Single-stranded nucleic acids and their uses
By targeting and stabilizing RCM sites in pre-mRNA with synthetic nucleic acids, the method enhances circular RNA biosynthesis, addressing clinical and immunogenicity challenges and facilitating therapeutic applications.
Patent Information
- Application Number
- JP2023014938
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-02-02
- Publication Date
- 2026-04-22
AI Technical Summary
Existing methods for enhancing circular RNA expression in cells face challenges, including high clinical hurdles for gene therapy and immunogenicity issues with extracellularly produced circular RNAs, necessitating a novel approach to promote intracellular biosynthesis.
Designing synthetic nucleic acids that target and bind to the reverse complementary match (RCM) sites in pre-mRNA, stabilizing double-strand formation to enhance circular RNA biosynthesis, using complementary sequences to regions near the RCM.
The synthetic nucleic acids promote a concentration-dependent increase in circular RNA biosynthesis, enabling controlled synthesis and potential therapeutic applications for disease-related circular RNAs, including cancer, and providing tools for elucidating their functions.
Smart Images

Figure 2026068029000007 
Figure 2026068029000008 
Figure 2026068029000009
Abstract
Description
[Technical Field]
[0001] This invention relates to a novel single-stranded nucleic acid having a specific structure, as well as an expression enhancer for circular RNA and a method for enhancing circular RNA expression using the single-stranded nucleic acid. [Background technology]
[0002] Circular RNA is a single-stranded RNA with a circular structure that is biosynthesized from pre-mRNA through a special splicing method called "backsplicing." It is one of the functional non-coding RNAs (ncRNAs) that have recently attracted attention as drug targets. Changes in the amount of circular RNA biosynthesis have been reported to be strongly associated with various cancers such as stem cell cancer and breast cancer, central nervous system diseases such as Alzheimer's and Parkinson's disease, and cardiovascular diseases such as myocardial infarction and neofibroma, and interest in circular RNA as a pharmaceutical target is increasing (Non-patent documents 1 and 2).
[0003] Conventional techniques for increasing circular RNA within cells can be broadly classified into two types: (1) administering a plasmid capable of producing circular RNA into cells using a drug delivery system, etc., and (2) artificially preparing the circular RNA to be increased outside the cell and introducing it into the cell using a drug delivery system, etc.
[0004] The method described in (1) above is commonly used to study the intracellular function of specific circular RNAs (Non-Patent Literature 3). While it is a suitable method for research using cultured cells, introducing plasmids, which are DNA, into cells is equivalent to gene therapy, and the hurdles to applying it to clinical trials are very high.
[0005] Furthermore, regarding (2) above, the method currently widely used for preparing circular RNA extracellularly is the method reported by Anderson et al. (Non-Patent Literature 4). In the method shown in Non-Patent Literature 3, linear RNA with self-splicing introns introduced before and after the sequence to be circularized is synthesized by in vitro transcription (IVT), and circularization is performed by the effect of the self-splicing introns. Cationic liposomes are used to introduce the prepared cells. Although the above method is highly anticipated as a drug discovery method targeting specific circular RNAs, several groups have reported that circular RNAs produced extracellularly may be immunogenic (Non-Patent Literature 5). [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] Z. Yao et al., Mol. Oncol. 2017, 11, 422-437, [Non-Patent Document 2] AT He, et al., Signal Transduct. Target Ther. 2021, 1-14. [Non-Patent Document 3] D. Liang et al., Genes Dev. 2014, 28, 2233-2247. [Non-Patent Document 4] RA Wesselhoeft et al., Nat. Commun. 2018, 9, DOI 10.1038 / s41467-018-05096-6. [Non-Patent Document 5] YG Chen et al., Mol. Cell, 2017, 67, 228-238.e5. [Overview of the project] [Problems that the invention aims to solve]
[0007] The object of the present invention is to provide a single-stranded nucleic acid having a specific structure capable of enhancing the expression of circular RNA. Another object of the present invention is to provide a method for enhancing the expression of circular RNA using the single-stranded nucleic acid. [Means for solving the problem]
[0008] The inventors first focused on the molecular mechanism of "back splicing" that occurs during the maturation of pre-mRNA, and conceived a "technology for increasing circular RNA in cells" that is completely different from the conventional technology described above. Specifically, in the splicing reaction that produces normal mature mRNA, the process begins when the 2' hydroxyl group of adenosine (BPA) at the branch site of an intron attacks the phosphate diester of the 5' splice site (5'ss) within the same intron. In contrast, in back splicing, the hydroxyl group of BPA first attacks the 5'ss of the 3' downstream intron, and the resulting 3' hydroxyl group at the exon terminus attacks the upstream 3'ss, resulting in circular RNA. Here, for back splicing to proceed, it is necessary for the two reaction sites, BPA and the downstream 5'ss, to be in close proximity through the partial double-strand formation of a reverse complementary match (RCM). Based on the backsplicing biosynthesis mechanism described above, we conceived the idea that the presence of a molecular probe that stabilizes double-strand formation between RCMs might promote intracellular biosynthesis of circular RNA.
