Method for reducing cell gene editing large fragment deletion

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a method for reducing cell gene editing large fragment deletion. The invention provides a method for reducing cell gene editing large fragment deletion, which comprises the following steps: introducing a gene editing system into a cell, and carrying out gene editing on a gamma-globin gene promoter region so as to reduce HBG gene large fragment deletion, the gene editing system comprises Cas nuclease, gRNA and ssODN, the ssODN comprises a 5'homologous arm, a replacement sequence and a 3 'homologous arm, the length of the 5' homologous arm and the length of the 3 'homologous arm are respectively and independently 30-60 nt, and HBG gene large fragment deletion caused by multiple DSBs can be reduced by adjusting the length of the ssODN.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, and in particular relates to a method for reducing the deletion of large fragments in cellular gene editing. Background Technology

[0002] Hemoglobinopathies, particularly β-thalassemia and sickle cell anemia, are a group of serious inherited blood disorders caused by abnormalities in the adult β-globin (HBB) gene. Studies have shown that γ-globin (encoded by the HBG1 and HBG2 genes), which is highly expressed during fetal development, can functionally partially or completely replace defective β-globin. Therefore, reactivating HBG gene expression in adult erythroid cells is considered a promising therapeutic strategy.

[0003] In recent years, gene editing technology, especially the CRISPR / Cas system, has been widely used to regulate HBG gene expression. Existing research shows that by disrupting the binding sites of transcriptional repressors (such as BCL11A and ZBTB7A) in the HBG promoter region, transcriptional repression of γ-globin can be significantly relieved, thereby increasing HbF levels. Based on this principle, gene editing protocols targeting the HBG promoter region have been validated in numerous research and clinical projects.

[0004] However, the unique structure of the HBG gene in the genome poses potential safety risks to the aforementioned editing strategies. In the human genome, the HBG1 and HBG2 gene sequences are highly homologous and arranged in tandem, with their promoter regions being highly similar in both sequence composition and spatial location. When gene editing is performed using nucleases targeting the BCL11A or ZBTB7A binding sites, the simultaneous presence of the target sequence in both the HBG1 and HBG2 promoters can easily lead to double-strand breaks (DSBs) at both gene sites.

[0005] During cellular DNA damage repair, if two adjacent DSBs coexist, the non-homologous end joining (NHEJ) repair mechanism may directly connect the broken ends, resulting in the complete deletion of a large genomic sequence between HBG1 and HBG2. Existing studies have observed that this type of editing event can induce a deletion of approximately 4.9 kb of intermediate fragments, involving the spacer region between HBG1 and HBG2, and may even affect the overall structural integrity of the β-globin gene cluster.

[0006] The aforementioned large-segment deletions not only lead to irreversible structural changes in the genome but may also introduce a series of potential risks. For example, the deleted regions may contain regulatory elements, non-coding RNAs, or chromatin structure-related sequences, and their loss may have unpredictable effects on erythroid differentiation, gene expression regulation, and long-term cell stability. Furthermore, the accumulation of such structural variations in in vitro edited hematopoietic stem cells may raise concerns about biosafety and regulatory implications in clinical applications.

[0007] Therefore, although gene editing strategies targeting HBG promoter regulatory sites have shown significant effects in enhancing HbF expression, how to reduce large fragment deletions of the HBG gene caused by multiple DSBs remains a technical problem that urgently needs to be solved in this field. Summary of the Invention

[0008] This invention provides a method for reducing large fragment deletions in cellular gene editing. It was unexpectedly discovered that adjusting the length of ssODN can reduce large fragment deletions of the HBG gene caused by multiple DSBs.

[0009] This invention provides a method for reducing large fragment deletions in cellular gene editing, the method comprising:

[0010] The gene editing system was introduced into cells to edit the promoter region of the γ-globin gene, in order to reduce large fragment deletions in the HBG gene;

[0011] The gene editing system includes a Cas nuclease, gRNA, and ssODN, wherein the ssODN comprises a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm, and the lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 30–60 nt.

[0012] In some implementations, the lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 35 to 50 nt.

[0013] In some embodiments, the lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 35nt, 36nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, or 50nt.

