Grass carp brain vascular smooth muscle cell line and application thereof

Abstract

The present application relates to the technical field of cytology, in particular to a grass carp brain vascular smooth muscle cell line and application, the preservation number of the cell line is CCTCC NO: C202607. The grass carp brain vascular smooth muscle cell line provided by the present application has the ability of efficiently proliferating GCRV-II. The titer of GCRV-II replicated in the cell line can be up to 6.32 x 10 9 TCID 50 / mL. The cytotoxicity of GCRV-II enriched by the cell line can cause grass carp to have typical hemorrhagic symptoms and death. The cell line is used for inactivated vaccine preparation experiment by using the enriched cytotoxicity, and multiple experiments prove that the relative protection rate of the inactivated vaccine is higher than 80%. Cryo-EM can observe a large number of intact virus particles in the concentrated cytotoxicity sample. Therefore, the present application lays an important foundation for in-depth research on GCRV-II pathogenic mechanism, vaccine preparation, virus structure analysis, antiviral drug screening and prevention and control of grass carp viral hemorrhagic disease.

Description

Technical Field

[0001] This invention relates to the field of cell biology, specifically to a grass carp brain vascular smooth muscle cell line and its applications. Background Technology

[0002] Grass carp (Ctenopharyngodon idella) is a leading freshwater aquaculture species in my country, consistently ranking first in production output and possessing significant economic value. However, outbreaks and epidemics of grass carp viral hemorrhagic disease often lead to severe economic losses in the aquaculture industry and hinder its sustainable development. The pathogen is grass carp reovirus (GCRV), whose pathogenic mechanism exhibits significant angiotropism. The virus primarily targets and damages the vascular system of the fish, particularly the cerebral vessels, directly causing characteristic hemorrhagic symptoms in multiple organs at the end of infection, resulting in extremely high mortality. Among the various GCRV genotypes, GCRV-II is currently the most widespread and pathogenic dominant strain. However, unlike GCRV-I and GCRV-III, GCRV-II is difficult to proliferate effectively in various existing cell models, including grass carp kidney cells (CIK, preservation number CCTCC NO: GDC0086), and does not induce significant cytopathic effects (CPE). The general insensitivity of existing models to the key pathogenic strain GCRV-II may stem from the fact that these cells are not the main natural target cells of the virus in vivo. This has become a core bottleneck in revealing its angiotropic pathogenic mechanism and developing efficient prevention and control technologies.

[0003] Generally, for a cell line to be susceptible to GCRV-II, infection should meet the following basic criteria: a significant cytopathic effect; qPCR showing a significantly higher viral load in the infected group than in the control group; and the virus can be detected by endpoint dilution (TCID). 50 Classical methods such as plaque assay (PFU) or plaque assay (PFU) are used to detect infectious viral titers in the infected group. It should be noted that there is a quantitative conversion relationship between the results of these two titer detection methods. In GCRV studies, the viral titer measured by the plaque assay (expressed as PFU / mL) is typically approximately equal to the titer measured by the endpoint dilution method (expressed as TCID). 50The concentration of GCRV (in mL) was 0.7 times that of other cells. Given that the core pathogenicity of GCRV lies in its specific invasion of the vascular system, constructing in vitro cell models derived from its key target tissue, the cerebral blood vessels, especially smooth muscle cell lines directly related to vascular function, is of irreplaceable value in revealing the angiotropism, replication mechanism, and pathogenic mechanism of GCRV-II in the most relevant cellular environment. Such cell lines can not only serve as ideal substrates for virus isolation and proliferation, solving technical challenges in vaccine production, but also provide a crucial platform for simulating the viral infection process at the cellular level and screening antiviral drugs. Therefore, establishing a grass carp cerebral vascular smooth muscle cell line that can be stably passaged, is highly sensitive to GCRV-II, and supports its efficient replication is an urgent need to overcome the current bottlenecks in basic research and prevention and control practices of grass carp hemorrhagic disease, and has significant scientific importance and application prospects. Summary of the Invention

[0004] To address the above problems, this invention provides a grass carp brain vascular smooth muscle cell line GCB5810, with the preservation number CCTCC NO:C202607.

[0005] Another object of the present invention is to provide the application of the above-mentioned cell lines.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] The applicant obtained the grass carp brain vascular smooth muscle cell line GCB5810 using the tissue block adherent culture method. This cell line was deposited at the China Center for Type Culture Collection on January 5, 2026, and is classified and named as: Grass carp brain vascular smooth muscle cell line (Ctenopharyngodon idellus) GCB5810, with accession number CCTCC NO:C202607, address: Wuhan University, Wuhan, China.

[0008] The method for culturing the grass carp cerebral vascular smooth muscle cell line GCB5810 involves culturing the grass carp vascular smooth muscle cell line in M199 medium; the M199 medium contains 10%~20% fetal bovine serum and 1% penicillin-streptomycin mixture.

[0009] The scope of protection of this invention also includes:

[0010] Application of grass carp brain vascular smooth muscle cell line GCB5810 in grass carp reovirus culture.

[0011] Application of grass carp brain vascular smooth muscle cell line GCB5810 in the isolation of grass carp reovirus.

[0012] Application of grass carp brain vascular smooth muscle cell line GCB5810 in the preparation of grass carp reovirus detection products.

[0013] Application of grass carp brain vascular smooth muscle cell line GCB5810 in preparing a drug screening model for the treatment or prevention of grass carp reovirus infection.

[0014] Application of grass carp brain vascular smooth muscle cell line GCB5810 in preparing a drug evaluation model for the treatment or prevention of grass carp reovirus infection.

[0015] Application of grass carp brain vascular smooth muscle cell line GCB5810 in the preparation of rapid diagnostic reagents for grass carp reovirus.

[0016] Application of grass carp brain vascular smooth muscle cell line GCB5810 in the preparation of reagents for epidemiological, viral genetic variation or evolution monitoring studies of GCRV-II.

[0017] Application of grass carp brain vascular smooth muscle cell line GCB5810 in the preparation of grass carp reovirus vaccine.

[0018] In the above-described applications, preferably, the grass carp reovirus is GCRV-II type.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] This invention utilizes a tissue block adherent culture method to obtain the grass carp brain vascular smooth muscle cell line GCB5810, with accession number CCTCC NO:C202607. This grass carp brain vascular smooth muscle cell line proliferates rapidly and grows stably; after 8 months of continuous passage culture, the cells have reached the 60th generation.