[0009] Based on the above idea, we conducted research and, surprisingly, discovered that administering synthetic nucleic acids that target and bind to a specific site near the RCM of pre-mRNA to cells can promote the biosynthesis of circular RNA. Based on this finding, we designed synthetic nucleic acids that bind to this specific site near the RCM of pre-mRNA of circCHEK2, a circular RNA associated with tumor growth in various cancers such as breast cancer, hepatocellular carcinoma, gastric cancer, and rectal cancer. When administered to HeLa cells, we confirmed a concentration-dependent increase in circCHEK2 biosynthesis. Based on these findings, the inventors further diligently investigated and completed the present invention.
[0010] In other words, the present invention is as follows. [1] (i) a complementary sequence for a region of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence for a region of at least 5 consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) A complementary sequence for a region of at least 5 consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence for a region of at least 5 consecutive bases from the 5' end of the RCM to 50 bases upstream. Single-stranded nucleic acids, including; [2] The single-stranded nucleic acid described in [1], wherein at least one nucleotide constituting the single-stranded nucleic acid is an artificial nucleic acid; [3] Single-stranded nucleic acids as described in [2], in which all nucleotides constituting the single-stranded nucleic acid are artificial nucleic acids; [4] A single-stranded nucleic acid as described in any one of [1] to [3], wherein the two complementary sequences are linked by a linker; [5] Single-stranded nucleic acids as described in [1], wherein the base length of the single-stranded nucleic acid is 10 to 40 bases; [6] (i) a single-stranded nucleic acid comprising a sequence complementary to a region of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a sequence complementary to a region of at least 5 consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) Single-stranded nucleic acids comprising a complementary sequence to a region consisting of at least 5 consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence to a region consisting of at least 5 consecutive bases from the 5' end of the RCM to 50 bases upstream. Expression enhancers for circular RNA, including; [7] (i) a single-stranded nucleic acid comprising a sequence complementary to a region of at least five consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a sequence complementary to a region of at least five consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) A single-stranded nucleic acid containing a complementary sequence to a region consisting of at least 5 consecutive bases from 50 bases downstream of the 3'-end of RCM and a complementary sequence to a region consisting of at least 5 consecutive bases from 50 bases upstream of the 5'-end of RCM A kit containing; [8] Cells and the following: (i) A single-stranded nucleic acid containing a complementary sequence to a region consisting of at least 5 consecutive bases from 50 bases upstream of the 5'-end of RCM and a complementary sequence to a region consisting of at least 5 consecutive bases from 50 bases downstream of the 3'-end of RCM, and / or (ii) A single-stranded nucleic acid containing a complementary sequence to a region consisting of at least 5 consecutive bases from 50 bases downstream of the 3'-end of RCM and a complementary sequence to a region consisting of at least 5 consecutive bases from 50 bases upstream of the 5'-end of RCM A method for enhancing the expression of circular RNA, comprising contacting with.
Advantages of the Invention
[0011] According to the present invention, it becomes possible to design and manufacture synthetic nucleic acids and the like that can control the synthesis amount of various circular RNAs. In addition, using the manufactured synthetic nucleic acids and the like as a platform, it also becomes possible to develop molecular probes that contribute to elucidating the functions of disease-related circular RNAs. Furthermore, by increasing the biosynthesis amount of circular RNAs involved in diseases with the synthetic nucleic acids and the like, it can also lead to suppressing the onset and exacerbation of diseases.
