Method for enzymatic cyclization of threose nucleic acid

Abstract

The invention discloses a method for enzymatic cyclization of threose nucleic acid. The method comprises the following operation steps: connecting 5 '-terminal monophosphate of DNA with 2'-terminal hydroxyl of TNA in an intramolecular manner by using CircLigase to complete cyclization of a single chain; the generation of a circular DNA-TNA product is confirmed by exonuclease in combination with mass spectrometry; 5 '-terminal monophosphate and 2'-terminal hydroxyl sequences with 16 different base combinations are prepared, the universality of cyclized connection of TNA is evaluated, and the accurate requirements of the sequences for connection site bases are defined; the cyclization efficiency of the CircLigase on a TNA single chain containing a single DNA nucleotide fragment and a DNA oligonucleotide fragment is tested; the cyclic TNA containing single DNA nucleotide can effectively resist degradation of S1 endonuclease and maintain the cyclic structure of the S1 endonuclease. According to the invention, not only is the universality of the method to different sequences tested, but also the influence of endonuclease on the stability of the cyclized TNA is explored, so that the types of tool enzymes for operating the TNA are enriched, and the optimization of the molecular performance of the functional TNA and the expansion of the application field of the TNA are facilitated.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of nucleic acid technology and application of unnatural nucleic acid, and relates to a method for enzymatic circularization of threose nucleic acid (i.e., a method for circularizing a single strand of TNA by enzymatic means); more specifically, it relates to a method for circularizing a single strand of unnatural nucleic acid by connecting a 5' terminal monophosphate of DNA with a 2' terminal hydroxyl of TNA to form a phosphodiester bond using CircLigase. BACKGROUND

[0002] In recent years, circular natural nucleic acids have attracted widespread attention in biological research. Due to their unique circular structure, they exhibit significant advantages in stability and functional diversity, which makes them have great application potential in the fields of drug delivery, targeted therapy and biosensing.

[0003] Similarly, unnatural nucleic acids can also be circularized to test the effect of circularization on the function of unnatural nucleic acids. Among a series of unnatural nucleic acids, threose nucleic acid (TNA) is an unnatural nucleic acid based on alpha-L-threofuranose units connected by 3', 2'-phosphodiester bonds. Its repeating unit has one less carbon atom than that of natural nucleic acid. Compared with natural nucleic acid, TNA has good biological stability and is more resistant to nuclease degradation. Through the continuous in-depth research of scientists on TNA in recent years, a variety of TNA molecules with different functions have been developed, including TNA aptamers with binding ability and TNA enzymes with catalytic activity; the function of TNA molecular tools can be regulated by circularization strategy. By circularizing these TNA functional molecules, the application field of TNA can be further expanded. However, the current research on the circularization of unnatural nucleic acid TNA is relatively blank, and there is no reported method for circularizing TNA. SUMMARY

[0004] The purpose of the present application is to provide a method for enzymatic circularization of threose nucleic acid by connecting a 5' terminal monophosphate of DNA with a 2' terminal hydroxyl of TNA to form a phosphodiester bond using CircLigase.

[0005] The technical solution of the present application is: the method for enzymatic circularization of threose nucleic acid according to the present application comprises the following steps: Step (1) connecting a 5' terminal monophosphate of DNA-TNA chimeric single strand with a 2' terminal hydroxyl to realize single strand circularization using CircLigase; Step (2) linear and circular DNA-TNA chimeric single strands after the reaction were treated with Exonuclease VII, and the degradation of each group of single strands was compared to identify that the product after the circularization was resistant to exonuclease degradation, and then based on mass spectrometry, the occurrence of the circularization reaction was further identified; Step (3) CircLigase had preference for DNA-TNA single strand ends, and the efficiency was the highest when the 5' end of DNA was G base and the 2' end of TNA was A base; Step (4) The circularization efficiency and resistance to endonuclease degradation of TNA single strands containing a single DNA nucleotide and DNA oligonucleotide fragments were compared; Step (5) For TNA single strands of different lengths containing a single DNA nucleotide, the relative electrophoretic migration rate of circular and linear single strands was affected by the length of the chain, and the 45 nt band was coincident with the linear band.

