Core amino acid sequence for driving any recombinant protein to be self-assembled into supramolecular hydrogel and application of core amino acid sequence

Abstract

The invention discloses a core amino acid sequence for driving any recombinant protein to be self-assembled into supramolecular hydrogel and application of the core amino acid sequence, and aims to solve the problems of complex synthesis, toxic residue, insufficient biocompatibility, difficulty in performance regulation and control and the like of the traditional chemical crosslinking hydrogel. The whole length of Ure2 (1-19) to Ure2 (1-71) and any truncated body and mutant are covered, and the shortest sequence Ure2 (1-19) has efficient driving self-assembly. The core amino acid sequence is fused to any recombinant protein, the obtained fusion protein can form nanofiber-shaped self-assembly aggregation when the concentration is lower than 1 mg / mL, and can form supramolecular hydrogel with the characteristics of shear thinning effect, injectability and the like when the concentration is greater than or equal to 1 mg / mL, and the formation of the hydrogel does not need any additional artificial interference. The preparation can be finished only by standing for a period of time.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and in particular relates to a core amino acid sequence that drives the self-assembly of any recombinant protein into a hydrogel and its application. Background Technology

[0002] Hydrogels, as three-dimensional cross-linked network materials, have attracted widespread attention in recent years in fields such as biomedicine, tissue engineering, drug delivery, and daily chemicals due to their high water content, biocompatibility, and flexibility. Traditional hydrogels are typically formed through chemical or physical cross-linking, resulting in complex synthesis processes. Furthermore, the cross-linking agents or byproducts may be toxic to organisms, limiting their application in biomedicine and cosmetics. Existing chemical cross-linking methods connect monomers into a network structure through chemical reactions, forming stable hydrogels. Although this method can prepare hydrogels with high mechanical strength, its synthesis usually requires the use of chemical cross-linking agents (such as glutaraldehyde, polyethylene glycol, and epoxides), which may remain in the product and pose potential toxicity to cells and tissues. In addition, these chemically cross-linked hydrogels are not only cumbersome to synthesize and require strict conditions, but they may also generate toxic byproducts during synthesis, and their safety to humans and cells has not been fully assessed, hindering large-scale applications. This limits their further application in biomedicine, tissue engineering, and other fields. Summary of the Invention

[0003] Currently, self-assembling recombinant protein materials mainly rely on chemical synthesis of short peptides with self-assembly functions, which is expensive and difficult to apply on a large scale. To solve the above technical problems, this invention discloses a core amino acid sequence that can drive the self-assembly of any recombinant protein to form a supramolecular hydrogel material and its applications. This core amino acid sequence can rapidly drive any recombinant protein to self-assemble into a supramolecular hydrogel at a concentration of ≥0.1%. The core amino acid sequence disclosed in this invention can serve as an important carrier in tissue engineering, biomedicine, drug delivery, and daily chemical industries. Using this sequence as a self-assembly driving module, coupled with human-like elastin, a novel supramolecular elastin with a smaller molecular weight can be constructed. This novel supramolecular elastin can rapidly form a supramolecular colloid with underwater adhesion properties, shear-thinning effect, injectability, uniform porosity, and at a concentration of 0.1% (w / v) in any aqueous solution (after standing for more than 10 min). It also has extremely strong cell adhesion properties. Applying the above hydrogel to any object surface can make that surface a cell adhesion material, promoting cell adhesion and proliferation. At the same time, its excellent healing effect significantly improves tissue repair. The novel cell adhesion material disclosed in this invention can serve as an important carrier in fields such as tissue engineering, biomedicine, drug delivery, and daily chemicals.

[0004] The first objective of this invention is to provide a method for preparing supramolecular hydrogels, comprising the following steps:

[0005] Recombinant proteins are obtained by fusing any protein with the amyloid short peptide Ure2(1-71) or its mutant, and then one or more recombinant proteins are placed in an aqueous solution for self-assembly.

[0006] The amino acid sequence of the amyloid short peptide Ure2(1-71) is shown in SEQ ID NO.1.

[0007] Furthermore, the amyloid short peptide mutant is any one of the following:

[0008] (1) Amyloid short peptides are truncated from the C-terminus to any one of the 1st to 52nd amino acids;

[0009] (2) Starting from the C-terminus, the amyloid short peptide replaces any one of the 1st to 52nd amino acids.

[0010] Furthermore, by fusing self-assembling short peptides to the N-terminus or C-terminus of any recombinant protein through genetic engineering, the recombinant protein can self-assemble into supramolecular materials such as nanofibers and hydrogels. Moreover, recombinant proteins fused with the core amino acid sequence will form nanofiber-like self-assembled aggregates at working concentrations below 1 mg / mL. The working environment can be any aqueous solution, including pure water and various buffer solutions, and the ambient temperature is unrestricted, allowing for assembly at 0ºC to room temperature. The self-assembly time decreases with increasing fusion protein concentration. At low concentrations (less than 1 mg / ml), it takes approximately 2 days to complete all self-assembly; at higher concentrations (greater than or equal to 1 mg / ml), it takes approximately 10 minutes or more to complete all self-assembly, at which point a supramolecular hydrogel has formed.

[0011] Furthermore, recombinant proteins fused with the core amino acid sequence will form supramolecular hydrogels with shear-thinning effects and injectability when the working concentration is greater than or equal to 1 mg / mL. The formation of this hydrogel does not require any additional artificial interference, such as pH adjustment or the addition of chemical cross-linking agents. The working environment can be any aqueous solution, including pure water and various buffer solutions, and the ambient temperature is not limited, and it can be carried out at 0ºC to room temperature. The formation of hydrogels can be achieved simply by letting the aqueous solution stand for more than 10 minutes.