Brief Description of the Drawings
[0012] [Figure 1]Figure 1 shows specific mutations introduced to generate construct p-GGA and p-UCC expressing pre-mGGA and pre-mUCC, respectively, from the original design p-UAC previously reported by Wilusz et al. (Liang, D. et al., Short Intronic Repeat Sequences Facilitate Circular RNA Production. Genes Dev. 2014, 28 (20), 2233-2247). In Figure 1, the gray arrows indicate the intron sequences RCS1 (left (1-40)) and 2 (right (1000-1035)), respectively, with mutated nucleotides shown in bold and underlined, and the sequence length indicated above each element. In the figure, the arrows indicate the direction of PCR amplification. [Figure 2] Figure 2 shows the complete sequence (SEQ ID NO: 23) of the region encoding the original circZKSCAN1 of p-UAC (top) and the resulting predicted pre-mUAC hairpin structure (bottom). Figure 2 also shows the divergent primer alignment. In the figure, underlined gray bold text indicates the sequence targeted by the ASO. Black highlighting with white bold text indicates the exon 2 region, and gray highlighting with bold text indicates the exon 3 region. Underlined lowercase letters indicate the RCS predicted to form the stem of the hairpin. Single nucleotide differences in exon 3 are shown in underlined black highlighting with white bold text. In the reference genome, it is expected to be T, not C. Introduced mutations are shown in bold black uppercase letters. [Figure 3] Figure 3 shows the complete sequence of the region encoding p-GGA (SEQ ID NO: 24) (top) and the resulting predicted pre-mGGA hairpin structure (bottom). In the figure, underlined gray bold text indicates the sequence targeted by ASO. Black highlighting with white bold text indicates the exon 2 region, and gray highlighting with bold text indicates the exon 3 region. Underlined lowercase letters indicate the RCS predicted to form the stem of the hairpin. Single nucleotide differences in exon 3 are shown in underlined black highlighting with white bold text. In the reference genome, it is expected to be T, not C. Introduced mutations are shown in bold black uppercase letters. [Figure 4] Figure 4 shows the complete sequence of the region encoding p-UCC (SEQ ID NO: 25) (top) and the resulting predicted pre-mUCC hairpin structure (bottom). In the figure, underlined gray bold text indicates the sequence targeted by ASO. Black highlighting with white bold text indicates the exon 2 region, and gray highlighting with bold text indicates the exon 3 region. Underlined lowercase letters indicate the RCS predicted to form the stem of the hairpin. Single nucleotide differences in exon 3 are shown in underlined black highlighting with white bold text. In the reference genome, it is expected to be T, not C. Introduced mutations are shown in bold black uppercase letters. [Figure 5] Figure 5 is a schematic diagram of the design and proposed mechanism of action of ASO1 (A). Figure 5 shows the sequence of ASO1 and the cross-linking structure formed when hybridized (B). RCS is shown in lowercase letters, the ASO1 target sequence is shown in bold gray uppercase letters, and ASO1 is shown in bold uppercase letters. [Figure 6] Figure 6 is a schematic diagram of the process involved in designing a bridging ASO targeting circCHEK2 upregulation. [Figure 7] Figure 7 is a schematic diagram of the ASO4 binding site on CHEK2 pre-mRNA. [Figure 8] Figure 8 shows the results of a test using naphthyridine carbamate dimer (NCD). Compared to using QCD (NCD in which the naphthyridine ring is replaced with a quinoline ring) which does not bind to RCM, using NCD that binds to RCM significantly increased the amount of circular RNA produced (bar graph (left) in Figure 8). On the other hand, when neither NCD nor QCD bound to RCM, no significant difference in the amount of circular RNA produced was observed (bar graph (right) in Figure 8). [Figure 9]Figure 9 shows the results of the study using ASO1. Administration of ASO1, which targets the vicinity of the RCM of pre-mRNA, resulted in a significant increase in circRNA synthesis in both full-match and mismatch cases (two bar graphs in Figure 9). Furthermore, administration of ASO2 and ASO3, which are scramble sequences of ASO1, did not result in any significant changes (two bar graphs in Figure 9). [Figure 10] Figure 10 shows the results of the experiment using ASO4. When ASO4 was administered to HeLa cells, a concentration-dependent increase in circCHEK2 biosynthesis was observed (bar graph in Figure 10). On the other hand, no such increase was observed with scrambled ASO (Scram), in which the ASO4 sequence was randomized (bar graph in Figure 10). [Modes for carrying out the invention]
[0013] 1. Single-stranded nucleic acid This invention relates to the following: (i) a complementary sequence for a region of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence for a region of at least 5 consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) A complementary sequence for a region of at least 5 consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence for a region of at least 5 consecutive bases from the 5' end of the RCM to 50 bases upstream. single-stranded nucleic acids, including To provide.
[0014] In this specification, "circular RNA (circRNA)" is formed during the maturation of pre-mRNA by back-splicing, where splicing proceeds in the reverse direction. Circular RNA is largely generated from exon or intron sequences, and a reverse complementary sequence (hereinafter sometimes abbreviated as "RCM") or an RNA-binding protein is required for circular RNA biosynthesis.
[0015] In this specification, "reverse complementary sequence (RCM)" means a region in pre-mRNA that locally forms a double helix, and the double helix causes the pre-mRNA to form a hairpin structure. In this specification, "proximity of the reverse complementary sequence (RCM)" refers to, for example, the region from the 5' end of the RCM to 50 bases upstream and the region from the 3' end of the RCM to 50 bases downstream, preferably the region from the 5' end of the RCM to 40 bases upstream and the region from the 3' end of the RCM to 40 bases downstream, more preferably the region from the 5' end of the RCM to 30 bases upstream and the region from the 3' end of the RCM to 30 bases downstream, and even more preferably the region from the 5' end of the RCM to 20 bases upstream and the region from the 3' end of the RCM to 20 bases downstream.
[0016] In one embodiment, the single-stranded nucleic acid of the present invention may include, but is not particularly limited, (i) a complementary sequence to a region consisting of at least 5 consecutive bases (or 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 bases, etc.) extending 50 bases (or 40, 30, or 20 bases) upstream from the 5' end of the RCM, and a complementary sequence to a region consisting of at least 5 consecutive bases (or 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 bases, etc.) extending 50 bases (or 40, 30, or 20 bases) downstream from the 3' end of the RCM.