[0014] In some implementations, the replacement sequence length of the ssODN is 0 to 5 nt.

[0015] In some embodiments, the 5' end of the 5' homologous arm and / or the 3' end of the 3' homologous arm are modified with thiophosphate.

[0016] In some embodiments, the γ-globin gene promoter region is selected from one or more of the following:

[0017] Between -92 and -66 for HBG1 and HBG2 starters, between -129 and -98 for HBG1 and HBG2 starters, between -175 and -153 for HBG1 and HBG2 starters, between -192 and -160 for HBG1 starters, between -428 and -406 for HBG1 starters, and between -432 and -410 for HBG2 starters.

[0018] In some embodiments, the γ-globin gene promoter region is selected from between -129 and -98 of the HBG1 and HBG2 promoters.

[0019] In some embodiments, the guide sequence of the gRNA is selected from any one or more sequences shown in SEQ ID NO:6 to SEQ ID NO:13.

[0020] In some embodiments, the ssODN is selected from any one or more of the sequences shown in SEQ ID NO:19 to SEQ ID NO:25.

[0021] In some embodiments, the cells are hematopoietic stem / progenitor cells, induced pluripotent stem cells, and / or erythroid progenitor cells.

[0022] In some embodiments, the gene editing system is introduced into the cells via electroporation;

[0023] The Cas nuclease and gRNA form an RNP complex, and the molar ratio of ssODN to the RNP complex is 0.8~2.

[0024] In some embodiments, the molar ratio of the ssODN to the RNP complex is 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.

[0025] In some embodiments, the Cas nuclease is selected from Cas9 and / or Cas12;

[0026] The Cas9 is selected from SpCas9, SaCas9, NmCas9, StCas9, St3Cas9, TdCas9, or their functional variants;

[0027] The Cas12 is selected from Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, C2c5, C2c8, C2c9, or functional variants thereof.

[0028] In summary, this invention provides a method for reducing large fragment deletions in cellular gene editing. Experimental results show that the lengths of the 5′ and 3′ homologous arms of ssODN are independently 30-60 nt, and the large fragment deletions of the cellular HBG gene are at a low level. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0030] Figure 1 The 4.9kb deletion frequency between HBG1 and HBG2 in each group of cells in Example 1 of this invention;

[0031] Figure 2 The 4.9kb deletion frequency between HBG1 and HBG2 in each group of cells in Example 2 of this invention. Detailed Implementation

[0032] definition

[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Furthermore, any methods or materials similar to or equivalent to those described or used herein may be used in the implementation of this invention. For the purposes of this invention, the following terms are defined.

[0034] In this application, “a,” “an,” and “the” are used to refer to one or more (i.e., at least one) grammatical object of the article.

[0035] In this application, when a specific value, range, or parameter is defined, it refers to the variation of that value, range, or parameter within a reasonable error range as understood by a person skilled in the art. This reasonable error range may originate from factors such as measurement methods, measurement conditions, instrument accuracy, experimental errors, or sample differences.

[0036] The terms “nucleic acid,” “nucleotide,” or “polynucleotide” refer to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and polymers thereof in single-stranded, double-stranded, or multi-stranded forms. This term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and / or pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural, synthetic, or derivatized nucleotide bases. In some embodiments, nucleic acids may comprise mixtures of DNA, RNA, and their analogues. Unless specifically defined, the term covers nucleic acids that contain known analogues of natural nucleotides, have similar binding properties to a reference nucleic acid, and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, specific nucleic acid sequences also implicitly encompass conserved variants of their modifications (e.g., degenerate codon substitutions), alleles, orthologs, single nucleotide polymorphisms (SNPs), and complementary sequences, as well as explicitly stated sequences. Specifically, degenerate codon substitution can be achieved by producing sequences in which the third position of one or more selected (or all) codons is replaced by a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term "nucleic acid" is used interchangeably with genes, cDNA, and mRNA encoded by genes.

[0037] The term "gene" or "nucleotide sequence encoding a polypeptide" refers to a segment of DNA involved in the production of a polypeptide chain. DNA segments may include regions located before and after coding regions that are involved in the transcription / translation of the gene product and the regulation of transcription / translation (leader and tail regions), as well as intercalation sequences (introns) between the individual coding regions (exons).