[0012] Furthermore, different recombinant proteins incorporating the core amino acid sequence can be mixed in any proportion at a working concentration greater than or equal to 1 mg / mL to form a supramolecular composite hydrogel with shear-thinning effect and injectability. The formation of this composite hydrogel does not require any additional artificial interference, such as pH adjustment or the addition of chemical cross-linking agents. The working environment can be any aqueous solution, including pure water and various buffer solutions, and the ambient temperature is not limited, and it can be carried out at 0ºC to room temperature. The formation of the hydrogel can be achieved simply by letting the aqueous solution stand for more than 10 minutes.

[0013] Furthermore, using the aforementioned core amino acid sequence as a self-assembly driving module, it is coupled to the N-terminus of the recombinant elastin to obtain a novel supramolecular elastin with a smaller molecular weight.

[0014] Furthermore, the recombinant elastin is formed by fusing a first sequence, a second sequence, and a third sequence, wherein the amino acid sequence of the first sequence is shown in SEQ ID NO.5, the amino acid sequence of the second sequence is shown in SEQ ID NO.6, and the amino acid sequence of the third sequence is RGD.

[0015] The recombinant elastin is composed of three fused parts: the partial sequence GB1 of the lactic acid bacteria-derived immunoglobulin and the partial sequence R16 of the insect elastin provide mechanical strength, and the human cell adhesion peptide RGD provides the cell adhesion site. The final artificial elastin sequence is GB1-R16-RGD.

[0016] Furthermore, the first sequence and the second sequence form a repeating unit, and the number of repeating units is 1-4.

[0017] The second objective of this invention is to provide a supramolecular hydrogel prepared by the above-described preparation method.

[0018] A third objective of this invention is to provide applications of the aforementioned supramolecular hydrogels in the biological or medical fields, namely, the preparation of cosmetic products, the preparation of medical device products, the preparation of injectable gels, tissue engineering, drug delivery, or enzyme immobilization.

[0019] The fourth objective of this invention is to provide a core amino acid sequence that can drive the self-assembly of any recombinant protein to form a supramolecular hydrogel material. The core amino acid sequence is the amyloid peptide Ure2(1-71) or a mutant thereof. The amino acid sequence of the amyloid peptide Ure2(1-71) is shown in SEQ ID NO.1, and the mutant is any one of the following:

[0020] (1) Amyloid short peptides are truncated from the C-terminus to any one of the 1st to 52nd amino acids;

[0021] (2) Starting from the C-terminus, the amyloid short peptide replaces any one of the 1st to 52nd amino acids.

[0022] A fifth objective of the present invention is to provide a cell adhesion material comprising the aforementioned supramolecular hydrogel.

[0023] The supramolecular elastin expressed by genetically engineered bacteria can rapidly form a supramolecular colloid with underwater adhesion properties, shear-thinning effect, injectability, uniform porosity, and other characteristics in any aqueous solution (after standing for more than 10 minutes). It also has extremely strong cell adhesion properties. Applying the above supramolecular hydrogel to any object surface can make that surface a cell adhesion material, which can promote cell adhesion, proliferation, differentiation, and three-dimensional cell culture, and at the same time promote skin tissue regeneration.

[0024] Furthermore, the supramolecular elastin expressed by genetically engineered bacteria, after purification and freeze-drying, yields a protein powder that, without any physical or chemical treatment, can rapidly form a supramolecular colloid with underwater adhesion properties in any aqueous solution, including pure water, at a concentration of not less than 0.1% (w / v).

[0025] Furthermore, the supramolecular elastin expressed by genetically engineered bacteria exhibits batch stability, and the resulting supramolecular hydrogel has uniform pores that allow solution permeability. It can not only be used as a cell adhesion coating material to be applied to any object surface for two-dimensional cell adhesion, proliferation, and differentiation, but also can be mixed with cells for three-dimensional cell culture, making it an excellent tissue engineering scaffold material.

[0026] Furthermore, the resulting supramolecular hydrogel, when applied to damaged skin, can promote wound healing and stimulate the regeneration of blood vessels and collagen in the skin tissue, while also having an anti-inflammatory effect.

[0027] Furthermore, supramolecular colloids remain attached to the surface of objects after being immersed in any organic solvent, without significant changes in morphology, demonstrating resistance to organic solvents.

[0028] A sixth objective of this invention is to provide the application of the above-mentioned cell adhesion material in tissue engineering.

[0029] The beneficial effects of this invention are:

[0030] (1) This invention screens a core amino acid sequence, Ure2(1-71), and its mutants that drive the self-assembly of recombinant proteins into hydrogels. This short peptide sequence or its mutants are fused to any recombinant protein using a fusion method. The resulting fusion protein forms supramolecular hydrogels or nanofibers with characteristics such as shear-thinning effect and injectability. The formation of this hydrogel does not require additional artificial chemical synthesis of the self-assembling short peptide, reducing the production cost of supramolecular nanomaterials. Furthermore, it requires no additional artificial interference, such as pH adjustment or the addition of chemical cross-linking agents; gelation is completed simply by allowing it to stand. The recombinant protein self-assembly mechanism developed in this invention has broad applications in cosmetic products, medical devices, injectable gels, tissue engineering, drug delivery, and enzyme immobilization.

[0031] (2) The present invention uses the above-mentioned self-assembly core sequence as a self-assembly driving module and couples it with the N-terminus of artificial elastin. It uses a novel supramolecular elastin with a smaller molecular weight produced by genetically engineered bacteria, which is obtained by fermentation, purification and freeze-drying. The obtained protein powder does not require any physical or chemical treatment and can quickly form a supramolecular colloid with underwater adhesion properties, shear thinning effect, injectability and uniform porous structure in any aqueous solution (after standing for more than 10 minutes).