[0017] Furthermore, the single-stranded nucleic acid of the present invention is not particularly limited, but may include (i) a complementary sequence to a region consisting of 30 bases or less (or 25 bases or less, 20 bases or less, 15 bases or less, 10 bases or less, etc.) extending 50 bases (or 40 bases, 30 bases, or 20 bases) upstream from the 5' end of the RCM, and a complementary sequence to a region consisting of 30 bases or less (or 25 bases or less, 20 bases or less, 15 bases or less, 10 bases or less, etc.) extending 50 bases (or 40 bases, 30 bases, or 20 bases) downstream from the 3' end of the RCM.
[0018] Furthermore, the single-stranded nucleic acid of the present invention is not particularly limited, but may include (i) a complementary sequence to a region consisting of 5 to 30 bases (or 5 to 25 bases, 5 to 20 bases, 5 to 15 bases, 10 to 30 bases, 10 to 25 bases, 10 to 20 bases, etc.) extending 50 bases (or 40 bases, 30 bases, or 20 bases) upstream from the 5' end of the RCM, and a complementary sequence to a region consisting of 5 to 30 bases (or 5 to 25 bases, 5 to 20 bases, 5 to 15 bases, 10 to 30 bases, 10 to 25 bases, 10 to 20 bases, etc.) extending 50 bases (or 40 bases, 30 bases, or 20 bases) downstream from the 3' end of the RCM.
[0019] In other embodiments, the single-stranded nucleic acid of the present invention may include, but is not particularly limited, (ii) a complementary sequence to a region consisting of at least 5 consecutive bases (or 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 bases, etc.) from the 3' end of the RCM to 50 bases downstream (or 40, 30, or 20 bases), and a complementary sequence to a region consisting of at least 5 consecutive bases (or 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 bases, etc.) from the 5' end of the RCM to 50 bases upstream (or 40, 30, or 20 bases).
[0020] Furthermore, the single-stranded nucleic acid of the present invention is not particularly limited, but may include (ii) a complementary sequence to a region consisting of 30 bases or less (or 25 bases or less, 20 bases or less, 15 bases or less, 10 bases or less, etc.) consecutively from the 3' end of the RCM to 50 bases downstream (or 40 bases, 30 bases, or 20 bases), and a complementary sequence to a region consisting of 30 bases or less (or 25 bases or less, 20 bases or less, 15 bases or less, 10 bases or less, etc.) consecutively from the 5' end of the RCM to 50 bases upstream (or 40 bases, 30 bases, or 20 bases).
[0021] Furthermore, the single-stranded nucleic acid of the present invention is not particularly limited, but may include (ii) a complementary sequence to a region consisting of 5 to 30 consecutive bases (or 5 to 25 bases, 5 to 20 bases, 5 to 15 bases, 10 to 30 bases, 10 to 25 bases, 10 to 20 bases, etc.) from the 3' end of the RCM to 50 bases downstream (or 40 bases, 30 bases, or 20 bases), and a complementary sequence to a region consisting of 5 to 30 consecutive bases (or 5 to 25 bases, 5 to 20 bases, 5 to 15 bases, 10 to 30 bases, 10 to 25 bases, 10 to 20 bases, etc.) from the 5' end of the RCM to 50 bases upstream (or 40 bases, 30 bases, or 20 bases).
[0022] In other embodiments, the single-stranded nucleic acid of the present invention may include both the complementary sequence described in (i) and the complementary sequence described in (ii).
[0023] In this specification, “nucleic acid” may mean monomeric nucleotides, but usually it means oligonucleotides composed of multiple monomers. Therefore, unless otherwise specified, when referring to monomeric nucleotides, it shall be written as “nucleic acid nucleotide,” and such nucleic acids include, for example, ribonucleic acid, deoxyribonucleic acid, cross-linked nucleic acids, peptide nucleic acids (PNA), and morpholino nucleic acids. In this specification, “artificial nucleic acid” means non-natural nucleotides other than natural nucleotides. Also, unless otherwise specified, when a nucleic acid is an oligonucleotide, each nucleotide residue constituting the nucleic acid (including the 5' and 3' terminal nucleotides) shall be simply referred to as “nucleotide.” Furthermore, in this specification, unless otherwise specified, “nucleic acid chain” and “chain” both mean single-stranded oligonucleotides. Nucleic acid chains can be prepared as full-length or partial chains by chemical synthesis (e.g., using an automated synthesizer) or by enzymatic processes (e.g., polymerase, ligase, or restriction reaction, but not limited to these). In this specification, "antisense oligonucleotide" (hereinafter sometimes abbreviated as "ASO") means a single-stranded nucleic acid that recognizes and binds to a specific site on pre-mRNA.
[0024] The single-stranded nucleic acid of the present invention preferably has at least one nucleotide modified to confer resistance to nucleases such as RNase H, from the viewpoint of stability in cells or in vivo. Such antisense oligonucleotides may consist entirely of non-natural nucleotides, or some of the nucleotides may be non-natural nucleotides (i.e., mixmer-type oligonucleotides). Examples of such non-natural nucleotides include nucleotides having a cross-linking structure (hereinafter sometimes referred to as "bridged nucleotides (BNA)").