[0006] Further, step (1) is to use CircLigase to connect the 5' terminal monophosphate and 2' terminal hydroxyl in the DNA-TNA chimeric single strand to form a phosphodiester bond, thereby realizing single strand circularization; Specifically: using CircLigase, the DNA-TNA chimeric single strand with 5' terminal monophosphate was used as a substrate for circularization reaction, and PAGE gel electrophoresis results showed that a new band appeared above the original linear single strand band, which was preliminarily judged to be the circularization product.

[0007] Further, step (2) is to treat linear and circular DNA-TNA chimeric single strands with Exonuclease VII, compare the degradation of each group of single strands, identify that the circularization product will not be degraded by exonuclease, while the DNA part of the linear single strand will be degraded by exonuclease, and the mass spectrometry of the products before and after circularization is verified, and it is identified that the molecular weight of the product after circularization is reduced by one water molecule compared with that before circularization, further confirming that the single strand is circularized.

[0008] Further, specifically: after purification of the DNA-TNA chimeric single strand before and after circularization, three samples of the same concentration were taken, respectively added with sterile water, Exonuclease VII and its reaction buffer, and after 37℃ reaction for 30 min, 85℃ heating for 15 min to inactivate the enzyme to terminate the reaction; The occurrence of the reaction was evaluated by denaturing polyacrylamide gel electrophoresis and nucleic acid dye staining, and it was identified that the DNA-TNA chimeric single strand before circularization was degraded by Exo VII, the original linear single strand band became light, and a new band appeared below, while the DNA-TNA chimeric single strand after circularization was not degraded; In addition, mass spectrometry analysis of the purified DNA-TNA chimeric single strands before and after cyclization identified that the molecular weight of the sample after cyclization was one molecule of water less than that of the sample before cyclization, further confirming the cyclization of TNA.

[0009] Further, the step (3) is to use CircLigase to cyclize single strands with different base combinations at the ligation site, and it is identified that after 12 h of reaction, eight combinations can be mostly cyclized (> 50%), five combinations can be partially cyclized (10%-50%), and three combinations can hardly be cyclized (< 10%), and the efficiency is the highest when the 5' end is G base and the 2' end is A base, and can be cyclized by 93% after 12 h of reaction at 55°C.

[0010] Further, specifically: first, 16 DNA-TNA chimeric single strands with different end base combinations are prepared, which have a single phosphate modification at the 5' end and a Cy5.5 fluorophore modified at a specific T base of DNA; Then, for each combination of DNA-TNA chimeric single strands, an equal amount of nucleic acid chains is added to CircLigase, Reaction buffer, ATP, and MnCl2, and reacted at 55°C for 12 h; The cyclization efficiency of different sequences is determined by denaturing polyacrylamide gel electrophoresis and fluorescence imaging system, and it is identified that CircLigase has preference for single strand end base; among them, the efficiency is the highest when the 5' end is G base and the 2' end is A base, and can be cyclized by 93% after 12 h of reaction.

[0011] Further, the step (4) is that compared with TNA single strands containing DNA oligonucleotide fragments with the same sequence, TNA single strands containing a single DNA nucleotide maintain similar cyclization efficiency and can be efficiently cyclized after 12 h.

[0012] Further, specifically: first, DNA-TNA versions with different backbone compositions and TNA versions containing a single DNA nucleotide are prepared, and the 5' end and 2' end of the two sequences are A base and consistent with the sequence in step (3); for TNA single strands containing a single DNA nucleotide and containing DNA oligonucleotide fragments with the same sequence, use CircLigase to perform cyclization reaction, and add an equal amount of nucleic acid chains to CircLigase, Reaction buffer, ATP, and MnCl2, and react at 55°C for different times; the cyclization efficiency is determined by denaturing polyacrylamide gel electrophoresis, and the results show that TNA single strands containing a single DNA nucleotide and containing DNA oligonucleotide fragments are cyclized with similar efficiency; The TNA single strands containing single DNA nucleotides and the DNA oligonucleotide fragments after the circularization are added with endonucleases respectively to react in the corresponding buffer, and it is identified that the TNA strands containing single DNA nucleotides after the circularization can resist the degradation of endonucleases, while the TNA single strands containing DNA oligonucleotide fragments after the circularization cannot resist the degradation of endonucleases.