[0021] The grass carp vascular smooth muscle cell line provided by this invention possesses the ability to efficiently proliferate GCRV-II, and the highest GCRV-II viral titer replicated in this cell line can reach 6.32 × 10⁻⁶. 9 TCID 50 The concentration of GCRV-II virus in the concentrated cytotoxic cell line was higher than that of existing grass carp reovirus type II sensitive cells. Transmission electron microscopy and cryo-electron microscopy revealed numerous intact viral particles in the concentrated cytotoxic sample, which is significant for viral structural analysis. GCRV-II virus enriched in grass carp vascular smooth muscle cell lines still induced typical hemorrhagic symptoms and death in grass carp. Using these cells to enrich cytotoxic virus for inactivated vaccine trials, multiple experiments demonstrated that the relative protection rate of the inactivated vaccine consistently exceeded 80%, indicating the potential of this cell line for producing inactivated vaccine cytotoxic virus.

[0022] The grass carp cerebral vascular smooth muscle cell line constructed in this invention is suitable for in vitro culture of GCRV-II, providing a technical platform for the isolation, detection, culture and complete biological characteristics study of GCRV-II, and laying an important foundation for in-depth research on the pathogenic mechanism of GCRV-II, vaccine preparation, viral structure analysis, antiviral drug screening and prevention and control of grass carp viral hemorrhagic disease. Attached Figure Description

[0023] Figure 1 The image shows the isolation and culture of the grass carp brain vascular smooth muscle cell line GCB5810.

[0024] Wherein: A is the image of grass carp brain tissue cells migrating out on day 10 of primary culture; BF are the observation results of cell morphology and growth status of grass carp brain vascular smooth muscle cell line GCB5810 at generations 2, 5, 20, 40 and 60 respectively.

[0025] Figure 2 This study aims to detect the presence of latent GCRV-I, GCRV-II, and GCRV-III infections in the grass carp brain vascular smooth muscle cell line GCB5810.

[0026] Figure 3 Purity detection of the grass carp brain vascular smooth muscle cell line GCB5810;

[0027] Wherein: A is the unified prevalence approximation and projection diagram after single-cell sequencing of the grass carp brain vascular smooth muscle cell line GCB5810; B is the pie chart of the proportion of different cell types in the grass carp brain vascular smooth muscle cell line GCB5810; C is the immunoblotting results of Calbindin and α-smooth muscle actin proteins in the grass carp brain vascular smooth muscle cell line GCB5810; D is the immunofluorescence results of Calbindin, α-smooth muscle actin, and rabbit control IgG in the grass carp brain vascular smooth muscle cell line GCB5810.

[0028] Figure 4 Karyotype analysis and growth rate of grass carp brain vascular smooth muscle cell line GCB5810;

[0029] Wherein: A is the comparison result of 12S PCR product detection by agarose gel electrophoresis of grass carp brain vascular smooth muscle cell line GCB5810; B is the statistical result of chromosome number distribution of grass carp brain vascular smooth muscle cell line GCB5810; C is the cell growth curve of grass carp brain vascular smooth muscle cell line GCB5810 at the 50th generation.

[0030] Figure 5 To detect the infection status of GCRV-II in grass carp brain vascular smooth muscle cell line GCB5810;

[0031] Wherein: A is the immunofluorescence result of the viral protein VP4 after grass carp brain vascular smooth muscle cell line GCB5810 was infected with GCRV-II; B is the immunoblotting result of VP4 after grass carp brain vascular smooth muscle cell line GCB5810 was infected with GCRV-II.

[0032] Figure 6 The image shows the copy number and titer of GCRV-II replication in the grass carp brain vascular smooth muscle cell line GCB5810 under different infection multiples and different days.

[0033] Wherein: A is a bright-field micrograph of GCB5810 infected with different titers of GCRV-II at different days; B is a graph showing the viral copy number of cell suspensions after GCB5810 infection with 0.01 MOI and 0.1 MOI GCRV-II at different days; C is a graph showing the viral titer of cell suspensions after GCB5810 infection with 0.01 MOI and 0.1 MOI GCRV-II at different days.

[0034] Figure 7 Transmission electron microscopy detection of viral particles in grass carp brain vascular smooth muscle cell line GCB5810 cells after GCRV-II infection;

[0035] In the diagram: A shows a regularly shaped virus factory with a membrane structure within a white box; B is a magnified view of the area within the white box in A; C shows a regularly shaped virus factory without a membrane structure within a white box; D is a magnified view of the area within the white box in C; E shows an irregularly shaped virus factory without a membrane structure within a white box; and F is a magnified view of the area within the white box in E.

[0036] Figure 8 Images showing the purification and cryopreservation of GCRV-II virus particles in the grass carp cerebral vascular smooth muscle cell line;

[0037] In this image: A shows the results of GCRV-II concentration and purification in the grass carp brain vascular smooth muscle cell line GCB5810; B shows the results of cryo-screening of purified GCRV-II virus under low-dose transmission electron microscopy.

[0038] Figure 9 To establish a grass carp infection model based on GCRV-II venom derived from the proliferation of grass carp cerebral vascular smooth muscle cell line;

[0039] Wherein: A is a graph showing the clinical symptoms of grass carp infected with GCRV-II; B is a graph showing the survival curves of grass carp infected with GCRV-II at different titers of the grass carp cerebral vascular smooth muscle cell line proliferation.

[0040] Figure 10To detect the pathogenicity of GCRV-II infection in grass carp brain vascular smooth muscle cell line proliferation;

[0041] In the figures: A is the histopathological analysis result of grass carp infected with GCRV-II; B is the immunofluorescence analysis result of grass carp infected with GCRV-II; C is the transmission electron microscopy analysis result of the head kidney of grass carp infected with GCRV-II.

[0042] Figure 11 To evaluate the safety and immunoprotective efficacy of an inactivated vaccine prepared from GCRV-II, a grass carp cerebral vascular smooth muscle cell line;

[0043] Where: A is the survival curve of experimental fish in the efficacy experiment of GCRV-II inactivated vaccine; B is the clinical symptom results of grass carp infected with GCRV-II in the efficacy experiment of GCRV-II inactivated vaccine. Detailed Implementation

[0044] To facilitate understanding of the present invention, a more complete description will be given below with reference to embodiments, of which preferred embodiments are provided. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. These embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0045] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0046] The GCRV-II used in this invention is GCRV-YX246 strain (Kong, W., Ding, G., Zhang, Q. et al. Identification and characterization of a novel reovirus strain isolated from grass carp (Ctenopharyngodon idella). Virology journal, 22(1), 92.).