[0025] In this specification, "complementary" means a relationship in which nucleic acid bases can form so-called Watson-Crick base pairs (natural base pairs) or non-Watson-Crick base pairs (Hoogsteen base pairs, wobble base pairs, etc.) via hydrogen bonds. Therefore, "complementary sequence" is used to mean not only a sequence that is completely complementary (i.e., hybridizes without mismatches) to the target sequence (e.g., a complementary sequence within a complementary strand, a sequence in a target RNA, etc.), but also a sequence that contains one or more mismatches (e.g., two, three, four, five or more), as long as it can hybridize with the target sequence under stringent conditions or physiological conditions in mammalian cells. In other words, it is permissible for the complementary strand to contain mismatches. For example, examples include sequences that are completely complementary to the target sequence and sequences that have 80% or more (e.g., 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more), most preferably 100%, identity. Furthermore, when the complementary strand is of a specific form such as a PNA strand, the double-stranded nucleic acid can be in a parallel form as well as an antiparallel form. Therefore, the above definition of "complementary" applies not only to the relationships between each nucleic acid strand of an antiparallel double-stranded nucleic acid, but also to the relationships between each nucleic acid strand of a parallel double-stranded nucleic acid.
[0026] Stringent conditions may be either low-stringent or high-stringent conditions. Low-stringent conditions may be relatively low temperature and high salt concentration conditions, for example, 30°C, 2×SSC, 0.1%SDS. High-stringent conditions may be relatively high temperature and low salt concentration conditions, for example, 65°C, 0.1×SSC, 0.1%SDS. The stringency of hybridization can be adjusted by changing conditions such as temperature and salt concentration. Here, 1×SSC contains 150 mM sodium chloride and 15 mM sodium citrate.
[0027] As described above, the single-stranded nucleic acid of the present invention preferably exhibits resistance to nucleases. Nucleases containing RNase H are enzymes that catalyze the hydrolysis reaction of phosphodiester bonds between nucleosides in DNA / RNA heteroduplexes and / or complementary strands forming DNA / DNA heteroduplexes. Furthermore, while the term "exhibiting resistance to nucleases" does not exclude degradation by ribonucleases other than RNase H, from the viewpoint of intracellular stability, it is preferable that the nucleic acid is not hydrolyzed by other ribonucleases, such as RNase A or DNase I.
[0028] To prevent the single-stranded nucleic acid of the present invention from becoming a substrate for nucleases, appropriate measures can be taken, such as making at least one of the nucleotides constituting the single-stranded nucleic acid a non-natural nucleotide, making at least one nucleoside bond of the single-stranded nucleic acid a bond other than a phosphodiester bond, capping the end of the single-stranded nucleic acid by attaching a non-natural molecule, or a combination of these measures. In one embodiment of the present invention, all nucleotides constituting the single-stranded nucleic acid are non-natural nucleotides, or all nucleoside bonds present in the complementary strand are bonds other than phosphodiester bonds. Examples of bonds other than phosphodiester bonds (hereinafter sometimes referred to as "modified nucleoside bonds") include, but are not limited to, phosphorothioate bonds, phosphorodithioate bonds, phosphotriester bonds, methylphosphonate bonds, methylthiophosphonate bonds, boranophosphate bonds, and phosphoramidate bonds. Non-natural nucleotides and modified nucleoside bonds may be used individually or in combination of multiple types.
[0029] In this specification, “non-natural nucleotide” means a nucleotide or nucleotide analog other than a natural nucleotide (i.e., ribonucleotides and deoxyribonucleotides) in which at least one of the components of a natural nucleotide is modified. The components of a nucleotide include a sugar group (e.g., ribose, deoxyribose), a base, and a phosphate group. “Modification” includes, for example, substitution, addition, and / or deletion of the component and / or nucleoside bond, and substitution, addition, and / or deletion of an atom and / or functional group in the component and / or nucleoside bond.
[0030] Examples of natural bases include adenine, cytosine, guanine, thymine, and uracil. Examples of modified bases include, but are not limited to, 5-methylcytosine, 5-fluorocytosine, 5-bromocytosine, 5-iodocytosine, or N4-methylcytosine; N6-methyladenine or 8-bromoadenine; and N2-methylguanine or 8-bromoguanine. The modified base is preferably 5-methylcytosine.
[0031] Modifications of the sugar moiety include, for example, 2'-O-methoxyethyl modification of the sugar moiety, 2'-O-methyl modification of the sugar moiety, 2'-fluoro modification of the sugar moiety, and crosslinking between the 2' and 4' positions of the sugar moiety (nucleotides having this crosslinking structure are BNA). Examples of BNA include locked nucleotides (LNA) and 2'-O,4'-C-ethylene-bridged nucleotides (ENA). More specifically, BNAs have the following nucleoside structure.