[0013] Further, the step (5) is that the relative migration rates of the linear sequences and the circularization products of the TNA single strands containing single DNA nucleotides with different lengths in the PAGE gel are different, the band of the circularization product shorter than 45 nt is below the band of the linear single strand, and the band of the circularization product longer than 45 nt is above the band of the linear single strand.

[0014] Further, specifically, the TNA single strands containing single DNA nucleotides with lengths of 20 nt, 30 nt, 40 nt and 80 nt are prepared, the single strands are circularized by using CircLigase, and equal amounts of the nucleic acid strands are added into CircLigase, Reaction buffer, ATP and MnCl2 to react at 55℃ for different time; the results show that the circularization efficiencies of the TNA single strands with different lengths are similar and have no obvious difference, the relative migration rates of the TNA circularization products in the PAGE exist difference compared with the linear single strands with the same length, and the relative positions of the circular and linear bands change at about 45 nt: the circularization products migrate faster below this length, and the circularization products migrate slower above this length.

[0015] Beneficial effects: Compared with the prior art, the present application has the following remarkable advantages: the CircLigase is used to realize the circularization of non-natural nucleic acid TNA, the Exonuclease VII is used to process the single-stranded DNA-TNA after the circularization, the degradation of the single-stranded in each group is compared, it is found that the product after the circularization can resist the degradation of the exonuclease, and the mass spectrum results prove that the DNA-TNA single strand is circularized; the substrate universality of the method is evaluated, it is identified that the CircLigase has preference for the end base of the TNA single strand, and the efficiency is the highest when the 5' end is G base and the 2' end is A base; the circularization efficiency of the TNA single strand containing a single and a DNA oligonucleotide fragment with the same sequence is compared, even if the overall nucleic acid skeleton is replaced by TNA after the DNA, the sequence can still be circularized with high efficiency; the relative migration rate of the circular product of the TNA sequence containing a single DNA nucleotide and the linear sequence in PAGE presents inversion with the increase of the length, about 45 nt is the critical point, when the length is less than the critical point, the circular product migrates faster, when the length is greater than the critical point, the circular product migrates slower, and the migration rates of the two are similar near the critical point; the circular TNA containing a single DNA nucleotide can effectively resist the degradation of the endonuclease and maintain its circular structure, and exhibits excellent biological stability; the present application provides a strategy with good application prospect for the nucleic acid technology and the application field of non-natural nucleic acid, especially the enzyme method of circularizing TNA to expand the application field of TNA. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 is the operation flowchart of the present application; Figure 2 is the result schematic diagram of the CircLigase circularization and connection of threose nucleic acid sequence of the present application; Figure 3 is the circularization efficiency schematic diagram of the CircLigase circularization and connection of the DNA-TNA chimeric sequence with 16 different base combinations in example 1 of the present application; Figure 4 is the circularization efficiency schematic diagram of the TNA sequence containing a single DNA nucleotide and the TNA single strand containing a DNA oligonucleotide fragment at different time points in example 2 of the present application; Figure 5 is the schematic diagram of the TNA sequence containing a single DNA nucleotide and the TNA sequence containing a DNA oligonucleotide fragment after the circularization, and the anti-S1 endonuclease degradation test schematic diagram of the endonuclease treatment in example 3 of the present application. DETAILED DESCRIPTION

[0017] The specific technical solutions of the present application will be further described in detail in combination with specific examples.