[0032] (3) The supramolecular colloid prepared by the present invention has extremely strong cell adhesion properties and batch stability. The resulting supramolecular hydrogel has uniform pores and the solution can pass through it. Applying the above supramolecular hydrogel to any object surface can make the surface a cell adhesion material, which can promote two-dimensional cell adhesion, proliferation, differentiation and three-dimensional cell culture. At the same time, it can promote the regeneration of skin tissue (such as blood vessels and collagen), and is an excellent tissue engineering scaffold material.

[0033] (4) The supramolecular colloid after application remains attached to the surface of the object after being soaked in any organic solvent, with no significant change in morphology, and has organic solvent resistance. The novel cell adhesion material disclosed in this invention can be used as an important carrier in the fields of tissue engineering, biomedicine, drug delivery, and daily chemicals. Attached Figure Description

[0034] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein:

[0035] Figure 1 The above are the SDS-PAGE electrophoresis results of the functional hydrogel material in Example 4 of this invention;

[0036] Figure 2 The above are the SDS-PAGE electrophoresis results of the functional hydrogel material in Example 4 of this invention;

[0037] Figure 3 The above are the SDS-PAGE electrophoresis results of the fluorescent hydrogel material in Example 4 of this invention;

[0038] Figure 4 This illustrates the aggregation of Ure2(1-71)-eGFP at a concentration of 0.5 mg / mL in Example 5 of this invention.

[0039] Figure 5 This illustrates the aggregation of Ure2(1-19)-eGFP at a concentration of 0.5 mg / mL in Example 5 of this invention.

[0040] Figure 6 This illustrates the aggregation of Ure2(tubian20)-eGFP at a concentration of 0.5 mg / mL in Example 5 of this invention.

[0041] Figure 7 This illustrates the aggregation of Ure2(tubian52)-eGFP at a concentration of 0.5 mg / mL in Example 5 of this invention.

[0042] Figure 8 The aggregation of Ure2(1-71)-mCherry at a concentration of 0.5 mg / mL is shown in Example 5 of this invention.

[0043] Figure 9 The aggregation of Ure2(1-19)-mCherry at a concentration of 0.5 mg / mL is shown in Example 5 of this invention.

[0044] Figure 10 This illustrates the aggregation of Ure2(tubian20)-mCherry at a concentration of 0.5 mg / mL in Example 5 of this invention.

[0045] Figure 11 The aggregation of Ure2(tubian52)-mCherry at a concentration of 0.5 mg / mL is shown in Example 5 of this invention.

[0046] Figure 12 This describes the gelation of Ure2(1-71)-eGFP at a concentration of 1 mg / mL in Example 6 of this invention.

[0047] Figure 13 This describes the gelation of Ure2(1-19)-eGFP at a concentration of 1 mg / mL in Example 6 of this invention.

[0048] Figure 14 This describes the gelation of Ure2(tubian20)-eGFP at a concentration of 1 mg / mL in Example 6 of this invention.

[0049] Figure 15 This describes the gelation of Ure2(tubian52)-eGFP at a concentration of 1 mg / mL in Example 6 of this invention.

[0050] Figure 16 This describes the gelation of Ure2(1-71)-mCherry at a concentration of 1 mg / mL in Example 6 of this invention.

[0051] Figure 17 This describes the gelation of Ure2(1-71)-GB1-R16-RGD at a concentration of 1 mg / mL in Example 6 of this invention.

[0052] Figure 18 This describes the gelation of Ure2(1-71)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 6 of this invention.

[0053] Figure 19 This describes the gelation of Ure2(1-71)-GB1-R16-RGD and Ure2(1-71)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 6 of the present invention.

[0054] Figure 20 This describes the gelation of Ure2(1-19)-GB1-R16-RGD at a concentration of 1 mg / mL in Example 6 of this invention.

[0055] Figure 21 This describes the gelation of Ure2(1-19)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 6 of this invention.

[0056] Figure 22 The gelation of Ure2(1-19)-GB1-R16-RGD and Ure2(1-19)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 6 of the present invention;

[0057] Figure 23 The nanofiber structure of the Ure2(1-71)-eGFP fusion protein under a transmission electron microscope in Example 7 of this invention;

[0058] Figure 24 The Ure2(1-19)-eGFP fusion protein nanofiber structure under a transmission electron microscope in Example 7 of this invention;

[0059] Figure 25 The Ure2(tubian52)-eGFP fusion protein nanofiber structure under a transmission electron microscope in Example 7 of this invention;

[0060] Figure 26The structure of Ure2(1-71)-mCherry fusion protein nanofibers under a transmission electron microscope in Example 7 of this invention;

[0061] Figure 27 The structure of Ure2(1-19)-mCherry fusion protein nanofibers under a transmission electron microscope in Example 7 of this invention;

[0062] Figure 28 The Ure2(tubian52)-mCherry fusion protein nanofiber structure under a transmission electron microscope in Example 7 of this invention;

[0063] Figure 29 The supramolecular hydrogel network structure formed by Ure2(1-71)-GB1-R16-RGD under a scanning electron microscope in Example 8 of this invention;

[0064] Figure 30 The supramolecular hydrogel network structure formed by Ure2(1-71)-(GB1-R16)4-RGD under a scanning electron microscope in Example 8 of this invention;

[0065] Figure 31 The supramolecular hydrogel network structure formed by Ure2(1-19)-GB1-R16-RGD under a scanning electron microscope in Example 8 of this invention;

[0066] Figure 32 The supramolecular hydrogel network structure formed by Ure2(1-19)-(GB1-R16)4-RGD under a scanning electron microscope in Example 8 of this invention;