[0047] The beneficial effects of the present invention will be illustrated below through specific embodiments.

[0048] Example 1:

[0049] Construction and culture of grass carp brain vascular smooth muscle cell line GCB5810

[0050] This invention utilizes a tissue block adherent culture method to create a grass carp brain vascular smooth muscle cell line. The specific steps and passage culture method are as follows:

[0051] (1) Add 0.1% gelatin to a 12-well plate, 2 mL per well, and let stand for 30 min. Add 1×PBS containing 1% bispecific antibody to a 6-well plate, 3 mL per well; the gelatin was purchased from Beyotime, catalog number: c0316; the bispecific antibody was penicillin-streptomycin bispecific antibody, purchased from VivaCell, catalog number C3420-0100.

[0052] (2) Place the grass carp on ice, use sterile tweezers to pick up the fish and place it into a sterile 10 cm culture dish, add 70% alcohol by volume to disinfect the surface of the fish until the alcohol is submerged, and wash for 1-2 minutes.

[0053] (3) Remove the brain tissue block in the clean bench and quickly place it into a six-well plate containing 1% penicillin antibody and 1×PBS. Shake to submerge the tissue and perform the first round of sterilization for 5-10 min. Then transfer the tissue to a new six-well plate containing 1% penicillin antibody and 1×PBS for the second round of sterilization for 5-10 min. Repeat the above steps for the third round of sterilization.

[0054] (4) Aspirate the supernatant from the 12-well plate containing gelatin. Cut the tissue block into small pieces and place them evenly on the gelatin. Use a 10 μL pipette tip to aspirate the liquid around the tissue and let it stand near an alcohol lamp for 15 min.

[0055] (5) After the tissue has dried slightly, add 2 mL of DMEM / F12 medium containing 20% ​​fetal bovine serum and 2% penicillin antibiotics to each well. The fetal bovine serum was purchased from Gibco, catalog number A5669701.

[0056] (6) Slowly place the culture plate into a 28°C, 5% carbon dioxide incubator and let it stand. Do not move the culture plate within 3 days.

[0057] (7) Passage the cells that have spread into a monolayer. Add 2 mL of 1×PBS containing 1% antibiotics to the 6-well plate for washing. Add 1 mL of 0.25% trypsin for digestion. After the cells become round and fall off, add 2 mL of complete culture medium to stop digestion. Gently blow the cells apart and carry out expansion culture.

[0058] The cells were cultured in DMEM / F12 medium containing 20% ​​fetal bovine serum and 2% penicillin antibiotics for the first 20 generations. From the 21st generation onwards, the cells were cultured in M199 medium containing 10% fetal bovine serum and 1% penicillin antibiotics.

[0059] The results are as follows Figure 1 As shown, grass carp brain tissue migrated out of cells on day 10 of primary culture, such as... Figure 1 As shown in Figure A, cells aggregate around the tissue mass. The primary emigrating cells constitute a heterogeneous population containing multiple cell types. In the second generation... Figure 1 As shown in B, the 5th generation is as follows: Figure 1 As shown in C, in the 20th generation, as Figure 1 As shown in D, cell growth gradually becomes clearer and tends to stabilize. The 40th generation... Figure 1 E in the figure and the 60th generation as shown Figure 1 As shown in F, the cells exhibit uniform morphology and stable growth. Identification of this stably passaged cell line confirmed it to be grass carp cerebral vascular smooth muscle cells.

[0060] The aforementioned grass carp brain vascular smooth muscle cells were deposited at the China Center for Type Culture Collection on January 5, 2026, classified and named as grass carp brain cell line (Ctenopharyngodon idellus) GCB5810, with accession number CCTCCNO:C202607, located at Wuhan University, Wuhan, China.

[0061] Example 2:

[0062] Cryopreservation and resuscitation of grass carp brain vascular smooth muscle cell line GCB5810

[0063] Cell cryopreservation:

[0064] Grass carp brain vascular smooth muscle cell line GCB5810 in good growth condition was cryopreserved every 5 passages. First, the original culture medium in the culture flask was aspirated, and 3 mL of PBS solution containing 1% (v / v) penicillin-streptomycin-amphoteric B was slowly added along the flask wall to gently wash the cell layer. Then, the PBS was discarded, and 2 mL of 0.25% trypsin digestion solution was added. The flask was then placed in a cell culture incubator for 5 minutes for digestion.

[0065] Under an inverted microscope, observe until most cells become rounded and their edges show increased refractive index. Gently tap the side of the culture flask to induce cell detachment. Add an appropriate amount of serum-containing complete culture medium to stop digestion, and gently agitate the bottom of the flask with a pipette to fully disperse the cells into a single-cell suspension. Transfer the suspension to a sterile 15 mL centrifuge tube.

[0066] Place the centrifuge tubes in a centrifuge and centrifuge at 500 g for 5 min. Carefully discard the supernatant, add an appropriate amount of serum-free cell cryopreservation medium (brand: Xinsaimei, catalog number: C440050) to the cell pellet, and gently resuspend and mix with a pipette, taking care to avoid generating air bubbles.

[0067] Aliquot the cell suspension into cryovials, approximately 500 μL per tube. Clearly label the tubes with the cell name, passage number, and cryopreservation date. Then transfer the cryovials to a programmed cooling box or store them directly in an ultra-low temperature freezer at -80°C.

[0068] Cell resuscitation:

[0069] Quickly remove the target cell cryopreservation tubes from the -80℃ freezer and immediately place them in a water bath preheated to 28℃, shaking them continuously to thaw them rapidly.

[0070] Transfer the completely thawed cell suspension to a 15 mL centrifuge tube, add 10 mL of complete culture medium to resuspend, centrifuge at 500 g for 5 min, remove the supernatant, resuspend in fresh complete culture medium, and transfer to an airtight 25 cm centrifuge tube. 2 Incubate in a culture flask at 28°C.

[0071] Example 3:

[0072] Verification that the grass carp brain vascular smooth muscle cell line GCB5810 does not have latent GCRV-I, GCRV-II, or GCRV-III infection.

[0073] To confirm whether the established cell line carries latent infection of common grass carp reovirus (GCRV), viral nucleic acid detection was performed on the grass carp cerebral vascular smooth muscle cell line GCB5810. The specific steps are as follows:

[0074] (1) Take grass carp brain vascular smooth muscle cells in good growth condition, discard the culture medium, and gently wash once with PBS. Add an appropriate amount of trypsin digestion solution at a volume ratio of 0.25%, and place in a cell culture incubator to digest until the cells detach. Add complete culture medium to stop digestion, collect the cell suspension, and obtain the cell pellet after centrifugation for later use.