[0018] Example 1 As shown in the figure, it identifies the circularization efficiency of CircLigase on DNA-TNA chimeric sequences with 16 different base combinations 1. Sequences used for synthesis; single-stranded DNA primer with monophosphate and fluorophore double modification: 5'-pNTTTG / iCY5.5dT / GAGTAATTGTTATT-3'; single-stranded DNA template: 5'-NACTTAACTATACCAATCCTAATCTCAGAGACTCTACTCAATAACAATTACTCACAAAC-3', "N" represents A, T, G or C; 2. Phosphorylated DNA-TNA chimeric single strands are prepared by extension reaction using TNA polymerase and four TNA triphosphate monomers; 3. The DNA-TNA chimeric single strands obtained above are evenly divided into several portions, each containing 1 pmol of DNA-TNA chimeric single strands, and incubated at 55°C for 12 h in a suitable reaction system; the reaction system contains 0.05 μM DNA-TNA chimeric single strands, 2.5 mM MnCl2, 0.05 mM ATP, 1x CircLigase reaction buffer (30 mM Tris-acetate, pH 7.5, 60 mM potassium acetate, 1 mM DTT), 0.05 mg / mL CircLigase. Then add 2 times the volume of stop buffer (7 M urea in 1x TBE); 4. Each group of samples is characterized using 12% denaturing polyacrylamide gel electrophoresis, and after electrophoresis at a constant power of 100 W for 1 h, imaging is performed using an Odyssey CLx dual-color infrared laser imaging system (700 nm excitation channel) and the fluorescence intensity of the bands is measured, and the circularization efficiency is quantified by the ratio of the fluorescence intensity of the circularized single-stranded band to the fluorescence intensity of the circularized plus linear single-stranded band; 5. A column chart of the circularization efficiency of 16 DNA-TNA chimeric single strands with different end base combinations is drawn to evaluate the circularization preference of CircLigase for different end base combinations; 6. Finally, it is identified that the 2' end TNA base has a greater impact on the DNA base with 5' end monophosphate modification; the preference order of CircLigase for 2' end TNA base is A>G>T>C, and the preference order of 5' end DNA base is G>A≈T≈C; the combination with the highest circularization efficiency is TNA 2'-OH (X) end A and DNA 5'-p (Y) end G.

[0019] Example 2 As shown in the figure, it compares the circularization efficiency of TNA single strands containing a single DNA nucleotide and DNA oligonucleotide fragments 1. Sequences used in synthesis: DNA primer containing single DNA nucleotide TNA single strand: 5'-GTAGTGGGTATAGTGTA-3'; DNA template containing single DNA nucleotide TNA single strand: 5'- TACTTAACTATACCAATCCTAATCTCAGAGACTCTACTCAATAACAATTACTCACAAATACACTATACCCACTAC-3'; DNA primer containing DNA oligonucleotide fragment TNA single strand: 5'-pATTTGTGAGTAATTGTTATT-3'; DNA template containing DNA oligonucleotide fragment TNA single strand: 5'-TACTTAACTATACCAATCCTAATCTCAGAGACTCTACTCAATAACAATTACTCACAAAC-3'; 2. TNA polymerase and four TNA triphosphate monomers were used to perform TNA extension reaction at the 3' end of single-stranded DNA to obtain DNA-TNA chimeric single strands; for the preparation of TNA single strand containing a single DNA nucleotide, SVPDE enzyme and corresponding buffer were added for reaction at 37°C to degrade the DNA part; 3. The TNA single strand containing DNA oligonucleotide fragment and the TNA single strand containing a single DNA nucleotide obtained above were equally divided into several portions, each containing 1 pmol of single strand, and incubated at 55°C for different times in a suitable reaction system; the reaction system contained 0.5 μM single strand, 2.5 mM MnCl2, 0.05 mM ATP, 1x CircLigase reaction buffer (30 mM Tris-acetate, pH 7.5, 60 mM potassium acetate, 1 mM DTT), 0.05 mg / mL CircLigase; then 2 volumes of termination buffer (7 M urea dissolved in 1x TBE) were added; 4. Each group of samples was characterized using 12% denaturing polyacrylamide gel electrophoresis, and after electrophoresis at a constant power of 100 W for 1 h, the circularization efficiency was quantified using the ratio of circular single strand band intensity to linear single strand band intensity; 5. The curves of the circularization efficiency of the two groups of single strands with time were drawn to evaluate the circularization efficiency of CircLigase on TNA single strands containing a single DNA nucleotide and containing DNA oligonucleotide fragments; 6. Finally, it was identified that TNA single strands containing a single DNA nucleotide and TNA single strands containing DNA oligonucleotide fragments were circularized at similar efficiencies.