[0067] Figure 33 The rheological properties of the supramolecular hydrogels formed in Example 9 of this invention at concentrations of 1 mg / mL, 10 mg / mL and 15 mg / mL, respectively;

[0068] Figure 34 The rheological properties of the supramolecular hydrogel formed by Ure2(1-71)-GB1-R16-RGD at a concentration of 1 mg / mL in Example 9 of this invention;

[0069] Figure 35 The rheological properties of the supramolecular hydrogel formed by Ure2(1-71)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 9 of this invention;

[0070] Figure 36 The rheological properties of the supramolecular hydrogel formed by Ure2(1-19)-GB1-R16-RGD at a concentration of 1 mg / mL in Example 9 of this invention;

[0071] Figure 37 The rheological properties of the supramolecular hydrogel formed by Ure2(1-19)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 9 of this invention;

[0072] Figure 38 The results of treating human skin fibroblasts with supramolecular hydrogel formed at a concentration of 1 mg / mL using Ure2(1-71)-GB1-R16-RGD in Example 10 of this invention.

[0073] Figure 39 The results of treating human skin fibroblasts with supramolecular hydrogels formed by Ure2(1-71)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 10 of this invention;

[0074] Figure 40 The results of treating human skin fibroblasts with supramolecular hydrogel formed at a concentration of 1 mg / mL using Ure2(1-19)-GB1-R16-RGD in Example 10 of this invention.

[0075] Figure 41 The results of treating human skin fibroblasts with supramolecular hydrogel formed by Ure2(1-19)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 10 of this invention;

[0076] Figure 42 The supramolecular hydrogels formed by Ure2(1-71)-GB1-R16-RGD, Ure2(1-71)-(GB1-R16)4-RGD, Ure2(1-19)-GB1-R16-RGD and Ure2(1-19)-(GB1-R16)4-RGD at a concentration of 1 mg / mL in Example 11 of this invention promote the healing of damaged skin tissue. Detailed Implementation

[0077] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0078] The primers used in the following examples are listed below:

[0079] Primer name Primer sequence (5'-3') Pf_Ure2(1-19)-GB1 - R16-RGD(N) TTCAAAACAATAACAGTAGCGGTATGGATACGTACAAG Pr_Ure2(1-19)-GB1-R16-RGD(N) GCGGCCGCTGTTATTGTTTATTATTG Pf_Ure2(1-19)-(GB1-R16)4-RGD (N) AATACAACCGGTAGCGGTGGTAGCGGTATGGATACGTACAAGC Pr_Ure2(1-19)-(GB1-R16)4-RGD (N) CCGCTACCGGTTGTATTACTGTTCCTGTTTC Pf_Ure2(1-71)- (GB1-R16)4-RGD(N) TTCAAAACAATAACAGCGGCGGTAGCGGTGGTAGCGGTATGGATACGTACAAG Pr_Ure2(1-71)- (GB1-R16)4-RGD(N) GCGGCCGCTGTTATTGTTTTGAACATTATTG Pf_Ure2(1-71)-GB1-R16-RGD(N) GCAATGGTAGCCAAAATAATGGTAGCGGTGGTAGCGGTATGGATACGTACAAG Pr_Ure2(1-71)-GB1-R16-RGD(N) ATTATTTTGGCTACCATTGCGGCCGC Pf_Ure2(1-19)-mCherry(N) TTCAAAACAATAACAGCGGCGGTAGCGGTGGTAGCGGTATGGTGAG Pr_Ure2(1-19)-mCherry(N) GCCGCTGTTATTGTTTTGAACATTATTGTTATTACTAC Pf_Ure2(1-19)-eGFP(N) TTCAAAACAATAACAGCGGCGGTAGCGGTGGTAGCGGTATGGGTAAG Pr_Ure2(1-19)-eGFP (N) GCCGCTGTTATTGTTTTGAACATTATTGTTATTACTACTGC Pf_Ure2(1-71)-mCherry(N) GCAATGGTAGCCAAAATAATGGTAGCGGTGGTAGCGGTATGGTG Pr_Ure2(1-71)-mCherry(N) ATTATTTTGGCTACCATTGCGGCCGC Pf_Ure2(1-71)-eGFP(N) GCAATGGTAGCCAAAATAATGGTAGCGGTGGTAGCGGTATGGG Pr_Ure2(1-71)-eGFP (N) ATTATTTTGGCTACCATTGCGGCCGC

[0080] Example 1: Obtaining short peptides Ure2 (1-19) and Ure2 (1-71) of amyloid fibrils

[0081] Ure2(1-71) can be obtained either by cloning the genome of Saccharomyces cerevisiae or by direct gene synthesis. In this case, gene synthesis was used. The amino acid sequence of Ure2(1-71) is: MMNNNGNQVSNLSNALRQVNIGNRNSNTTTDQSNINFEFSTGVNNNNNNNSSSNNNNVQNNNSGRNGSQNN, as shown in SEQ ID NO.1. Ure2(1-19) is then truncated by 52 amino acids to become MMNNNGNQVSNLSNALRQV, as shown in SEQ ID NO.2.

[0082] Due to codon bias, there can be many different gene sequences, but ultimately, as long as the encoded amino acid sequence is as shown above, it is the target sequence in this invention.

[0083] The amino acids in Ure2(1-71) were replaced to obtain the mutants Ure2(tubian20) (shown in SEQ ID NO.3) and Ure2(tubian52) (shown in SEQ ID NO.4).