[0032] [ka]
[0033] (In the formula, R represents a hydrogen atom, a C1-C7 alkyl group which may be branched or ring-forming, a C2-C7 alkenyl group which may be branched or ring-forming, an aryl group which may contain a heteroatom, an aralkyl group which has an aryl moiety which may contain a heteroatom, or a protecting group for an amino group in nucleic acid synthesis. Preferably, R is a hydrogen atom, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, a phenyl group, or a benzyl group, and more preferably, R is a hydrogen atom or a methyl group. Base is a natural base or a modified base.)
[0034] Examples of nucleotide analogs include peptide nucleotides (PNA), gamma-substituted PNA, or morpholino nucleotides (-N(H)-P(=O)(-NR1R2)-O-[R1 and R2 both represent methyl groups] or morpholino linked by other non-phosphodiester bonds), and boranophosphate nucleotides (-OP(-BH3)(=0)-O-). PNA is a nucleotide analog having a main chain in which N-(2-aminoethyl)glycine is linked by an amide bond instead of sugar, and the structure of PNA, in which all nucleotides (n+2 nucleotides) are PNA nucleotides, is shown below. Chiral units such as amino acids may be introduced to the N-terminus or C-terminus of the PNA chain as appropriate.
[0035] [ka]
[0036] (In the formula, B is either a natural base or a modified base.)
[0037] The morpholino nucleic acid nucleotides are shown below.
[0038] [ka]
[0039] (In the formula, Base is either a natural base or a modified base.)
[0040] The boranophosphate-type nucleic acid nucleotides are shown below.
[0041] [ka]
[0042] (In the formula, Base is either a natural base or a modified base.)
[0043] In one embodiment, the single-stranded nucleic acid of the present invention is a nucleic acid in which all bonds between nucleosides are phosphorothioate bonds and all sugar portions have 2'-O-methyl modifications.
[0044] The single-stranded nucleic acid of the present invention may be indirectly linked via a linker between (i) a complementary sequence to a region consisting of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream of (a) and (b) a complementary sequence to a region consisting of at least 5 consecutive bases from the 3' end of the RCM down to 50 bases downstream of (b) the RCM. Alternatively, the single-stranded nucleic acid of the present invention may be indirectly linked via a linker between (ii) a complementary sequence to a region consisting of at least 5 consecutive bases from the 3' end of the RCM up to 50 bases downstream of (c) and (d) a complementary sequence to a region consisting of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream of (d) the RCM.
[0045] The order of linking is not particularly limited; the 5' end of the complementary sequence of (a) and the 3' end of the complementary sequence of (b) may be linked via a linker, or the 3' end of the complementary sequence of (a) and the 5' end of the complementary sequence of (b). Alternatively, the 5' end of the complementary sequence of (c) and the 3' end of the complementary sequence of (d) may be linked via a linker, or the 3' end of the complementary sequence of (c) and the 5' end of the complementary sequence of (d) may be linked via a linker.
[0046] In the present invention, it is preferable that the "linker" has a structure in which the complementary sequence linked via the linker does not bind to the target pre-mRNA within its own region and does not undergo self-annealing. The material constituting the linker used in the present invention is not particularly limited, as long as the complementary sequences (a) and (b), and similarly the complementary sequences (c) and (d), can be indirectly linked via the linker.
[0047] Specifically, the materials constituting the linker include, for example, the aforementioned natural nucleotides, non-natural nucleotides, natural nucleotides, non-natural nucleosides, or combinations thereof. When the linker contains natural nucleotides, non-natural nucleotides, natural nucleotides, non-natural nucleosides, or combinations thereof, the number included is not particularly limited as long as it does not hinder the enhancement of circular RNA expression by the single-stranded nucleic acid of the present invention, but may be, for example, 1 to 10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, etc.), 1 to 5, 1 to 4, or 1 to 3. In one embodiment, the linker is 3 nt adenosine and single non-base pairing uracil.
[0048] The single-stranded nucleic acid of the present invention, by adopting the above-described structure, can bind to the vicinity of the RCM of pre-mRNA, thereby enhancing the expression of circular RNA.
[0049] The single-stranded nucleic acid of the present invention may have one or more (e.g., 1, 2, 3, 4 or more) functional molecules bound to it. The functional molecules may be bound to the 5' and / or 3' ends of the single-stranded nucleic acid, or to the linker portion. If there are two or more functional molecules, they may be bound to different positions on the single-stranded nucleic acid, or they may be bound in tandem. Furthermore, the binding between the single-stranded nucleic acid and the functional molecules of the present invention may be direct binding or indirect binding mediated by another substance. However, it is preferable that the functional molecules are directly bound to the single-stranded nucleic acid via covalent bonds, ionic bonds, hydrogen bonds, etc., and covalent bonding is more preferable in that it provides a more stable binding. The functional molecules may also be bound to the single-stranded nucleic acid via cleavable linking groups. For example, the functional molecules may be linked via disulfide bonds. Furthermore, only one type of functional molecule may be used, or a combination of multiple types may be used.