[0020] Example 3 As shown in the figure, the anti-endonuclease degradation of TNA single strands containing DNA oligonucleotide fragments and TNA single strands containing a single DNA nucleotide after circularization was observed 1. The single-stranded DNA-containing oligonucleotide fragment TNA and the single-stranded TNA containing a single DNA nucleotide obtained above were circularized using CircLigase, and incubated at 55°C for 12 h in a suitable reaction system; the reaction system contained 0.5 μM single-stranded, 2.5 mM MnCl2, 0.05 mM ATP, 1× CircLigase reaction buffer (30 mM Tris-acetic acid, pH 7.5, 60 mM potassium acetate, 1 mM DTT), 0.05 mg / mL CircLigase; after the corresponding circularization product was purified, the circularized single-stranded TNA containing a single DNA nucleotide and the single-stranded TNA containing a DNA oligonucleotide fragment were obtained; 2. The circularized single-stranded TNA containing a single DNA nucleotide and the single-stranded TNA containing a DNA oligonucleotide fragment prepared above were divided into several portions, each containing 20 pmol of circularized single-stranded; S1 endonuclease and the corresponding reaction buffer were added, respectively, and after 37°C reaction for 30 min, 85°C heating for 15 min was performed to inactivate S1 to terminate the reaction; 3. Each group of samples was characterized using 12% denaturing polyacrylamide gel electrophoresis, and after electrophoresis at a constant power of 100 W for 1 h, nucleic acid dye was used for staining to identify the occurrence of the reaction; 4. Finally, it was identified that the circularized single-stranded TNA containing a single DNA nucleotide could resist S1 endonuclease degradation, while the circularized single-stranded TNA containing a DNA oligonucleotide fragment was degraded by S1 endonuclease.

Claims

1. A method for enzymatic cyclization of threonine nucleic acid, characterized in that, Includes the following steps: Step (1) uses CircLigase to link the 5' end monophosphate and the 2' end hydroxyl group of the DNA-TNA chimeric single strand to achieve single-strand cyclization; Step (2) Use Exonuclease VII to treat linear and circularized DNA-TNA chimeric single strands, compare the degradation of each group of single strands, identify that the circularized product is resistant to exonuclease degradation, and then identify the occurrence of the cyclization reaction based on mass spectrometry. Step (3) CircLigase has a preference for the terminal bases of DNA-TNA single strands. The efficiency is highest when the 5' end of DNA is a G base and the 2' end of TNA is an A base. Step (4) Compare the circularization efficiency and resistance to endonuclease degradation of TNA single strands containing single DNA nucleotides and DNA oligonucleotide fragments; Step (5) For TNA single strands of different lengths containing a single DNA nucleotide, the relative electrophoretic migration rate of circular and linear single strands is affected by the strand length. At 45 nt, the circular and linear bands overlap.

2. The method for enzymatic cyclization of threonine nucleic acid according to claim 1, characterized in that, Step (1) involves using CircLigase to link the 5' end monophosphate and the 2' end hydroxyl group in the DNA-TNA chimeric single strand to form a phosphodiester bond, thereby achieving single-strand cyclization. Specifically, using CircLigase, a cyclization reaction was carried out on a DNA-TNA chimeric single strand modified with a 5' end monophosphate as the substrate. PAGE gel electrophoresis results showed that a new band appeared above the original linear single-stranded band, which was identified as the cyclization product.

3. The method for enzymatic cyclization of threonine nucleic acid according to claim 1, characterized in that, Step (2) involves treating linear and circularized DNA-TNA chimeric single strands with Exonuclease VII, comparing the degradation of each group of single strands, and identifying that the circularized product is not degraded by exonuclease, while the DNA portion of the linear single strand is degraded by exonuclease. Mass spectrometry is used to verify the products before and after circularization, and it is found that the molecular weight of the product after circularization is reduced by one water molecule compared with that before circularization, thus confirming that the single strand is circularized.