[0084] The amino acid sequence of the mutant Ure2 (tubian20) is MMNNNGNQVSNLSNALRQVNIGNRNSNTTTDQSNINFEFSTGVNNNNNNNSFSNNNNVQNNNSGRNGSQNN; the amino acid sequence of the mutant Ure2 (tubian52) is MMNNNGNQVSNLSNALRQVMIGNRNSNTTTDQSNINFEFSTGVNNNNNNNSSSNNNNVQNNNSGRNGSQNN.

[0085] Example 2: Obtaining the sequence of artificial elastin

[0086] The supramolecular elastin is composed of three fused parts: the immunoglobulin partial sequence GB1 derived from lactic acid bacteria and the partial sequence R16 derived from insect elastin provide mechanical strength, and the human cell adhesion short peptide RGD provides the cell adhesion site. The final artificial elastin sequence is GB1-R16-RGD.

[0087] The amino acid sequence of GB1 in supramolecular elastin is shown in SEQ ID NO.5, specifically:

[0088] MDTYKLILNGKTLKGETTTEAVDAATAEKVFKQYANDNGVDGEWTYDDATKTFTVTERS;

[0089] The amino acid sequence of R16 in supramolecular elastin is shown in SEQ ID NO.6, specifically: AQTPSSQYGAP;

[0090] The amino acid sequence of RGD in artificial hydrogel materials is: RGD.

[0091] In this invention, the above-mentioned protein sequences are all obtained by gene synthesis.

[0092] The protein sequence that provides mechanical strength in artificial hydrogel materials can be a single repeat (GB1-R16-RGD) or multiple repeats, such as four repeats (GB1-R16)4-RGD;

[0093] The above-mentioned artificial elastin sequence was obtained through gene synthesis.

[0094] Example 3: Obtaining Hydrogel Materials

[0095] The amyloid fibrous short peptides Ure2(1-19) or Ure2(1-71) were fused to the N-terminus of artificial elastin to obtain single-repeat and functionalized hydrogel materials Ure2(1-71)-GB1-R16-RGD, Ure2(1-71)-(GB1-R16)4-RGD, Ure2(1-19)-GB1-R16-RGD and Ure2(1-19)-(GB1-R16)4-RGD.

[0096] Using primers Pf_Ure2(1-19)-GB1-R16-RGD(N) / Pr_Ure2(1-19)-GB1-R16-RGD(N), Pf_Ure2(1-71)-GB1-R16-RGD(N) / Pr_Ure2(1-71)-GB1-R16-RGD(N) and a one-step rapid cloning kit (Yisheng Biotechnology), the amyloid fibrous short peptide mutant Ure2(1-71) was fused to the N-terminus of the single-repeat supramolecular elastin GB1-R16-RGD and inserted into the Nde I / Xho I position of the expression plasmid pET-28a(+), thus constructing the expression plasmid pET28a-Ure2(1-71)-GB1-R16-RGD. pET28a-Ure2(1-71)-(GB1-R16)4-RGD, pET28a-Ure2(1-19)-GB1-R16-RGD and pET28a-Ure2(1-19)-(GB1-R16)4-RGD were constructed using the same method.

[0097] Furthermore, the amyloid fibril short peptides Ure2(1-19) or Ure2(1-71) were fused to the N-terminus to drive the fluorescent proteins mCherry and eGFP, resulting in fluorescent hydrogel materials Ure2(1-19)-mCherry, Ure2(1-19)-eGFP, Ure2(1-71)-mCherry, Ure2(1-71)-eGFP, Ure2(tubian20)-eGFP, Ure2(tubian20)-mCherry, Ure2(tubian52)-eGFP, and Ure2(tubian52)-mCherry.

[0098] Furthermore, using primers Pf_Ure2(1-19)-mCherry(N) / Pr_Ure2(1-19)-mCherry(N), Pf_Ure2(1-19)-eGFP(N) / Pr_Ure2(1-19)-eGFP(N), Pf_Ure2(1-71)-mCherry(N) / Pr_Ure2(1-71)-mCherry(N), and Pf_Ure2(1-71)-eGFP(N) / Pr_Ure2(1-71)-eGFP(N) provides a one-step fast method. The rapid cloning kit (Yisheng Biotechnology) fused the amyloid fibrillary short peptides Ure2(1-19) and Ure2(1-19) to the N-terminus of the fluorescent proteins mCherry and eGFP, and inserted them into the NdeI / XhoI position of the expression plasmid pET-28a(+), thus constructing the expression plasmids pET28a-Ure2(1-19)-mCherry, pET28a-Ure2(1-19)-eGFP, pET28a-Ure2(1-71)-mCherry, and pET28a-Ure2(1-71)-eGFP. Using the same method, pET28a-Ure2(tubian20)-eGFP, pET28a-Ure2(tubian20)-mCherry, pET28a-Ure2(tubian52)-eGFP, and pET28a-Ure2(tubian52)-mCherry were also constructed.

[0099] Example 4: Expression and purification of the target protein

[0100] Preparation of culture medium: LB (Luria broth) liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.0; autoclave at 121℃ for 20 min.

[0101] LB solid medium: Add 2% agar powder to LB (Luria broth) liquid medium; autoclave at 121℃ for 20 min.

[0102] Preparation of competent E. coli cells:

[0103] The expression strain used in this example was *Escherichia coli* BL21(DE3). A single colony was picked and cultured in 5 mL of LB medium on a shaker (37°C, 220 rpm) overnight (approximately 12 h). 500 μL of the overnight culture was transferred to 50 mL of fresh LB medium and cultured on a shaker (37°C, 200 rpm) until the absorbance reached 0.35-0.6 at 600 nm. 0.1 mol / L CaCl2 solution was pre-chilled on ice. 25 mL of the bacterial culture was transferred to a 50 mL EP tube and cooled on ice for 10 min. The tube was centrifuged at 3000 g at 4°C for 5 min, the supernatant was discarded, and 1 mL of pre-chilled 0.1 mol / L CaCl2 solution was added. The cells were gently resuspended by pipetting and placed on ice for 20 min. Centrifuge at 3000 g, 4℃ for 5 min, discard the supernatant, add 1 mL of pre-cooled mixed solution (0.1 mol / L CaCl2 mixed with 10% glycerol), and mix well to resuspend the cells. Aliquot 100 μL of cell suspension into 1.5 mL EP tubes and store at -80℃ for later use.