[0038] The term "gRNA" or "guide RNA" refers to an RNA molecule that can interact with and guide the corresponding gene-editing tool, the Cas nuclease, to recognize or act on a target nucleic acid sequence. Guide RNAs can be in single-molecule or multi-molecule form. In some embodiments, guide RNAs include single guide RNAs (sgRNAs), which typically contain a target sequence and a backbone sequence; in other embodiments, guide RNAs may consist of crRNAs and tracrRNAs or exist in functionally equivalent forms. sgRNAs are a type of guide RNA.

[0039] The term "functional variant" refers to a polypeptide that, compared to a reference gene editing tool (e.g., wild-type Cas protein), has one or more alterations in its amino acid sequence, such as substitution, deletion, or insertion, but retains at least one biological activity of the reference gene editing tool. In some embodiments, the functional variant retains nuclease activity mediating target DNA cleavage, the activity level of which may be comparable to, enhanced, or reduced by the reference protein. In some embodiments, the functional variant has altered activity, such as: (i) altered protospacer sequence neighbor motif (PAM) specificity; or (ii) increased target specificity (i.e., reduced off-target effects). Invention Details

[0041] This invention provides a method for reducing large fragment deletions in cellular gene editing. It was unexpectedly discovered that adjusting the length of ssODN can reduce large fragment deletions of the HBG gene caused by multiple DSBs.

[0042] Methods to reduce large deletions in cellular gene editing include:

[0043] The gene editing system was introduced into cells to edit the promoter region of the γ-globin gene, in order to reduce large fragment deletions in the HBG gene;

[0044] The gene editing system includes Cas nuclease, gRNA, and ssODN. ssODN contains a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm. The lengths of the 5′ and 3′ homologous arms are each independently 30–60 nt.

[0045] “ssODN” refers to single-stranded oligodeoxynucleotide, which can be used as a repair template in CRISPR / Cas-mediated gene editing and is often used to guide homology-directed repair (HDR). The applicant unexpectedly discovered that adjusting the length of ssODN can reduce large fragment deletions of the HBG gene caused by multiple DSBs.

[0046] In some implementations, ssODN contains nucleotide sequences homologous to the upstream and downstream regions of the target gene cleavage site, namely 5′ homologous arms and 3′ homologous arms, each of which is independently 30 to 60 nt in length.

[0047] In this application, when a series of values ​​is listed, it is intended to cover each value and sub-range within that range. For example, the lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 30~60 nt, covering: the lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 31~60nt, 32~60nt, 59~60nt, etc., and the lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 30nt, 31nt, 32nt, 33nt, 34nt, 35nt, 36nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, 50nt, 51nt, 52nt, 53nt, 54nt, 55nt, 56nt, 57nt, 58nt, 59nt, and 60nt.

[0048] In some implementations, the replacement sequence length of ssODN is 0~5 nt. The replacement sequence lengths of ssODN are 0~4nt, 0~3nt, 0~2nt, 0~1nt, 0nt, 1nt, 2nt, 3nt, 4nt, and 5nt.

[0049] In some embodiments, the ssODN comprises at least one, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more of the modified nucleotides described herein. In some cases, at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 99% of the sequence of the ssODN comprises the modified nucleotides. In some embodiments, the modified nucleotides are located at one or both ends of the ssODN. The modified nucleotides can be the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth nucleotide from the end, or any combination thereof. In some embodiments, the 5' end of the 5' homologous arm and / or the 3' end of the 3' homologous arm has a phosphate thioester modification. For example, the modified nucleotides can be located at the three terminal nucleotides at both ends of the ssODN. Alternatively, the modified nucleotides can be located inside the ends.

[0050] In some implementations, the γ-globin gene promoter region is selected from one or more of the following:

[0051] The HBG1 and HBG2 promoters are between -92 and -66 (Table 1 SEQ ID NO:1), between -129 and -98 (Table 1 SEQ ID NO:2), between -175 and -153 (Table 1 SEQ ID NO:3), between -192 and -160 (Table 1 SEQ ID NO:4), between -428 and -406 (Table 1 SEQ ID NO:5) of the HBG1 promoter, and between -432 and -410 (Table 1 SEQ ID NO:5) of the HBG2 promoter.