[0075] (2) Add 1 mL of Trizol reagent to the cell pellet and lyse thoroughly by shaking. Add 200 μL of pre-chilled chloroform, shake vigorously for 30 s, and incubate on ice for 10 min. Centrifuge at 13,000 g for 10 min at 4 °C, and carefully transfer the supernatant to a new RNase-free centrifuge tube. Add an equal volume of isopropanol, gently invert to mix, and incubate on ice for 10 min to precipitate RNA. Centrifuge again at 13,000 g for 15 min at 4 °C, and discard the supernatant. Wash the precipitate with 800 μL of 70% ethanol, centrifuge, discard the ethanol, and dry the precipitate at room temperature. Dissolve the RNA precipitate in an appropriate amount of RNase-free water. Take a small amount of RNA solution for agarose gel electrophoresis and ultra-micro UV spectrophotometry to assess the integrity and concentration of RNA. Subsequently, use the RevertAid FirstStrand cDNA Synthesis Kit to reverse transcribe 1 μg of total RNA into cDNA according to the instructions.

[0076] (3) Specific primers were designed for PCR amplification of the conserved regions of the S6 gene segment in the three main GCRV genotypes (type I, type II, and type III). The following controls were set up at the same time: a negative control using ddH2O as a template; a positive control using cDNA from known GCRV-I, GCRV-II, and GCRV-III positive samples as templates; and an internal control using β-actin as an internal reference to verify the quality of cDNA.

[0077] The PCR products were analyzed by 2% agarose gel electrophoresis. Figure 2 The results showed that the three viral genotype-specific PCRs of the grass carp brain vascular smooth muscle cell line GCB5810 did not produce the expected bands, while all positive controls showed specific amplified bands, and the internal control bands were clear. This indicates that under the test conditions, this cell line did not have latent infection with GCRV-I, GCRV-II, or GCRV-III.

[0078] Example 4:

[0079] Purity Detection of Grass Carp Brain Vascular Smooth Muscle Cell Line GCB5810

[0080] Grass carp brain vascular smooth muscle cells (GCB5810) in good growth condition were collected, digested with trypsin, and prepared into single-cell suspensions. Cell viability was ensured to be greater than 85% by trypan blue staining and counting. Subsequently, single-cell isolation, barcoding, reverse transcription, and cDNA amplification were performed strictly according to the manufacturer's standard procedures using a Chromium™ single-cell microarray (10× Genomics) and the accompanying Chromium® Single Cell 3' Library & Gel Bead Kit v3.1 to construct single-cell sequencing libraries. The constructed libraries were quantified and quality controlled using an Agilent 2100 Bioanalyzer system (high-sensitivity DNA microarray) and a Qubit™ high-sensitivity DNA assay kit (Thermo Fisher Scientific).

[0081] Libraries that passed quality control were sequenced at 150 bp (PE150) pairs on the Illumina NovaSeq X Plus platform. After the raw sequencing data were generated, a preliminary quality assessment was performed using the Cell Ranger analysis workflow (version 7.1.0).

[0082] The raw sequencing reads were aligned to the grass carp reference genome (RefSeq ID: GCF_018340385.1) using the STAR alignment algorithm. Subsequently, a digital gene expression matrix (based on UMI counts) was generated using Cell Ranger software. The matrix was filtered and normalized using the Seurat package (version 4.0.0): low-quality cells with fewer than 500 expressed genes, a total UMI count higher than 50,000, or a mitochondrial gene read ratio exceeding 10% were removed; and genes not expressed in any cells were also removed. Potential doublets were identified and removed using the R package DoubletFinder.

[0083] The selected high-quality single-cell data were integrated and subjected to dimensionality reduction analysis. First, principal component analysis (PCA) was performed using Seurat software, and a shared nearest neighbor (SNN) graph was constructed based on the first few principal components. Then, cells were clustered using a modular optimization-based clustering algorithm. For visualization, a nonlinear dimensionality reduction method (UMAP) was used to display the cell distribution on a two-dimensional plane. Finally, multiple cell subpopulations were obtained. By reviewing existing literature, classic cell type-specific marker genes reported in bony fishes and mammals were selected to provide biological annotations for each cell subpopulation, thereby assessing the relative proportion and purity of cerebral vascular smooth muscle cells in the target cell line.

[0084] Proteins were extracted from grass carp brain vascular smooth muscle cells for immunoblotting and immunofluorescence experiments to verify the expression of Calbindin and α-smooth muscle actin (ACTA2), classic marker proteins of brain vascular smooth muscle cells in GCB5810 cells. Rabbit anti-Calbindin antibody (dilution 1:5000), purchased from ABclonal (catalog number A4284), and rabbit anti-α-smooth muscle actin (ACTA2) antibody (dilution 1:5000), purchased from ABclonal (catalog number A7248), were used.

[0085] The results are as follows Figure 3 As shown in Figure A, most of the cells in GCB5810 are vascular smooth muscle cells; Figure 3 As shown in Figure B, GCB5810 cells are mainly composed of vascular smooth muscle cells, accounting for 97.55%; Figure 3 C and Figure 3 As shown in Figure D, the results of Western blotting and immunofluorescence experiments indicate that GCB5810 cells express vascular smooth muscle cell marker proteins Calbindin and ACTA2. This demonstrates that the grass carp brain vascular smooth muscle cell line GCB5810 provided by this invention has high purity and is mainly composed of vascular smooth muscle cells.

[0086] Example 5:

[0087] Validation of the origin of grass carp brain vascular smooth muscle cell line GCB5810:

[0088] Based on the publicly available grass carp mitochondrial genome sequence (GenBank: AY897013.1), a pair of primers specifically amplifying the 12S rRNA gene fragment were designed and synthesized: 12S rRNA-F: TTAGATACCCCACTATGCTC, and 12S rRNA-R: ACTAAATCCTCCTTCAAGCA. PCR amplification was performed using genomic DNA extracted from the grass carp cerebral vascular smooth muscle cell line GCB5810 as a template. The reaction system and cycling parameters were optimized according to standard conditions. Parallel reactions were also set up, using known grass carp tissue DNA as a positive control and ddH2O without DNA template as a negative control.

[0089] Take an appropriate amount of PCR product and perform electrophoresis on a 1.5% agarose gel, then stain with nucleic acid dyes. Observe and photograph the gel using a gel imaging system.