[0104] Plasmid was transformed into Escherichia coli BL21:

[0105] After the competent cells thaw, transfer 1 μL of plasmid into 100 μL of competent cells and gently tap to mix. Incubate on ice for 30 min, then heat shock in a 42°C water bath for 90 s, followed by 10 min on ice. Add 1 mL of fresh LB medium to each competent cell EP tube and incubate on a shaker (37°C, 200 rpm, 1 h). Add all E. coli to a kanamycin-resistant plate and spread thoroughly. Incubate the transformation plate upside down at 37°C for 12–24 h.

[0106] Fermentation by strains:

[0107] Prepare a culture medium for activating the bacterial strain (LB liquid medium). Add the engineered bacteria to the LB culture medium at a ratio of 1% and culture on a shaker (37℃, 200 rpm) for 12 h. Inoculate the activated bacterial strain into 200 mL of fermentation medium (LB liquid medium) with an initial inoculum of OD600 of 0.1. Culture on a shaker (37℃, 200 rpm) until the absorbance reaches 0.5-0.6 at 600 nm. Then add 10 mM IPTG and induce fermentation on a shaker (30℃, 200 rpm) for 12 h. Measure the absorbance at 600 nm to be 2.0-2.5.

[0108] Collect bacterial cells:

[0109] After removing the supernatant by high-speed refrigerated centrifuge at 6000 rpm for 10 min at 4℃, 200 mL of fermentation broth was transferred in batches to 50 mL EP tubes. The resulting bacterial cells were placed on a vortex mixer to resuspend the bacterial cells evenly and then ultrasonically disrupted in an ice bath.

[0110] Ultrasonic rupture instrument parameter settings: power 900W, probe size 12mm, amplitude 60%, ultrasound for 2 seconds, stop for 2 seconds, total time 2 minutes, total ultrasound time 6 minutes.

[0111] Protein purification:

[0112] The cell lysis buffer was transferred to 50 mL EP tubes and centrifuged at 8000 rpm for 10 min at 4°C. The supernatant was carefully transferred to a clean tube without touching the precipitate below. The supernatant was mixed with 5 mL of Ni-NTA agarose purification resin and incubated for 1 h. Water and buffer were filtered through a 0.45 μm filter before use to minimize the impact of impurities on the packing material.

[0113] Wash the resin with 10 column volumes of stripping buffer (50 mM NaH2PO4, 300 mM NaCl, 100 mM EDTA, pH 8.0), then wash with 10-20 column volumes of deionized water, followed by 5 column volumes of 100 mM NiSO4 (dissolved in deionized water). Finally, reequilibrate with 10 column volumes of PBS buffer. The equilibrated resin is ready for purification experiments.

[0114] The incubated Ni-NTA agarose purification resin was loaded onto a column for gradient elution. Most contaminating proteins were eluted with 20 mL of 40 mM imidazole, followed by elution with 500 mM imidazole to remove the target protein. The protein concentration in the eluent was determined using a micro-spectrophotometer. Finally, desalting was performed using a membrane packing instrument. The eluted and desalted proteins were suitable for SDS-PAGE analysis. The column was eluted with 5 volumes of Eluent Buffer, equilibrated with 5 volumes of Binding / Wash Buffer, and washed with 5 volumes of ddH2O. A 20% ethanol protective buffer was added, and the column was stored at 2–8°C. The collected proteins were desalted using a gravity desalting column to remove imidazole, followed by lyophilization to obtain the target protein, which was then stored at 4°C.

[0115] Data were collected at each step of the purification process and the purification status was verified by SDS-PAGE. The purification status of the functional hydrogel material is shown in the attached figure. Figure 1 and attached Figure 2 The purification status of the fluorescent hydrogel material is shown in the attached figure. Figure 3 As shown.

[0116] Example 5: Preparation of self-assembled nanofiber aggregates

[0117] The recombinant protein fused with the above-mentioned self-assembled short peptides is dissolved in pure water or various buffer solutions at a concentration of less than 1 mg / ml. The ambient temperature is not limited and can be carried out from 0°C to room temperature. The protein solution is then allowed to stand to obtain nanofiber-like self-assembled aggregates. The recombinant protein activity of these self-assembled aggregates remains unchanged. It takes about 2 days for the entire self-assembly to be completed.

[0118] The aggregation of Ure2(1-71)-eGFP at a concentration of 0.5 mg / mL is as follows: Figure 4 As shown, the aggregation of Ure2(1-19)-eGFP is as follows: Figure 5 As shown, the aggregation of Ure2(tubian20)-eGFP is as follows: Figure 6 As shown, the aggregation of Ure2(tubian52)-eGFP is as follows: Figure 7 As shown, the aggregation of Ure2(1-71)-mCherry is as follows: Figure 8 As shown, the aggregation of Ure2(1-19)-mCherry is as follows: Figure 9 As shown, the aggregation of Ure2(tubian20)-mCherry is as follows: Figure 10 As shown, the aggregation of Ure2(tubian52)-mCherry is as follows: Figure 11 As shown.