[0052] In some embodiments, the γ-globin gene promoter region is selected from between -129 and -98 of the HBG1 and HBG2 promoters (Table 1 SEQ ID NO:2).

[0053] gRNAs consist of: a first nucleotide sequence that hybridizes with target DNA in the cell's genome, where the target DNA contains mutations; and a second nucleotide sequence that interacts with Cas nucleases. gRNAs include both single guide RNAs (sgRNAs) and dual guide RNAs (dsRNAs).

[0054] In some implementations, the guide sequence of the gRNA is selected from any one or more sequences shown in SEQ ID NO:6 to SEQ ID NO:13.

[0055] An example of a guide sequence containing a stem loop for Cas9 binding is provided herein as GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Table 1 SEQ ID NO: 14).

[0056] In some implementations, the gRNA is selected from sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, sgRNA6, sgRNA7 and / or sgRNA8, the backbone sequence of sgRNA1-sgRNA8 is SEQ ID NO:14, and the guide sequences of sgRNA1-sgRNA8 are SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, and SEQ ID NO:13, respectively.

[0057] Exemplary sgRNA:

[0058] CUUGUCAAGGCUAUUGGUCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO: 15).

[0059] Table 1. Promoter region and sgRNA sequence information of the γ-globin gene of this invention.

[0060]

[0061] In some embodiments, the sgRNA is a modified sgRNA. In some cases, the modified sgRNA is complexed with a Cas nuclease (e.g., the Cas9 peptide) or a variant or fragment thereof to form a ribonucleoprotein (RNP)-based complex, and ssODN, for delivery into cells (e.g., in vitro cells such as primary cells for in vitro therapy or in vivo cells such as patient cells). The modifying nucleotides of the sgRNA may include modifications in the ribose (e.g., sugar) group, phosphate group, nucleobase, or any combination thereof. In some embodiments, modifications in the ribose group include modifications at the 2' position of the ribose. In some embodiments, the modified nucleotides include 2'-fluoroarabinose, tricyclic DNA (tc-DNA), peptide nucleic acid, cyclohexene nucleic acid (CeNA), locked nucleic acid (LNA), ethylene-bridged nucleic acid (ENA), phosphodiamidatemorpholino, or combinations thereof. The modified nucleotides or nucleotide analogs may include sugar-modified and / or backbone-modified ribonucleotides (i.e., including modifications to the phosphate-sugar backbone). For example, the phosphodiester bonds of natural or organic RNA can be modified to include at least one of nitrogen or sulfur heteroatoms. In some backbone-modified ribonucleotides, the phosphate group attached to an adjacent ribonucleotide can be replaced with a modified group, such as a thiophosphate group. In preferred sugar-modified ribonucleotides, the 2' portion is a group selected from H, OR, R, halogen, SH, SR, NH2, NHR, NR2, or ON, wherein R is a C1-C6 alkyl, alkenyl, or alkynyl, F, Cl, Br, or I. In some embodiments, the modified nucleotide contains a sugar modification. Non-limiting examples of sugar modifications include 2'-deoxy-2'-fluoro-oligonucleotides (2'-fluoro-2'-deoxycytidine-5'-triphosphate, 2'-fluoro-2'-deoxyuridine-5'-triphosphate), 2'-deoxy-2'-deamino-oligonucleotides (2'-amino-2'-deoxycytidine-5'-triphosphate, 2'-amino-2'-deoxyuridine-5'-triphosphate), 2'-O-alkyl-oligonucleotides, 2'-deoxy -2'-C-alkyl oligonucleotides (2'-O-methylcytidine-5'-triphosphate, 2'-methyluridine-5'-triphosphate), 2'-C-alkyl oligonucleotides, and their isomers (2'-cytarabine-5'-triphosphate, 2'-cytarabine-5'-triphosphate), azidotriphosphates (2'-azido-2'-deoxycytidine-5'-triphosphate, 2'-azido-2'-deoxyuridine-5'-triphosphate), and combinations thereof. In some embodiments, the modified sgRNA contains one or more 2'-fluorine, 2'-amino, and / or 2'-sulfur modifications.In some cases, the modifications are 2'-fluoro-cytidine, 2'-fluoro-uridine, 2'-fluoro-adenosine, 2'-fluoro-guanosine, 2'-amino-cytidine, 2'-amino-uridine, 2'-amino-adenosine, 2'-amino-guanosine, 2,6-diaminopurine, 4-thio-uridine, 5-amino-allyl-uridine, 5-bromo-uridine, 5-iodo-uridine, 5-methyl-cytidine, ribo-thymidine, 2-aminopurine, 2'-amino-butyryl-pyrene-uridine, 5-fluoro-cytidine, and / or 5-fluoro-uridine.