[0090] The target PCR product was gel-cleaved, purified, and sent to a sequencing company for bidirectional Sanger sequencing. The obtained sequencing sequences were then compared for homology in the NCBI database using the BLAST tool. Furthermore, multiple alignments were performed using molecular evolution software such as MEGA to compare the 12S sequence of the cell line with the standard 12S rRNA gene sequence of grass carp downloaded from NCBI.

[0091] like Figure 4 As shown in Figure A, the PCR product of cell line GCB5810 presents a single, clear band at the expected size position (approximately 380 bp), consistent with the positive control band, while the negative control shows no band, preliminarily confirming successful amplification and good specificity. The alignment of the 12S sequence of cell line GCB5810 with the grass carp reference sequence shows an identity of 99.16%, fully confirming that this cell line originates from grass carp and ruling out the possibility of cross-contamination.

[0092] Example 6:

[0093] Chromosomal karyotype analysis of grass carp brain vascular smooth muscle cell line GCB5810

[0094] Grass carp brain vascular smooth muscle cell line GCB5810 (generation 55) was selected for passage. After passage for 36 h, pre-prepared colchicine (purchased from Sangon Biotech Shanghai Co., Ltd., catalog number A600322-0100) was added to achieve a final concentration of 2 μg / mL, and the cells were returned to the cell culture incubator for another 12 h.

[0095] Digest cells with 0.25% trypsin (w / v) and centrifuge at 1,000 g for 5 min at 4°C. Resuspend cells in pre-chilled PBS and centrifuge at 1,000 g for 10 min at 4°C, then discard the supernatant.

[0096] Add 1 mL of pre-prepared hypotonic solution and 0.075 mol / L potassium chloride solution to the cell pellet, gently resuspend and mix, then place in a 37℃ water bath for hypotonic treatment for 30 min.

[0097] Prepare the fixative in advance: mix methanol and acetic acid in a 3:1 ratio and pre-cool at 4°C. Add 500 μL of fresh fixative to the hypotonic cells, pre-fix at room temperature for 5 min, then centrifuge at 1,000 g for 10 min at room temperature and remove the supernatant. Resuspend the hypotonic cells in 1 mL of fresh fixative, fix at room temperature for 10 min, then centrifuge at 1,000 g for 10 min at room temperature and remove the fixative. Repeat this step 3 times.

[0098] After the final centrifugation, leave approximately 150 μL of fixative and gently resuspend the cells. Lay several pre-cooled pathology-grade glass slides flat on the table. Using a pipette, draw 20 μL of the resuspended cell suspension and drop 2 drops onto each slide from a height of about 50 cm.

[0099] Leave the slide containing the cell suspension to air dry overnight. Cover with Giemsa stain (purchased from Beyotime, catalog number C0133-100) and stain for 30 minutes. Gently wash away excess stain with distilled water and let air dry.

[0100] After mounting with neutral resin, observe the cell chromosome division phase under a 100x oil immersion microscope in an upright position. Take clear pictures of at least 100 cells in metaphase, count the number of chromosomes, and analyze the chromosome composition.

[0101] The results are as follows Figure 4 As shown in B, the statistical results of chromosome number distribution in the 55th generation of grass carp brain cell line are shown. It can be seen from the figure that the mode of chromosomes in the 55th generation grass carp brain cell line GCB5810 is 48, which is the same as the previously reported number of grass carp chromosomes 2n=48, indicating that the grass carp brain vascular smooth muscle cell line GCB5810 constructed by Example 1 has not undergone mutation.

[0102] Example 7:

[0103] Determination of growth rate of grass carp brain vascular smooth muscle cell line GCB5810

[0104] Take healthy, 50th generation grass carp cerebral vascular smooth muscle cell line GCB5810 cells and administer at a ratio of 1×10⁻⁶. 5 pcs / cm 2 Inoculated at 25cm 2 For each time period, three replicates were performed using airtight cell culture flasks. 4 mL of culture medium was added to each flask, and the cells were placed in a cell culture incubator and cultured for 0 days.

[0105] Subsequently, three vials of cells were randomly selected daily, digested with trypsin at a concentration of 0.25% (w / v), and the resulting cell suspension was counted using a hemocytometer, with the unit being cells / cm³. 2 A total of 13 days were recorded, and then the cell growth curve was plotted with time points as the x-axis and cell number as the y-axis.

[0106] The results are as follows Figure 4 As shown in Figure C, the growth curve of the grass carp brain vascular smooth muscle cell line GCB5810 cells exhibits a typical "S" shape, consistent with the in vitro proliferation behavior of adherent cells.

[0107] Example 8:

[0108] Detection of viral proteins in grass carp brain vascular smooth muscle cell line GCB5810 cells after infection with GCRV-II

[0109] Immunofluorescence assay: Grass carp brain vascular smooth muscle cell line GCB5810 cells (50th generation, healthy growth) were used, and 5 × 10⁶ cells were injected into each well. 5 Cells were seeded into 12-well plates containing slides and cultured overnight. After incubation, the cells were infected with GCRV-II virus filtrate. An uninfected control was also included. Five days after infection, the cells were washed twice with PBS, then fixed with 4% paraformaldehyde at room temperature for 1 h. After washing three times with PBS, the cells were treated with PBS containing 0.2% Triton® X-100 for 15 min. After washing three times with PBS, the cells were blocked with PBS containing 5% BSA at 37°C for 1 h. After washing three times with PBS, the cells were incubated overnight with rabbit anti-GCRV-II VP4 antibody at a dilution of 1:500. After washing three times with PBS, the cells were incubated for 1 h with ReadyProbes™ AlexaFluor® 594 goat anti-rabbit IgG antibody at a dilution of 1:500. After washing three times with PBST, the cells were incubated with the blue fluorescent dye NucBlue™ Fixed Cell ReadyProbes. TM The sample, abbreviated as DAPI, was purchased from Invitrogen, catalog number R37606. It was used to mount and stain cell nuclei, and after the slides dried, they were photographed using a Leica fluorescence confocal microscope.

[0110] Take healthy grass carp brain vascular smooth muscle cell line GCB5810 cells, at a ratio of 5 × 10⁶ cells per flask. 6 Inoculated at 25cm 2 After overnight culture in airtight cell culture flasks, cells were gently washed once with PBS containing 1% penicillin antibody and then filled with homogenized fish tissue containing GCRV-II virus, along with 2 mL of serum-free MEM medium (Gibco, catalog number C11095500BT). The flasks were incubated at 28°C in a 5% CO2 incubator. One hour later, 2 mL of MEM medium containing 4% fetal bovine serum and 1% penicillin antibody was added to the culture flasks for continued culture. Cells were collected after 5 days of infection, and RIPA lysis buffer (Thermo Fisher Scientific) containing a protease inhibitor was added to lyse the cells. The supernatant was collected and then immunoblot was used to detect GCRV-II virus protein expression. The antibody used was rabbit anti-GCRV-II VP4 antibody, diluted 1:1000.