4. The method for enzymatic cyclization of threonine nucleic acid according to claim 3, characterized in that, Specifically: First, after purifying the DNA-TNA chimeric single strands before and after circularization, take three portions of the same concentration and add sterile water, Exonuclease VII and its reaction buffer to each portion. After reacting at 37°C for 30 min, heat at 85°C for 15 min to inactivate the enzyme and terminate the reaction. Then, the occurrence of the reaction was assessed by denaturing polyacrylamide gel electrophoresis and nucleic acid dye staining. It was found that the uncirculated DNA-TNA chimeric single strands were degraded by Exo VII, the original linear single strand bands became lighter and new bands appeared below, and the circularized DNA-TNA chimeric single strands were not degraded. In addition, mass spectrometry analysis of the purified, uncirculated, and circulated DNA-TNA chimeric single strands revealed that the circulated sample had a molecular weight that was one water molecule smaller than the uncirculated sample, thus confirming the circulation of TNA.

5. The method for enzymatic cyclization of threonine according to claim 1, characterized in that, Step (3) involves using CircLigase to cyclize single strands with different bases at the linkage sites. After 12 hours of reaction, it was found that most of the eight combinations cyclized, five combinations cyclized only a small portion, and three combinations did not cyclize. The highest efficiency was achieved when the 5' end was a G base and the 2' end was an A base. After 12 hours of reaction at 55°C, 93% of the strands cyclized.

6. The method for enzymatic cyclization of threonine according to claim 5, characterized in that, Specifically, firstly, 16 DNA-TNA chimeric single strands with different terminal base combinations were prepared, each with a 5' end modified with a monophosphate, and a Cy5.5 fluorophore was modified on a specific T base of the DNA. Then, for each combination of DNA-TNA chimeric single strands, equal amounts of nucleic acid strands were added to CircLigase, Reaction buffer, ATP, and MnCl2, respectively, and reacted at 55°C for 12 h. Finally, the cyclization efficiency of different sequences was determined by denaturing polyacrylamide gel electrophoresis and fluorescence imaging system, and it was found that CircLigase has a preference for the terminal bases of single strands; among them, the efficiency was the highest when the 5' end was a G base and the 2' end was an A base, with cyclization of 93% after 12 h of reaction.

7. The method for enzymatic cyclization of threonine nucleic acid according to claim 1, characterized in that, Step (4) is that, compared with TNA single strands that have the same sequence but contain DNA oligonucleotide fragments, TNA single strands containing a single DNA nucleotide maintain circularization efficiency and are all highly efficient circularized after 12 hours.

8. The method for enzymatic cyclization of threonine according to claim 7, characterized in that, Specifically: First, prepare single-stranded TNA versions with the same sequence but different backbone compositions and TNA versions containing a single DNA nucleotide. Both sequences have A bases at the 5' and 2' ends and are consistent with the sequence in step (3). For TNA single-stranded TNAs with the same sequence containing a single DNA nucleotide and TNA oligonucleotide fragments, use CircLigase to perform cyclization reactions. Take equal amounts of nucleic acid strands and add CircLigase, reaction buffer, ATP, and MnCl2 respectively. React at 55°C for different times. Circulation efficiency is determined by denaturing polyacrylamide gel electrophoresis. Then, nucleases were added to the circularized TNA single strands containing single DNA nucleotides and those containing DNA oligonucleotide fragments, respectively, and they were reacted in the corresponding buffers. It was found that the circularized TNA single strands containing single DNA nucleotides were resistant to endonuclease degradation, while the circularized TNA single strands containing DNA oligonucleotide fragments were not resistant to endonuclease degradation.

9. The method for enzymatic cyclization of threonine according to claim 1, characterized in that, Step (5) involves the fact that for TNA single strands containing a single DNA nucleotide of different lengths, the relative migration rates of the linear sequence and its circularized product in the PAGE gel are different. The circularized product band shorter than 45 nt is below the linear single strand band, and the circularized product band longer than 45 nt is above the linear single strand band.

10. The method for enzymatic cyclization of threonine according to claim 9, characterized in that, Specifically, TNA single strands containing a single DNA nucleotide with lengths of 20 nt, 30 nt, 40 nt, and 80 nt were prepared. These single strands were then cyclized using CircLigase. Equal amounts of nucleic acid strands were added to CircLigase, reaction buffer, ATP, and MnCl2, respectively, and reacted at 55°C for different times. The results showed that the cyclization efficiency of TNA single strands of different lengths was the same.

Images