[0062] In some implementations, ssODN is selected from any one or more of the sequences shown in SEQ ID NO:19 to SEQ ID NO:25.

[0063] In some implementations, the cells are cell lines and / or primary cells.

[0064] In some implementations, the cells are hematopoietic stem / progenitor cells, induced pluripotent stem cells, and / or erythroid progenitor cells.

[0065] In some implementations, the cells may also be CD34+ cells. CD34+ cells may be selected from primary CD34+ hematopoietic progenitor cells, CD34+ peripheral blood cells, CD34+ umbilical cord blood cells, and CD34+ bone marrow cells. The cells may also be primary cells, such as primary CD34+ hematopoietic progenitor cells. The cells may be in vitro or ex vivo.

[0066] In some implementations, the gene-editing system is introduced into cells via electroporation;

[0067] Cas nuclease and gRNA form an RNP complex, with the molar ratio of ssODN to the RNP complex being 0.8–2. In some embodiments, the molar ratio of ssODN to the RNP complex is 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2. In some embodiments, the molar ratio of ssODN to the RNP complex is 1–2. In some embodiments, the molar ratio of ssODN to the RNP complex is 1.0. In some embodiments, the molar ratio of ssODN to the RNP complex is 1.3. In some embodiments, the molar ratio of ssODN to the RNP complex is 1.5. In some embodiments, the molar ratio of ssODN to the RNP complex is 2.

[0068] In some implementations, the Cas nuclease may be an RNA-directed Cas nuclease, such as a Cas protein or a functional fragment thereof from any bacterial species.

[0069] In some implementations, the Cas nuclease is a CRISPR-related protein selected from the group consisting of: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12a (also known as Cpf1), Csy1, Csy2, Csy3, Cse1, Cse2, and Csc. 1. Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cas12e (also known as CasX), Cas12d (also known as CasY), CasZ, or their functional fragments.

[0070] In some implementations, the Cas nuclease is the Cas9 nuclease (also known as the Cas9 protein or a functional fragment thereof). "Cas9" refers to an RNA-guided, double-stranded DNA-binding nuclease or cleavage enzyme. Wild-type Cas9 nucleases possess two functional domains that cleave different DNA strands, such as RuvC and HNH. When both domains are active, Cas9 can induce double-strand breaks in genomic DNA (target DNA). Cas9 enzymes may contain one or more catalytic domains from Cas9 proteins belonging to the following bacteria: *Corynebacterium*, *Sutterella*, *Legionella*, *Treponema*, *Filifactor*, *Eubacterium*, *Streptococcus*, *Lactobacillus*, *Mycoplasma*, and *Bacteroides*. The genera *Flavobacterium*, *Sphaerochaeta*, *Azospirillum*, *Gluconacetobacter*, *Neisseria*, *Roseburia*, *Parvibaculum*, *Staphylococcus*, *Nitratifractor*, and *Campylobacter* are mentioned. In some embodiments, the two catalytic domains are derived from different bacterial species. In some embodiments, the Cas9 nuclease is derived from *Streptococcus pyogenes*.