[0111] The results are as follows Figure 5As shown in Figure A, the immunofluorescence experiment results indicate that, 5 days after infection, a large number of GCRV-II viral protein VP4 were distributed in the cytoplasm of grass carp brain vascular smooth muscle cells in a punctate pattern; the immunoblotting experiment in Figure B shows that the expression of GCRV-II viral protein VP4 was detected in grass carp brain vascular smooth muscle cells 5 days after infection, indicating that GCRV-II can proliferate in the grass carp vascular smooth muscle cell line GCB5810.

[0112] Example 9:

[0113] Detection of GCRV-II infection in grass carp brain vascular smooth muscle cell line GCB5810

[0114] (1) Virus sample collection: Take grass carp brain vascular smooth muscle cell line GCB5810 cells in good growth condition, at a rate of 2×10⁶ cells per bottle. 6 Inoculated at 25cm 2 After overnight culture, airtight cell culture flasks were infected with GCRV-YX246 at 0.01 MOI and 0.1 MOI, with an uninfected control group. Cell suspension samples were collected at 1 dpi, 3 dpi, 5 dpi, 7 dpi, and 9 dpi after infection and stored at −80℃ for later use.

[0115] (2) Viral copy number determination: 200 μL of cell suspension samples at different time points after infection were added to 1 mL of Trizol to extract total viral RNA. cDNA was obtained by reverse transcription using Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR at a total RNA content of 100 ng. Specific TaqMan probe primers were designed based on the GCRV-YX246-S7 sequence (accession number PQ553632.1) in GenBank: GCRV-YX246-S7-F: CGACGACAAGATTGGGATACT, GCRV-YX246-S7-R: CTATGCCAGCCAAGAAATTTATACTG. GCRV-YX246-S7-Taq: 5'-FAM-TCTAA / ina-T / AGGATAGGCGC / ina-T / AAC-BHQ1-3'. Amplification was performed using 2× T5 Fast qPCR Mix (Probe). The reaction volume was 10 μL, consisting of 5 μL 2× T5 Mix, 0.2 μL each of forward and reverse primers, 0.4 μL probe, 1 μL cDNA, and 3.2 μL sterile water. Amplification conditions were: 95℃ pre-denaturation for 30 s; 40 cycles: 95℃ denaturation for 5 s, followed by annealing at 60℃ for 34 s. The GCRV-II virus copy number in the cell suspension was calculated using the standard curve.

[0116] (3) Virus titer determination (TCID) 50 Method): Inoculate each well with 9 × 10⁹ grass carp cerebral vascular smooth muscle cells in good condition. 4 Cells were cultured overnight in 48-well plates. GCRV-II virus solution was then serially diluted 10-fold in MEM medium. Each dilution was used in six replicates, with 50 μL per well. Adsorption was performed at room temperature for 1 h, during which the plate was gently shaken approximately 5 times. After adsorption, MEM medium containing 2% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P / S) was added to each well. Cells were cultured for 7–9 days, and the cytopathic effect (CPE) of each well was observed and recorded daily under an inverted microscope. Positive wells were identified by indirect immunofluorescence (IFA): cells were fixed, permeabilized, blocked with blocking solution, and incubated with VP4 monoclonal primary antibody. After washing to remove unbound primary antibody, cells were incubated with fluorescently labeled 488 secondary antibody, washed again, and stained with nuclear cells. Finally, positive wells were observed and identified using a laser confocal microscope. The GCRV-II virus titer was calculated using the Reed-Muench method based on the distribution of positive wells.

[0117] Jie Ru Figure 6 As shown, under different multiplicity of infection (MOI) conditions, the GCRV-YX246 strain can replicate and proliferate in the grass carp cerebral vascular smooth muscle cell line GCB5810. In section A, it is shown that after inoculating GCB5810 cells with GCRV-YX246 at 0.01 MOI, cytopathic effect (CPE) began to appear at 5 dpi, and the cell monolayer was almost completely destroyed by 9 dpi. After inoculating GCB5810 cells with GCRV-YX246 at 0.1 MOI, significant CPE appeared at 3 dpi, and the cell monolayer was basically dead by 7 dpi. In section B, it is shown that under the 0.01 MOI inoculation condition, the GCRV-II virus copy number in the GCB5810 cell sample gradually increased with the duration of infection, reaching a plateau at 9 dpi; under the 0.1 MOI inoculation condition, the virus copy number also increased with the duration of infection, reaching a plateau at 7 dpi. Figure C shows that, under the 0.01 MOI inoculation condition, the viral titer gradually increased with infection time, reaching an average titer of 10 at 9 dpi. 8.4 TCID 50 / mL; Under 0.1 MOI inoculation conditions, the viral titer also showed a time-dependent increasing trend, reaching an average titer of 10 at 9 dpi. 8.9 TCID 50 / mL, with a maximum titer of 6.32×10⁻⁶. 9 TCID 50 / mL. These results indicate that GCRV-II virus can effectively replicate and proliferate in grass carp cerebral vascular smooth muscle cell lines, exhibiting time-dependent changes. Furthermore, the VP4 monoclonal antibody can specifically recognize GCRV-II replicating in this cell line, and the viral titer can be determined using immunofluorescence analysis (IFA).

[0118] Example 10:

[0119] Transmission electron microscopy analysis

[0120] Transmission electron microscopy was performed on the grass carp brain vascular smooth muscle cell line GCB5810 infected with GCRV-II virus filtrate obtained after 5 blind passages to observe GCRV-II virus particles in the grass carp brain vascular smooth muscle cells. The specific steps are as follows:

[0121] Cell pellets were collected from virus-infected cells at different time points: Smooth muscle cells from the brain of grass carp in good growth condition were collected at a concentration of 2 × 10⁻⁶ cells per flask. 6 Inoculated at 25cm 2 After overnight culture in an airtight cell culture flask, the cells were infected with virus filtrate that had been blindly passaged for 5 generations. Once the cells showed cytopathic effects, the cell pellet was collected after 6 days of infection.

[0122] Transmission electron microscopy analysis: Cell pellets infected for 6 days were resuspended in an appropriate amount of 2.5% glutaraldehyde fixative and fixed overnight at 4°C. The samples were then sent to the Analysis and Testing Center of the Institute of Hydrobiology, Chinese Academy of Sciences for processing and observation and analysis under a transmission electron microscope.

