000 r / min), and the supernatant was collected for enzyme activity detection using a microbial β-glucosidase (β-glucoside) ELISA kit (Jiangsu Enzyme Immunosorbent Assay). The results showed that the β-glucosidase activity of Saccharomyces cerevisiae Sc45-32 was 44.32 ± 0.95 U / mL.

[0052] Example 3

[0053] Nutritional composition determination of yellow slurry after fermentation by brewer's yeast Sc45-32

[0054] (1) Preparation of soybean milk: Wash 500 g of dried soybeans and soak them in water overnight at room temperature. Then drain and rinse. Take 1000 g of wet soybeans and mix them with 5400 mL of water (the ratio of wet soybeans to water = 1:5.4 w / v) in a soybean milk grinder (model FSM-100, Shenyang Machinery Factory No. 3, China). Filter the resulting slurry through gauze to obtain soybean milk. Heat the soybean milk to 100℃ and maintain for 5 minutes. Take 700 mL of hot soybean milk (100℃) and put it into a stainless steel container, then cool it to 80±2℃. Slowly pour the acidic whey (fermentation) solution (purchased from Li Ji Long Qian Cheng Tofu Shop in Laiwu, Jinan, Shandong) into the steel container while stirring slowly and stopping the addition of acidic whey until the soybean milk coagulates. The volume of acidic whey used is about 185 mL.

[0055] (2) Preparation of yellow slurry culture medium: The fresh yellow slurry prepared in step (1) above is centrifuged at 4000 rpm for 10 min to remove insoluble matter. The supernatant is then sterilized at 121℃ for 15 min to obtain yellow slurry culture medium.

[0056] The appearance of the yellow pulp culture medium is as follows: Figure 4 As shown,

[0057] The moisture, fat, protein, and total sugar contents of three batches of yellow aqueous culture medium prepared by the above method were determined. Moisture content was determined according to GB 5009.3-2016, fat content according to GB 5009.6-2016, protein content according to GB 5009.5-2016, and total sugar content according to GB / T 15672-2009. The results are shown in Table 1.

[0058] Table 1. Nutritional composition analysis of yellow pulp water

[0059]

[0060] Note: Different lowercase letters represent significant differences, p<0.05.

[0061] As shown in Table 1, the yellow liquid exhibits a certain degree of batch stability. The yellow liquid contains a relatively high amount of water and a certain amount of carbon and nitrogen sources, which are essential nutrients for microbial growth. It possesses the basic conditions for microbial growth and can be used for microbial fermentation. The test results showed no significant differences, indicating good batch stability of the yellow liquid.

[0062] (3) Saccharomyces cerevisiae Sc45-32 fermentation medium for yellow slurry:

[0063] Take 200 μL of the Saccharomyces cerevisiae Sc45-32 strain stored at -80℃ and inoculate it into YPD medium. Activate it overnight at 28℃ and 150 r / min. Inoculate the activated bacterial solution into the yellow slurry water medium prepared above at an inoculation rate of 1% and ferment it at 28℃ and 150 r / min for 24 h.

[0064] (4) HPLC analysis of soybean isoflavone content in fermented yellow liquid

[0065] The fermented broth and the unfermented yellow slurry culture medium were mixed with 80% chromatographic grade methanol solution at a ratio of 1:1. The mixture was ultrasonically extracted for 1 h at an ultrasonic power of 200 W and 24 kHz. After mixing, the mixture was centrifuged at 11000 r / min for 20 min. The supernatant was filtered through a 0.22 μm organic filter membrane and injected into a 1.5 mL sample vial. The vial was stored at -20℃ for later use in HPLC analysis.

[0066] HPLC determination of soybean isoflavones: Chromatographic conditions:

[0067] Chromatographic column: C18 column; Detector: Waters 2695 UV detector; Mobile phase: A: 0.1% (v / v) aqueous acetic acid solution, B: 10.1% (v / v) acetic acid acetonitrile solution; Column temperature: 35℃; Detection wavelength: 260 nm; Injection volume: 10 μL; Analysis time: 60 min. Gradient elution conditions are shown in Table 2.

[0068] Table 2 Gradient elution program

[0069]

[0070] Establishment of standard curves: Weigh 1 mg each of daidzein, daidzein, genistein, genistein, daidzein, and daidzein standards, and dissolve them in chromatographic grade 70% DMSO to prepare 500 μg / mL standard stock solutions. Take appropriate amounts of each standard stock solution and prepare mixed standard solutions with concentrations of 50 μg / mL, 40 μg / mL, 30 μg / mL, 20 μg / mL, and 10 μg / mL using 70% DMSO. Analyze the mixed standard solutions of each concentration using HPLC, determine the peak area of ​​each component at different concentrations, and plot the standard curves for the six standards using linear regression with the standard concentration (x) of each component against the corresponding peak area (y).