[0071] Functional fragments (or useful variants) of Cas9 nucleases may include a single inactive catalytic domain, such as RuvC- or HNH- enzymes or nicks. Cas9 nicks have only one active functional domain and are capable of cleaving only one strand of the target DNA, thereby creating a single-strand break or nick. In some embodiments, a mutant Cas9 nuclease with at least the D10A mutation is a Cas9 nick. In other embodiments, a mutant Cas9 nuclease with at least the H840A mutation is a Cas9 nick. Other examples of mutations present in Cas9 nicks include, but are not limited to, N854A and N863A. Double-strand breaks can be introduced using Cas9 nicks if at least two RNAs targeting opposite DNA strands are used. Double-nicked induced double-strand breaks can be repaired via NHEJ or HDR (Ran et al., 2013, Cell, 154:1380-1389). This gene-editing strategy favors HDR and reduces the frequency of indel mutations at off-target DNA sites. Non-limiting examples of Cas9 nucleases or nickases are described, for example, in U.S. Patents 8,895,308, 8,889,418, and 8,865,406, and U.S. Application Publications 2014 / 0356959, 2014 / 0273226, and 2014 / 0186919. Cas9 nucleases or nickases can be codon-optimized for target cells or target organisms.

[0072] In some implementations, the Cas nuclease is selected from Cas9 and / or Cas12;

[0073] Cas9 is selected from SpCas9 (Streptococcus pyogenes), SaCas9 (Staphylococcus aureus), NmCas9 (Neisseria meningitidis), StCas9 (Streptococcus thermophilus), St3Cas9 (Streptococcus thermophilus CRISPR3), TdCas9 (Treponemadenticola), or functional variants thereof;

[0074] Cas12 is selected from Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, C2c5, C2c8, C2c9, or their functional variants.

[0075] In some implementations, the molar ratio of sgRNA to Cas9 is 2.2–5.0.

[0076] In some implementations, the molar ratio of sgRNA to Cas9 is 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or 5.0.

[0077] In some implementations, the concentration of the RNP complex formed by the Cas nuclease and gRNA is above 1 μM.

[0078] In some implementations, the concentration of the RNP complex formed by the Cas nuclease and gRNA is 1 μM-5 μM. Specific Implementation

[0079] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0080] Example 1

[0081] This embodiment aims to investigate the effect of ssODN homologous arm length on the 4.9kb deletion frequency between HBG1 and HBG2 (ddPCR detection).

[0082] Cas9 protein (SpCas9) and sgRNA (SEQ ID NO: 15) were mixed and incubated at a molar ratio of sgRNA to Cas9 of 3 (tests showed that the efficiency of HBG site indel was higher when the molar ratio of sgRNA to Cas9 was in the range of 2.2-5, and there was no significant difference in the effect on the 4.9kb deletion frequency between HBG1 and HBG2), forming an RNP complex. The experiment was divided into 12 groups. Control group 1 (WT) pre-stimulated mPB CD34+ cells with human cytokines in X-Vivo-10 for 2 days without electroporation. Control group 2 (T0) pre-stimulated mPB CD34+ cells with human cytokines in X-Vivo-10 for 2 days, and then electroporated with 2μM RNP complex (tests showed that the efficiency of HBG site indel was low below 0.5μM of RNP complex, which did not meet the treatment requirements, while the efficiency of indel was higher above 1μM of RNP complex, so 2μM RNP complex was used for testing). The difference between T1-T10 and T0 is that electroporation uses a mixture of 2.6 μM ssODN and 2 μM RNP complex. The ssODNs used in T1-T10 (with three replicates) are ssODN1 to ssODN10 respectively (details in Table 2), i.e., T1 uses ssODN1, T2 uses ssODN2, T3 uses ssODN3, and so on. The lengths of ssODN1 to ssODN10 are 180 nt, 160 nt, 140 nt, 120 nt, 100 nt, 80 nt, 83 nt, 81 nt, 70 nt, and 60 nt respectively (tests showed that ssODN lengths in the range of 60 nt-180 nt had no significant difference in the effect on the Indel frequency of HBG sites). Two days after pre-stimulation (WT) or three days after electroporation (T0, T1-T10), genomic DNA was extracted, and the 4.9kb deletion frequency between HBG1 and HBG2 was determined by droplet digital PCR (ddPCR).