[0123] The results are as follows Figure 7 As shown, Figure 7 According to AF, when grass carp brain vascular smooth muscle cells GCB5810 were infected with GCRV-II virus filtrate, a large number of virus factories appeared on day 6. There were a large number of GCRV-II virus particles in the cells, and virus factories were formed. Figure 7 B, D, and F in the middle are respectively Figure 7 Enlarged images of the white-boxed areas A, C, and E in the image. These observations demonstrate that GCRV-II can effectively proliferate in the grass carp brain vascular smooth muscle cell line GCB5810.

[0124] Example 11:

[0125] Concentration, purification, and cryopreservation of GCRV-II virus in grass carp cerebral vascular smooth muscle cell line GCB5810.

[0126] (1) Virus collection: GCB5810 cells, a grass carp cerebral vascular smooth muscle cell line in good growth condition, were collected and inoculated at a rate of 6 × 10⁶ cells per bottle. 6Cells were cultured overnight in 75 cm² airtight culture flasks and then infected with blind-passed second-generation GCRV-II virus filtrate. Cell suspension samples were collected at 7 dpi and stored at −80°C.

[0127] (2) Virus concentration and purification: The virus suspension was subjected to two freeze-thaw cycles at −80℃ / room temperature, and centrifuged at 4℃ for 10 min at 4,000 g to remove cell debris. The supernatant was filtered through a 0.45 μm membrane. The clarified filtrate was separated into layers on a 20% sucrose pad, centrifuged at 28,000 rpm and 4℃ for 2 h on an SW28 rotor, and the precipitate was collected and gently resuspended in PBS buffer. After resuspending, the virus was separated into layers on a discontinuous sucrose density gradient (20%, 30%, 40%, 50%, 70% w / v), and centrifuged at 31,000 rpm and 4℃ for 3 h on an SW41Ti rotor. After collecting the virus bands, the buffer was changed and desalted by centrifugation at 37,000 rpm and 4℃ for 2 h on the same rotor. The precipitate was resuspended in storage buffer and stored at −80℃.

[0128] (3) Sample preparation by freezing: The viral sample concentration was adjusted to 12 mg / mL and clarified in a low-salt buffer. A copper grid (300–400 mesh) was plasma-cleaned for 30–60 s. 3–5 μL of sample was dropped onto the grid, and excess liquid was scraped off with filter paper to form a thin liquid film. The film was then immediately immersed in liquid nitrogen-cooled liquid ethane for rapid freezing and stored in liquid nitrogen. Low-dose transmission electron microscopy was used for preliminary screening of the grid to evaluate film uniformity, ice crystal formation, and viral particle distribution. Based on the results, the sample concentration, loading volume, and thinning conditions were optimized.

[0129] like Figure 8 As shown in Figure A, a sufficient number of complete single GCRV-II virus particles were obtained through sucrose concentration and discontinuous sucrose gradient centrifugation; Figure B shows that low-dose transmission electron microscopy screening confirmed that the virus particles on the grid were complete and uniformly distributed, and could be used for subsequent three-dimensional structure analysis.

[0130] Example 12: Establishment of a grass carp infection model using GCRV-II derived from the grass carp cerebral vascular smooth muscle cell line GCB5810.

[0131] Healthy grass carp weighing 10-15 g were randomly divided into four groups of 30 fish each. The control group was injected intraperitoneally with 200 μL PBS. The experimental groups 1-3 were injected intraperitoneally with blind-transmitted second-generation GCRV-II (GCRV-XT256) virus filtrate (200 μL / fish), with a virus titer of 5.46 × 10⁻⁶. 6 5.46×10 5 5.46×10 4 TCID 50 / mL. Observe and record the fish's condition and survival status daily.

[0132] The results are as follows Figure 9 As shown in Figure A, the grass carp in the experimental group exhibited typical symptoms of grass carp hemorrhagic disease, including hemorrhage in the eye socket, gill cover, oral cavity, lower jaw, and fin base; necropsy revealed muscle hemorrhage; as shown in Figure A. Figure 9 As shown in B, no deaths occurred in the control group (0%); in experimental group 1, mortality began on day 3, reaching 100% within 5 days; in experimental group 2, mortality began on day 3 and ceased on day 7, with a mortality rate of 83.3%; in experimental group 3, mortality began on day 6 and ceased on day 8, with a mortality rate of 13.3%. The results indicate that GCRV-II proliferating in the cell line at titers ≥5.46 × 10⁻⁶ is effective. 5 TCID 50 It remains highly infectious even at a concentration of / mL.

[0133] Example 13:

[0134] Pathogenicity of GCRV-II infection in the proliferation of grass carp brain vascular smooth muscle cell line GCB5810

[0135] To verify the success of GCRV-II infection in grass carp in the infection model established in Example 12, histopathological analysis, immunofluorescence staining, and transmission electron microscopy were performed on the infected fish. The specific steps are as follows:

[0136] (1) Histopathological analysis: During the experimental challenge, the brain, gills, intestines, head kidneys, and spleen tissues of dying grass carp infected with the GCRV-II strain replicated in the grass carp brain vascular smooth muscle cell line GCB5810 were fixed in 4% formaldehyde for histopathological and immunohistochemical analysis. After fixation, the samples were embedded in paraffin and tissue sections were prepared using conventional histological methods. After staining with hematoxylin and eosin (HE), the sections were observed under an optical microscope. The results showed that the brain tissue of the diseased fish had obvious pathological changes, including cytoplasmic vacuolation, nuclear atrophy, and neuronal degeneration; gill tissue lesions showed epithelial cell proliferation and fusion of gill lamellae, and dilation and congestion of gill filament vessels; the main pathological changes in the intestinal tissue were swelling and partial shedding of intestinal villi, inflammatory cell infiltration of the lamina propria, and congestion of the submucosa; the head kidney tissue had disordered structure, focal cell necrosis, and nuclear dissolution; a large amount of pigmentation was observed in the spleen tissue, the spleen parenchyma was loose, and the number of lymphocytes was reduced ( Figure 10 (A)