[0119] Example 6: Preparation of supramolecular hydrogels

[0120] The supramolecular hydrogel is prepared as follows: The obtained hydrogel material is dissolved in pure water, various buffer solutions, or DMEM cell culture medium, with a concentration range of ≥1 mg / ml. The ambient temperature is unrestricted; the process can be carried out from 0ºC to room temperature. Allowing the protein solution to stand yields a nanofiber-like self-assembled hydrogel, in which the recombinant protein activity remains unchanged. The self-assembly time is ≥10 min to complete the hydrogel formation.

[0121] When designing hydrogel materials using sequences, driven by Ure2(1-19) and Ure2(1-71), under room temperature conditions, only pure water is added without the addition of any crosslinking agent. Ure2(1-19)-GB1-RGD, Ure2(1-71)-GB1-RGD, Ure2(1-19)-mCherry, Ure2(1-19)-eGFP, Ure2(1-71)-mCherry and Ure2(1-71)-eGFP form a transparent and homogeneous aqueous solution. After standing for a period of time, they all form stable hydrogels, demonstrating a unique rapid gelation ability. This further illustrates that the purified hydrogel material powder can rapidly self-assemble in any aqueous solution, including pure water, to form an injectable colloid with underwater adhesion properties and shear-thinning effect.

[0122] The gelation behavior of Ure2(1-71)-eGFP at a concentration of 1 mg / mL is as follows: Figure 12 As shown, the gelation behavior of Ure2(1-19)-eGFP is as follows: Figure 13 As shown, the gelation behavior of Ure2(tubian20)-eGFP is as follows: Figure 14 As shown, the gelation behavior of Ure2(tubian52)-eGFP is as follows: Figure 15 As shown, the gelation behavior of Ure2(1-71)-mCherry is as follows: Figure 16 As shown, the gelation process of Ure2(1-71)-GB1-R16-RGD is as follows: Figure 17 and Figure 19 As shown, the gelation behavior of Ure2(1-71)-(GB1-R16)4-RGD is as follows: Figure 18 and Figure 19 As shown, the gelation process of Ure2(1-19)-GB1-R16-RGD is as follows: Figure 20 and Figure 22 As shown, the gelation behavior of Ure2(1-19)-(GB1-R16)4-RGD is as follows: Figure 21 and Figure 22 As shown.

[0123] Example 7: TEM observation of nanofiber formation

[0124] For negative staining TEM, a 10 µL droplet of target protein suspension (30 µM) was loaded onto a glow discharge carbon-coated grid and held for 1 minute. Additional sample was blotted away with filter paper and held for 1 minute. 2% uranyl acetate was used to stain the sample for 20 seconds. Photographs were recorded using a CM120-FEG (FEI) microscope operating at 100 kV.

[0125] The structure of Ure2(1-71)-eGFP fusion protein nanofibers under a transmission electron microscope is shown below. Figure 23 As shown, the structure of the Ure2(1-19)-eGFP fusion protein nanofibers is as follows. Figure 24 As shown, the Ure2(tubian52)-eGFP fusion protein nanofiber structure is as follows: Figure 25 As shown, the structure of the Ure2(1-71)-mCherry fusion protein nanofibers is as follows: Figure 26 As shown, the Ure2(1-19)-mCherry fusion protein nanofiber structure is as follows: Figure 27 As shown, the Ure2(tubian52)-mCherry fusion protein nanofiber structure is as follows: Figure 28 As shown.

[0126] Example 8: SEM observation of the formation of nanonetworks

[0127] The prepared protein solution was dropped into the center of the silicon wafer, and after being thoroughly dried in a drying tower, its surface morphology was observed under a JSM-7610FPlus scanning electron microscope.

[0128] The supramolecular hydrogel network structure formed by Ure2(1-71)-GB1-R16-RGD under scanning electron microscopy is as follows: Figure 29 As shown, the supramolecular hydrogel network structure formed by Ure2(1-71)-(GB1-R16)4-RGD is as follows: Figure 30 As shown, the supramolecular hydrogel network structure formed by Ure2(1-19)-GB1-R16-RGD is as follows: Figure 31 As shown, the supramolecular hydrogel network structure formed by Ure2(1-19)-(GB1-R16)4-RGD is as follows: Figure 32 As shown.

[0129] Example 9: Rheological determination of supramolecular hydrogels

[0130] The rheological properties of supramolecular hydrogels were investigated using a strain-controlled rheometer (TA Instruments, AR-G2). Three hydrogel samples were prepared independently for all measurements. Hydrogel samples prepared at different concentrations were placed on plates. Rheological experiments were performed by placing different concentrations on plates. Strain-dependent strain scanning modes were used with amplitudes ranging from 0.01% to 1000% and a fixed frequency of 1 rad / s, or a fixed frequency scanning mode with a strain of 1% and a frequency scanning mode ranging from 0.01 radians / second to 10 radians / second, while continuously measuring the storage modulus (G') and loss modulus (G'').

[0131] The rheological properties of supramolecular hydrogels formed by Ure2(1-71)-eGFP at concentrations of 1 mg / mL, 10 mg / mL, and 15 mg / mL are as follows: Figure 33 As shown, the rheological properties of the supramolecular hydrogel formed by Ure2(1-71)-GB1-R16-RGD at a concentration of 1 mg / mL are as follows: Figure 34 As shown, the rheological properties of the supramolecular hydrogel formed by Ure2(1-71)-(GB1-R16)4-RGD at a concentration of 1 mg / mL are as follows: Figure 35 As shown, the rheological properties of the supramolecular hydrogel formed by Ure2(1-19)-GB1-R16-RGD at a concentration of 1 mg / mL are as follows: Figure 36 As shown, the rheological properties of the supramolecular hydrogel formed by Ure2(1-19)-(GB1-R16)4-RGD at a concentration of 1 mg / mL are as follows: Figure 37 As shown.