[0083] The 4.9kb deletion frequency between HBG1 and HBG2 is shown in Table 3 and Figure 1The results showed that the length of the homologous arm of ssODN affects the 4.9kb deletion frequency between HBG1 and HBG2. When the lengths of the 5′ and 3′ homologous arms of ssODN are within the range of 30-60 nt, the 4.9kb deletion frequency between HBG1 and HBG2 is significantly lower than that of T0 (control group) and T1, T2, and T3, with the 4.9kb deletion frequency between HBG1 and HBG2 being less than 30%. When the lengths of the 5′ and 3′ homologous arms of ssODN are 40 nt, the 4.9kb deletion frequency between HBG1 and HBG2 is below 10%, further reducing the 4.9kb deletion frequency between HBG1 and HBG2 compared to T0-T4. When the lengths of the 5′ and 3′ homologous arms of ssODN are further shortened from 40 nt, the 4.9kb deletion frequency between HBG1 and HBG2 shows an increasing trend. In summary, when the lengths of the 5′ and 3′ homologous arms of ssODN are within the range of 30-60 nt, the 4.9 kb deletion frequency between HBG1 and HBG2 can be kept at a low level while ensuring the efficiency of HBG site indel.

[0084] Table 2. SSODN sequence information used in Example 1

[0085]

[0086]

[0087]

[0088] In Table 2, underlines (straight lines) represent 5′ homologous arms, and underlines (wavy lines) represent 3′ homologous arms.

[0089] Table 3. Frequency of 4.9kb deletion between HBG1 and HBG2 in each group of Example 1

[0090]

[0091]

[0092]

[0093] Example 2

[0094] This embodiment aims to study the effect of the ratio of ssODN to RNP on the 4.9kb deletion frequency between HBG1 and HBG2 (ddPCR detection).

[0095] Cas9 protein (SpCas9) and sgRNA (SEQ ID NO: 15) were mixed and incubated at a molar ratio of sgRNA to Cas9 of 3 to form an RNP complex. The experiment was divided into 8 groups. Control group 1 (WT) pre-stimulated mPB CD34+ cells with human cytokines from X-Vivo-10 for 2 days without electroporation. Control group 2 (T0) pre-stimulated mPB CD34+ cells with human cytokines from X-Vivo-10 for 2 days, followed by electroporation with 2 μM of the RNP complex. The difference between T1-T6 and T0 was that electroporation was performed using a mixture of ssODN6 and the RNP complex. In T1-T6 (with 3 replicates), the molar ratio of ssODN to RNP complex was 0.5, 0.8, 1, 1.3, 1.5, and 2, respectively. That is, the molar ratio of ssODN to RNP complex was 0.5 in T1, 0.8 in T2, and so on. Three days after electroporation, genomic DNA was extracted, and the 4.9 kb deletion frequency between HBG1 and HBG2 was determined by droplet digital PCR (ddPCR).

[0096] The 4.9kb deletion frequency results between HBG1 and HBG2 are shown in Table 4 and Figure 2 The results showed that the ratio of ssODN to RNP affected the 4.9kb deletion frequency between HBG1 and HBG2. When the molar ratio of the ssODN to RNP complex was in the range of 0.8-2, the 4.9kb deletion frequency between HBG1 and HBG2 was significantly lower than that in T0 (control group) and T1, with the 4.9kb deletion frequency between HBG1 and HBG2 being less than 30%. When the molar ratio of the ssODN to RNP complex was in the range of 1.3-2, the 4.9kb deletion frequency between HBG1 and HBG2 was less than 10%, further reducing the 4.9kb deletion frequency between HBG1 and HBG2 compared to T0-T3.

[0097] Table 4. Frequency of 4.9kb deletion between HBG1 and HBG2 in each group of Example 2

[0098]

[0099]

[0100] Example 3

[0101] In this embodiment, ONT (Oxford Nanopore Technologies) was used to detect the 4.9kb deletion frequency between HBG1 and HBG2 in the genomic DNA after electroporation of a mixture of 2.6μM ssODN and 2μM RNP complex in Examples 1 (T6, T7, and T8). The only difference from Example 1 is that the ddPCR detection method was replaced with ONT technology.