[0137] (2) Immunofluorescence staining: GCRV-II VP4 monoclonal antibody (CN120329426B) stored in our laboratory was used to detect virus-specific antigens in tissue sections. After blocking, the sections were incubated with VP4 primary antibody, followed by incubation with fluorescently labeled secondary antibody (CY3). Cell nuclei were labeled with DAPI (UV excitation wavelength 330–380 nm, emission wavelength 420 nm, blue fluorescence; CY3 excitation wavelength 510–560 nm, emission wavelength 590 nm, red fluorescence). Observation and image acquisition were performed using a fluorescence microscope. The results showed that GCRV-II was widely present in all tested organs of infected fish, while almost no virus was detected in any organs of the control group fish. Figure 10 (B)

[0138] (3) Transmission electron microscopy analysis

[0139] Infected fish head kidney tissue was fixed overnight in electron microscopy fixative and rinsed with 0.1 M phosphate buffer (pH 7.4). The tissue was then transferred to 0.1 M phosphate buffer containing 1% osmium tetroxide (OsO4) for fixation at room temperature for 2 h, followed by rinsing three times with 0.1 M phosphate buffer. The tissue was dehydrated with a gradient of 50%, 60%, 70%, 80%, 90%, 95%, and 100% ethanol, and then further dehydrated with acetone before being placed in embedding molds and polymerized at 60°C for 48 h. The resin-embedded blocks were cut into ultrathin sections and transferred to a copper mesh, stained with 2% uranium acetate and 2.6% lead citrate, and finally observed under a transmission electron microscope (TEM, HT-7700, Tokyo, Japan). The results showed a large number of typical GCRV-II virus particles in the infected fish head kidney tissue, demonstrating that the virus effectively replicated within the tissue and formed complete particles. Figure 10 (C)

[0140] Example 14:

[0141] Safety and immunoprotective efficacy evaluation of inactivated vaccines prepared using GCRV-II derived from the grass carp cerebral vascular smooth muscle cell line GCB5810.

[0142] (1) Preparation and testing of antigens for vaccine production

[0143] GCRV-YX246 was inoculated into approximately 90% confluence grass carp cerebral vascular smooth muscle cell line GCB5810 at a rate of 0.3 mL / T75, for a total of 20 flasks. The inoculated cells were cultured at 28°C, and cytopathic effect (CPE) was observed daily. When approximately 80%–90% of the cells showed typical CPE, all inoculated cells were scraped off with a cell scraper, mixed thoroughly, and transferred to a sterile container as part of the same batch of virus solution. A portion of the sample was used for quality testing, and the remaining sample was stored at -80°C for later use. A portion of the harvested virus solution was subjected to a single freeze-thaw cycle, and the virus titer was determined; the virus content in 0.2 mL of virus solution should not be less than 10. 6.0 TCID 50 For GCRV-II that passed the titer test, 10% formaldehyde solution was added to bring the final formaldehyde volume fraction in the system to 0.2%. The mixture was thoroughly stirred and then inactivated at 28°C for 48 h. After inactivation, the inactivated virus solution was tested for complete inactivation and sterility. The results showed that the virus content before inactivation was 10... 6.0 TCID 50 / 0.2 mL, after inactivation, the samples all met the requirements for inactivation and sterility.

[0144] (2) Preparation of nano-aluminum gel adjuvant vaccines

[0145] The virus solution, which has passed the inactivation test, was mixed with nano-aluminum gel adjuvant at a volume ratio of 4:1 and stirred at 100–500 rpm / min for at least 90 min to obtain a homogeneous and stable vaccine formulation. After preparation, the vaccine was aseptically aliquoted, labeled with the batch number and preparation date, and stored at 2–8℃ for later use. The nano-aluminum gel adjuvant was purchased from Zhengzhou Aidejia Biotechnology Co., Ltd., catalog number 2025034.

[0146] (3) Safety evaluation of inactivated vaccines

[0147] Healthy grass carp weighing 10–20 g were selected and inactivated vaccines were administered via intraperitoneal injection. Each fish received 0.4 mL of the vaccine, with 50 fish in each batch used as the experimental group. The fish were observed for 14 days post-inoculation, and their mental state, feeding behavior, and any abnormal clinical reactions were recorded. Tissue reactions at the injection site and vaccine absorption were observed and recorded 30 days post-inoculation. The results are shown in the table below.

[0148] .

[0149] (4) Evaluation of the efficacy of inactivated vaccines

[0150] One hundred healthy grass carp weighing 10-20 g were selected. Fifty of these fish were injected intraperitoneally with an inactivated vaccine, with each fish receiving 0.2 mL. The remaining 50 fish served as a blank control group, receiving no immunization. Twenty-eight days after immunization, the grass carp in each experimental group were injected intraperitoneally with 10... 6.0 TCID 50 200 µL of 0.2 mL GCRV-XT256 strain venom was administered. After challenge, the animals were observed continuously for 14 days, with detailed records kept of their mental state, diet, clinical manifestations, and morbidity / mortality. Autopsies were performed on deceased individuals promptly, and pathological changes were recorded.

[0151] The results showed that 44 out of 50 grass carp in the blank control group died; the experimental group with the inactivated vaccine containing nano-aluminum adjuvant achieved a protection rate of over 80% against challenge with GCRV-XT256 strain. Figure 11 (See Table A below). In the blank control group, dead grass carp exhibited punctate hemorrhages in areas such as the eye sockets, gill covers, oral cavity, lower jaw, and fin bases; necropsy revealed obvious pathological features of "red muscle and red intestines." In the vaccine group, the hemorrhage symptoms were significantly reduced. Figure 11 (B)

[0152] .

[0153] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0154] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. An isolated grass carp brain vascular smooth muscle cell line GCB5810, the cell line having the accession number CCTCC NO:C202607.

2. The application of the grass carp brain vascular smooth muscle cell line GCB5810 as described in claim 1 in the culture of grass carp reovirus.

3. The application of the grass carp brain vascular smooth muscle cell line GCB5810 as described in claim 1 in the isolation of grass carp reovirus.

4. The application of the grass carp cerebral vascular smooth muscle cell line GCB5810 as described in claim 1 in the preparation of a drug screening model for the treatment or prevention of grass carp reovirus infection.

5. The application of the grass carp cerebral vascular smooth muscle cell line GCB5810 as described in claim 1 in the preparation of a drug evaluation model for the treatment or prevention of grass carp reovirus infection.

6. The application of the grass carp cerebral vascular smooth muscle cell line GCB5810 as described in claim 1 in the preparation of reagents for the epidemiological, viral genetic variation or evolution monitoring of GCRV-II grass carp reovirus.

7. The use of the grass carp brain vascular smooth muscle cell line GCB5810 as described in claim 1 in the preparation of grass carp reovirus vaccine.

8. In any application according to claims 2-5 or claim 7, the grass carp reovirus is GCRV-II type.

Images