[0050] The functional molecules described above are not specifically limited in their structure, as long as they impart a desired function to the single-stranded nucleic acid of the present invention. Desired functions include, for example, labeling, purification, and delivery. Examples of the part that imparts the labeling function include compounds such as fluorescent proteins and luciferases. Examples of the part that imparts the purification function include compounds such as biotin, avidin, His-tagged peptides, GST-tagged peptides, and FLAG-tagged peptides. Furthermore, the functional molecule may change the properties of the double-stranded nucleic acid (for example, its ability to bind to a target sequence) by being bound to the double-stranded nucleic acid.
[0051] In one embodiment, a functional molecule plays a role in enhancing the transport of a target to a cell or cell nucleus, and such a functional molecule is also referred to as a "target-directed molecule" or "drug delivery molecule." For example, it has been shown that certain peptide tags, when conjugated to oligonucleotides, enhance the cellular uptake of oligonucleotides. Therefore, examples of target-directed molecules used in the present invention include, for example, arginine-rich peptides P007 and B peptide disclosed in HaiFang Yin et al., Human Molecular Genetics, Vol. 17(24), 3909-3918 (2008) and its references. Nuclear transport can be enhanced by conjugating a portion such as m3G-CAP (see Pedro MD Moreno et al., Nucleic Acids Res., Vol. 37, 1925-1935 (2009)) to an oligonucleotide. Furthermore, a single target-directed molecule may be used, or multiple types may be used in combination.
[0052] The target-directed molecule may be an amino sugar. Examples of such amino sugars include N-acetylgalactosamine (GalNAc), and more specifically, a GalNAc ligand (GalNAc ligand) having a (2S,4R)-4-Hydroxy-L-prolinol skeleton. hp), GalNAc ligands with a 3-Amino-1,2-propanediol skeleton (GalNAc apd Examples include (Bioorg. Med. Chem, 2016, 24, 26, Nucleos Nucleot Nucl, 2020, 39, 109, Curr Protoc Nucleic Acid Chem, 2019, 78, e99. Nucleic Acid Therapeutics, Doi: 10.1089 / nat.2021.0036). The target-directing molecule may also be a lipid. Examples of such lipids include cholesterol and fatty acids (e.g., vitamin E (tocopherol, tocotrienol), vitamin A, and vitamin D); fat-soluble vitamins such as vitamin K (e.g., acylcarnitine); intermediate metabolites such as acyl-CoA; glycolipids, glycerides, and their derivatives or analogs. Among these, cholesterol or vitamin E (tocopherol and tocotrienol) is preferred from the viewpoint of higher safety. Water-soluble vitamins such as folic acid may also be used. Furthermore, from the viewpoint of being able to deliver nucleic acids to various organs with high specificity and efficiency by binding to various proteins (e.g., receptors) present on the cell surface of various organs, low molecular weight ligands, aptamers, peptides, or proteins (e.g., receptor ligands and antibodies and / or their fragments) are preferred as target-directed molecules.
[0053] Nucleic acids to which the above-mentioned functional molecules are bound can be produced by using nucleic acid species to which the functional molecules are pre-bound, and by performing synthesis, purification, and annealing using known methods. Numerous methods for linking functional molecules to nucleic acids are well known in the art. For example, when using GalNAc as the functional molecule, a GalNAc amidite block can be linked to the nucleic acid by acting according to the phosphoramidite method. GalNAc amidite blocks can be synthesized by methods described in, for example, Curr Protoc Nucleic Acid Chem. 2019, 78, e99. Doi: 10.1002 / cpnc.99. and 2. Nucleic Acid Ther. 2021, in press. Doi: 10.1089 / nat.2021.0036. Alternatively, nucleic acid chains can be ordered from a manufacturer (e.g., Gene Design Co., Ltd.) by specifying the base sequence and modification site or type.
[0054] (2) Uses of the single-stranded nucleic acid of the present invention As described above, the single-stranded nucleic acid of the present invention can bind to the vicinity of the RCM of pre-mRNA, thereby enhancing the expression of circular RNA. Therefore, the single-stranded nucleic acid of the present invention can be used as a composition for enhancing the expression of a target circular RNA (or a circular RNA expression enhancer). The composition of the present invention may be a composition in which the toxicity of the antisense oligonucleotide is reduced (e.g., low hepatotoxicity, low nephrotoxicity). The composition of the present invention may be prepared as a pharmaceutical, cosmetic, or food product and administered orally or parenterally. The composition of the present invention can also be used as a reagent or test agent. The composition of the present invention may be provided as a composition kit containing the single-stranded nucleic acid and reagents in separate compositions, for example, if it contains other reagents.
[0055] Therefore, the present invention is as follows: (i) a single-stranded nucleic acid comprising a complementary sequence to a region of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence to a region of at least 5 consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) Single-stranded nucleic acids comprising a complementary sequence to a region consisting of at least 5 consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence to a region consisting of at least 5 consecutive bases from the 5' end of the RCM to 50 bases upstream. Expression enhancers for circular RNAs To provide.