[0102] Edited cell samples were obtained and genomic DNA was extracted according to the method described in Example 1. The extracted DNA was subjected to agarose gel electrophoresis for quality control to confirm its integrity met the requirements (clear main band, no obvious degradation). The quality-controlled DNA samples were then used to construct ONT long-read sequencing libraries, a process that included standard steps such as DNA fragment end repair, adapter ligation, and motor protein loading. The prepared libraries were loaded into the ONT sequencer for high-throughput sequencing. The key advantage of choosing ONT technology lies in its ultra-long read length (the median measured read length is >50 kb, far exceeding the target deletion fragment of 4.9 kb) and single-molecule real-time analysis capability, making it particularly suitable for the accurate detection of large fragment deletion events. This technology can directly cross potential deletion breakpoint regions, and a single read sequence can completely cover and clearly distinguish the location and length of the deletion breakpoint, effectively avoiding the limitations of short-read sequencing technologies that cannot cross large fragment deletion regions due to their short read length and require complex bioinformatics inference.

[0103] After base identification and sequence alignment of the obtained long-read sequencing data, targeted analysis was performed, focusing on the sequence coverage of the HBG promoter editing site and its upstream and downstream regions, in order to screen for the existence of a specific fragment deletion of expected size 4.9kb.

[0104] Data analysis results show that in the RNP-edited samples, the sequence types at the target editing sites of the sample groups with added ssODN6, ssODN7 or ssODN8 are similar to those of the control group 1 (WT), that is, no specific fragment deletion of the expected size of 4.9kb was detected in the edited sample groups.

[0105] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for reducing large fragment deletions in cellular gene editing, characterized in that, The method includes: The gene editing system was introduced into cells to edit the promoter region of the γ-globin gene, in order to reduce large fragment deletions in the HBG gene; The gene editing system includes a Cas nuclease, gRNA, and ssODN, wherein the ssODN contains a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm, and the lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 30–60 nt; The γ-globin gene promoter region is selected from one or more of the following: Between -92 and -66 for HBG1 and HBG2 promoters, between -129 and -98 for HBG1 and HBG2 promoters, between -175 and -153 for HBG1 and HBG2 promoters, between -192 and -160 for HBG1 promoters, between -428 and -406 for HBG2 promoters, and between -432 and -410 for HBG2 promoters; The gRNA has a guide sequence, which is selected from any one or more sequences shown in SEQ ID NO:6 to SEQ ID NO:13; When the γ-globin gene promoter region is selected from between -129 and -98 of the HBG1 and HBG2 promoters, the ssODN is selected from any one or more of the sequences shown in SEQ ID NO:19 to SEQ ID NO:

25.

2. The method according to claim 1, characterized in that, The lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 35~50 nt.

3. The method according to claim 1 or 2, characterized in that, The lengths of the 5′ homologous arm and the 3′ homologous arm are each independently 35nt, 36nt, 37nt, 38nt, 39nt, 40nt, 41nt, 42nt, 43nt, 44nt, 45nt, 46nt, 47nt, 48nt, 49nt, or 50nt.

4. The method according to claim 1, characterized in that, The replacement sequence length of the ssODN is 0~5 nt.

5. The method according to claim 1, characterized in that, The 5' end of the 5' homologous arm and / or the 3' end of the 3' homologous arm are modified with thiophosphate.

6. The method according to claim 1, characterized in that, The cells are hematopoietic stem / progenitor cells, induced pluripotent stem cells, and / or erythroid progenitor cells.

7. The method according to claim 1, characterized in that, The gene editing system introduces the gene into the cells via electroporation; The Cas nuclease and gRNA form an RNP complex, and the molar ratio of ssODN to the RNP complex is 0.8~2.

8. The method according to claim 7, characterized in that, The molar ratio of ssODN to the RNP complex is 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or 2.

9. The method according to claim 1, characterized in that, The Cas nuclease is selected from Cas9 and / or Cas12; The Cas9 is selected from SpCas9, SaCas9, NmCas9, StCas9, St3Cas9, TdCas9, or their functional variants; The Cas12 is selected from Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, C2c5, C2c8, C2c9, or functional variants thereof.

Images