[0071] Calculation of isoflavone content in fermented yellow liquid: The peak areas of each component in the fermented yellow liquid were measured by HPLC and substituted into the standard curves of each standard to obtain the concentration of each component in the sample. The contents of daidzin, gycitin, genistin, daidzein, gycitein, genistein, and the percentage of daidzein are calculated. The results are as follows: Figure 5 As shown, compared with the unfermented control group (CK), the total soybean isoflavone glycosides in the yellow slurry water after fermentation by *Saccharomyces cerevisiae* Sc45-32 decreased from 410.633±13.18 mg / mL to 51.2±0.58 mg / mL, while the total soybean isoflavone aglycones increased from 9.818±1.23 mg / mL to 163.784±4.75 mg / mL. This indicates that during fermentation, as the amount of soybean isoflavone glycosides decreased, the amount of aglycones gradually increased. Soybean isoflavone glycosides were gradually converted into aglycones during fermentation, and the proportion of soybean isoflavone aglycones also increased from 2.33% before fermentation to 76.29%. This demonstrates that *Saccharomyces cerevisiae* Sc45-32 has the ability to convert soybean isoflavone glycosides into soybean isoflavone aglycones.

[0072] Example 4

[0073] Assay of hydroxylase activity of Saccharomyces cerevisiae Sc45-32

[0074] Take 200 μL of Saccharomyces cerevisiae Sc45-32 stored at -80℃ and inoculate it into YPD liquid medium. First, activate the inoculated bacterial solution overnight at 28℃ and 150 r / min. Then, inoculate it into the yellow slurry water medium prepared by the above method at an inoculation rate of 1%, and place it in a shaker at 28℃ and 150 r / min for fermentation culture for 24 h.

[0075] The activities of tyrosinase (TyR), cytochrome P450 hydroxylase (CYPH), and flavin monooxygenase (FMO) were determined using the following methods:

[0076] ①CYP450 enzyme activity assay: The microbial fermentation broth was subjected to ultrasonic disruption of cells (ice bath, power 20% or 200 W, ultrasonic 3 s, 10 s interval, repeated 30 times), centrifuged at 2-8℃ for 20 minutes (5000 rpm), and the supernatant was collected and measured using a microbial cytochrome P450 hydroxylase (CYPH) ELISA kit (Jiangsu Enzyme Immunosorbent Assay).

[0077] ②Tyrosinase activity assay: The microbial fermentation broth was subjected to ultrasonic disruption of cells (ice bath, power 20% or 200W, ultrasonic for 3 seconds, interval 10 seconds, repeated 30 times), centrifuged at 2-8℃ for 20 minutes (5000 rpm), and the supernatant was collected and measured using a microbial tyrosinase (TyR) ELISA kit (Jiangsu Enzyme Immunosorbent Assay).

[0078] ③ Flavin monooxygenase (FMO) activity assay: The microbial fermentation broth was subjected to sonication to disrupt the cells (ice bath, power 20% or 200 W, sonication for 3 s, interval 10 s, repeated 30 times), centrifuged at 2-8℃ for 20 minutes (5000 rpm), and the supernatant was collected and measured using a microbial flavin monooxygenase (FMO) ELISA kit (Jiangsu Enzyme Immunosorbent Assay).

[0079] The enzyme activities of tyrosinase (TyR), cytochrome P450 hydroxylase (CYPH), and flavin monooxygenase (FMO) in Saccharomyces cerevisiae Sc45-32 were measured as follows: Figure 6 As shown, Saccharomyces cerevisiae Sc45-32 has high levels of tyrosinase (TyR), cytochrome P450 hydroxylase (CYPH), and flavin monooxygenase (FMO) activities.

[0080] Example 5

[0081] Application of Saccharomyces cerevisiae Sc45-32 in the production of 4',6,7-trihydroxyisoflavones from hydroxylated soybean isoflavone aglycones

[0082] 1. Non-targeted LC-MS / MS mass spectrometry analysis of soybean isoflavones in fermented yellow liquid

[0083] Take 200 μL of Saccharomyces cerevisiae Sc45-32 stored at -80℃ and inoculate it into YPD liquid medium. First, activate the inoculated bacterial solution overnight at 28℃ and 150 r / min. Then, inoculate it into the yellow slurry water medium prepared by the above method at an inoculation rate of 1%, and place it in a shaker at 28℃ and 150 r / min for fermentation culture for 24 h.

[0084] Take 400 μL of the fermented sample, centrifuge with 4',6,7-trihydroxyisoflavone at 4℃ for 10 min, collect the supernatant and analyze it. The results are as follows. Figure 7 As shown, (4',6,7-Trihydroxyisoflavone) was detected in the fermentation broth of Saccharomyces cerevisiae Sc45-32.