[0132] Example 10: Hydrogel promotes rapid adhesion of human skin fibroblasts

[0133] 200 μL of the hydrogel from this invention is added to a 48-well flat-bottomed microplate and spread evenly to create a colloidal plate suitable for cell culture. Protein solutions of different concentrations are added to the 48-well plate, 200 μL per well. After standing in a clean bench for 1 h, all liquid is aspirated with a pipette. The plate is then air-dried in a clean bench for 30 min before being seeded with cells. Adhering cells are digested with trypsin for 1 min, not exceeding 3 min. Digestion is stopped with twice the volume of trypsin in complete culture medium. 10 μL of the digested solution is used for cell microscopic counting. All liquid in the flask is then transferred to a 15 mL centrifuge tube and centrifuged at 1200 rpm for 5 min. The supernatant is discarded. The precipitated cells are diluted with complete culture medium, with a volume of 200 μL per well and a cell count of 10,000 per well. The plate is then incubated at 37°C in a 5% CO2 incubator for 24 h.

[0134] After culturing the cells for 0 h, 36 h, and 72 h, fluorescence photography was performed under a microscope. The cells were then gently rinsed three times with PBS and the Beyotime live / dead cell staining kit was used according to the instructions. The cell growth was then observed under a fluorescence microscope.

[0135] The results of treating human skin fibroblasts with a supramolecular hydrogel formed by Ure2(1-71)-GB1-R16-RGD at a concentration of 1 mg / mL are as follows: Figure 38 As shown, the supramolecular hydrogel formed by Ure2(1-71)-(GB1-R16)4-RGD at a concentration of 1 mg / mL treated human skin fibroblasts with the following results. Figure 39 As shown, the supramolecular hydrogel formed by Ure2(1-19)-GB1-R16-RGD at a concentration of 1 mg / mL treated human skin fibroblasts with the following results. Figure 40 As shown, the supramolecular hydrogel formed by Ure2(1-19)-(GB1-R16)4-RGD at a concentration of 1 mg / mL treated human skin fibroblasts with the following results. Figure 41 As shown, the treatment with supramolecular hydrogel significantly improved the growth of human skin fibroblasts compared to the control group. The supramolecular hydrogel prepared in this example can promote cell adhesion, proliferation, and differentiation.

[0136] Example 11: Wound healing and tissue regeneration of damaged skin tissue

[0137] To evaluate the effects of supramolecular hydrogels on wound healing and tissue regeneration in damaged skin tissue, healthy SD rats weighing approximately 300 grams were randomly divided into six groups (n=6). Rats were anesthetized with chloral hydrate (10 wt.%). A circular wound with a diameter of 10 mm was created on the rat's back. The six experimental groups consisted of an untreated control group and groups treated with Ure2(1-71)-GB1-R16-RGD, Ure2(1-71)-(GB1-R16)4-RGD, Ure2(1-19)-GB1-R16-RGD, Ure2(1-19)-(GB1-R16)4-RGD (all supramolecular elastin concentrations were 1 mg / ml), and the commercial collagen functional dressing BONNEHEURE, respectively. Each group was individually treated. Wound photographs were taken using a digital camera on days 1, 3, 7, and 10 after treatment. The results are shown below. Figure 42 As shown, the supramolecular hydrogel prepared in the examples can promote skin tissue regeneration and has good application prospects in the fields of tissue engineering and biomedicine.

[0138] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A method for preparing a supramolecular hydrogel, characterized in that, Includes the following steps: Recombinant proteins are obtained by fusing any recombinant protein with the amyloid short peptide Ure2(1-71) or its mutant, and then one or more recombinant proteins are placed in an aqueous solution for self-assembly. The amino acid sequence of the amyloid short peptide Ure2(1-71) is shown in SEQ ID NO.

1.

2. The preparation method according to claim 1, characterized in that, Amyloid short peptide mutants are any of the following: (1) Amyloid short peptides are truncated from the C-terminus to any one of the 1st to 52nd amino acids; (2) Starting from the C-terminus, the amyloid short peptide replaces any one of the 1st to 52nd amino acids.

3. The preparation method according to claim 1 or 2, characterized in that: The protein is a recombinant elastin, which is formed by fusing a first sequence, a second sequence and a third sequence. The amino acid sequence of the first sequence is shown in SEQ ID NO.5, the amino acid sequence of the second sequence is shown in SEQ ID NO.6, and the amino acid sequence of the third sequence is RGD.

4. The preparation method according to claim 3, characterized in that: The first sequence and the second sequence form a repeating unit, and the number of repeating units is 1-4.

5. The preparation method according to claim 1, characterized in that: The concentration of the recombinant protein in the aqueous solution is not less than 1 mg / mL.

6. The supramolecular hydrogel prepared by the preparation method according to any one of claims 1-5.

7. The application of the supramolecular hydrogel of claim 6 in the biological or medical field, wherein the application is the preparation of cosmetic products, medical device products, injectable gel preparation, tissue engineering, drug delivery or enzyme immobilization.

8. A core amino acid sequence capable of driving the self-assembly of any recombinant protein to form a supramolecular hydrogel material, characterized in that, The core amino acid sequence is the amyloid peptide Ure2(1-71) or its mutant, the amino acid sequence of which is shown in SEQ ID NO.1, and the mutant is any one of the following: (1) Amyloid short peptides are truncated from the C-terminus to any one of the 1st to 52nd amino acids; (2) Starting from the C-terminus, the amyloid short peptide replaces any one of the 1st to 52nd amino acids.

9. A cell adhesion material, characterized in that: The cell adhesion material includes the supramolecular hydrogel of claim 6.

10. The application of the cell adhesion material of claim 9 in tissue engineering.

Images