[0085] 2. Targeted LC-MS / MS mass spectrometry analysis of soybean isoflavones in fermented yellow liquid

[0086] Take 200 μL of Saccharomyces cerevisiae Sc45-32 stored at -80℃ and inoculate it into YPD liquid medium. First, activate the inoculated bacterial solution overnight at 28℃ and 150 r / min. Then, inoculate it into the yellow slurry water medium prepared by the above method at an inoculation rate of 1%, and place it in a shaker at 28℃ and 150 r / min for fermentation culture for 24 h.

[0087] After lyophilizing 20 mL of fermentation broth sample for 72 h and concentrating it, it was reconstituted with 10 mL of 80% methanol, extracted by sonication for 1 h, centrifuged at 11000 r / min for 20 min to remove the precipitate, and then added 20 mL of 80% chromatographic grade methanol, sonicated, and centrifuged at 11000 r / min for 20 min to remove the precipitate. The supernatant of the three parallel groups was collected, and the yellow liquid was used as a blank. The samples were stored at -20℃ for targeted LC-MS / MS analysis.

[0088] The extracted ion chromatogram of 4',6,7-trihydroxyisoflavone detected in targeted metabolic analysis is shown below. Figure 8 As shown, the content of soybean isoflavone aglycones in the fermented yellow liquid was measured as follows: Figure 9 As shown, the content of 4',6,7-trihydroxyisoflavones in the fermented yellow liquid is as follows: Figure 10 As shown;

[0089] Depend on Figures 8-10 It was found that 4',6,7-trihydroxyisoflavone was detected in the fermented yellow slurry of Saccharomyces cerevisiae Sc45-32. After fermentation of the yellow slurry with Saccharomyces cerevisiae Sc45-32 for 24 h, the content of total soybean isoflavone aglycones (Glycitein, Daidzein, Genistein) increased from 403.86±13.80 ng / mL in the unfermented yellow slurry to 11209.74±193.80 ng / mL; the content of 4',6,7-trihydroxyisoflavone increased from 6.61±0.20 ng / mL in the unfermented yellow slurry to 403.12±9.06 ng / mL.

[0090] 3. Growth curve of Saccharomyces cerevisiae Sc45-32

[0091] After second-generation passage of *Saccharomyces cerevisiae* Sc45-32 stored at -80℃, a 1% inoculum was added to yellow slurry medium. The mixture was incubated at 28-30℃ on a shaker at 150 r / min for 24 h. The OD values ​​after 24 h of fermentation were measured using a microbial growth curve analyzer. 600 The OD600 value is the absorbance at 600 nanometers, a standard indicator for measuring bacterial concentration in microbiological experiments. A higher value indicates greater turbidity and a higher concentration of bacteria in the bacterial solution. Measurements were taken every 2 hours, using uninoculated yellow liquid as a control. Results are as follows... Figure 11 As shown, the brewer's yeast Sc45-32 reaches the logarithmic growth phase in about 8 hours of fermentation and the plateau phase in about 18 hours. This can be used as the "gold standard" for judging whether the fermentation process is normal, and whether the batch of yellow slurry is stable and contaminated.

[0092] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. A Saccharomyces cerevisiae strain, characterized in that, The brewing yeast is Saccharomyces cerevisiae Sc45-32, with accession number CGMCC No.39082.

2. The use of the brewing yeast of claim 1 in hydroxylated soybean isoflavone aglycones.

3. The use of Saccharomyces cerevisiae according to claim 2 for the hydroxylation of soy isoflavone aglycone, characterized in that, Used to prepare 4',6,7-trihydroxyisoflavone.

4. The use of Saccharomyces cerevisiae according to claim 3 for the hydroxylation of soy isoflavone aglycone, characterized by, Fermentation was carried out using yellow slurry as the culture medium and Saccharomyces cerevisiae Sc45-32 with preservation number CGMCC No.39082.

5. The application of the brewer's yeast according to claim 4 in hydroxylated soybean isoflavone aglycones, characterized in that, The fermentation conditions are: fermentation culture for 18-48 hours at 28-30℃ and 150-200 r / min.

6. The use of Saccharomyces cerevisiae according to claim 4 in the hydroxylation of soy isoflavone aglycone, characterized by, The inoculum size of Saccharomyces cerevisiae Sc45-32 with accession number CGMCC No.39082 in the culture medium was 0.5-5%.

7. The use of Saccharomyces cerevisiae according to claim 4 in the hydroxylation of soy isoflavone aglycone, characterized by, The yellow liquid is soybean product yellow liquid.

8. The use of Saccharomyces cerevisiae according to claim 7 for the hydroxylation of soy isoflavone aglycone, characterized by, The yellow liquid from soybean products is a liquid byproduct produced during the production of soybean products from soybeans, after pressing or filtering.

9. The use of Saccharomyces cerevisiae according to claim 8 for the hydroxylation of soy isoflavone aglycone, characterized by, The soy products mentioned are tofu or dried bean curd sticks.

Images