[0056] Furthermore, the present invention includes the following: (i) a single-stranded nucleic acid comprising a complementary sequence to a region of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence to a region of at least 5 consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) Single-stranded nucleic acids comprising a complementary sequence to a region consisting of at least 5 consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence to a region consisting of at least 5 consecutive bases from the 5' end of the RCM to 50 bases upstream. kit We also offer it.
[0057] The composition (or agent) of the present invention can be administered to a subject, for example, by administering the single-stranded nucleic acid of the present invention alone or together with a pharmacologically acceptable carrier. Examples of subjects include mammals, including humans, and the cells, tissues, and organs of such animals. Therefore, a method for enhancing the expression of circular RNA in a subject, comprising administering the single-stranded nucleic acid of the present invention to the subject, is also provided. This administration may be performed in vivo or in vitro.
[0058] When the target of administration is cells and the administration is performed in vitro, the present invention applies as follows: Cells, and the following: (i) a single-stranded nucleic acid comprising a complementary sequence to a region of at least 5 consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence to a region of at least 5 consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) Single-stranded nucleic acids comprising a complementary sequence to a region consisting of at least 5 consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence to a region consisting of at least 5 consecutive bases from the 5' end of the RCM to 50 bases upstream. A method for enhancing the expression of circular RNA, including contact with To provide.
[0059] Contact between the single-stranded nucleic acid of the present invention and cells can be achieved, for example, by adding the single-stranded nucleic acid to a culture medium capable of culturing the desired cells. The culture medium capable of culturing the desired cells can be appropriately selected.
[0060] To facilitate the introduction of single-stranded nucleic acids into target cells, the composition (or agent) of the present invention may further contain a nucleic acid delivery reagent. Examples of such nucleic acid delivery reagents include calcium chloride, calcium enrichment reagents, atelocollagen, liposomes, nanoparticles, lipofectin, lipofectamine, DOGS (transfectam), DOPE, DOTAP, DDAB, DHDEAB, HDEAB, polyblen, or cationic lipids such as poly(ethyleneimine) (PEI).
[0061] As described above, the single-stranded nucleic acid of the present invention may also be used as a pharmaceutical. Accordingly, pharmaceutical compositions containing the single-stranded nucleic acid of the present invention are also provided. The pharmaceutical compositions of the present invention may be used for the treatment or prevention of diseases, particularly diseases involving a decrease in circular RNA expression (e.g., cancer (specifically, hepatocellular carcinoma (circular RNA: circZKSCAN1) and breast cancer (circular RNA: circTADA2A-E6), etc.), central nervous system diseases (specifically, Alzheimer's disease (circular RNA: CDR1as / ciRS-7), Parkinson's disease (circular RNA: circDLGAP4), etc.), and cardiovascular diseases (specifically, myocardial infarction (circular RNA: circNfix), myocardial fibrosis (circular RNA: circNFIB, circYap), etc.). In the present invention, "treatment" also includes alleviation or improvement of symptoms, prevention, delay or cessation of the progression of disease or symptoms, or the manifestation of symptoms.
[0062] The pharmaceutical composition of the present invention may use an effective amount of the single-stranded nucleic acid of the present invention alone, or it may be formulated with any carrier, such as a pharmacologically acceptable carrier.
[0063] Examples of pharmacologically acceptable carriers include, but are not limited to, excipients such as sucrose and starch, binders such as cellulose and methylcellulose, disintegrants such as starch and carboxymethylcellulose, lubricants such as magnesium stearate and aerosil, fragrances such as citric acid and menthol, preservatives such as sodium benzoate and sodium bisulfite, stabilizers such as citric acid and sodium citrate, suspending agents such as methylcellulose and polyvinylpyrrolide, dispersants such as surfactants, diluents such as water and physiological saline, and base waxes.
[0064] To facilitate the introduction of the single-stranded nucleic acid into target cells, the pharmaceutical composition of the present invention may further contain a nucleic acid delivery reagent. The same nucleic acid delivery reagent as described above can be used.
[0065] Furthermore, the pharmaceutical composition of the present invention may be a pharmaceutical composition in which the single-stranded nucleic acid of the present invention is encapsulated in liposomes. A liposome is a microclosed vesicle having an internal phase surrounded by one or more lipid bilayers, and can usually hold water-soluble substances in the internal phase and lipid-soluble substances in the lipid bilayers. In this specification, when "encapsulated," the complex of the present invention may be held in the internal phase of the liposome or in the lipid bilayers. The liposomes used in the present invention may be monolayers or multilayers, and the particle size can be appropriately selected in the range of, for example, 10 to 1000 nm, preferably 50 to 300 nm. Considering delivery to target tissue, the particle size is, for example, 200 nm or less, preferably 100 nm or less.
[0066] Methods for encapsulating water-soluble compounds such as oligonucleotides into liposomes include the lipid film method (vortex method), reverse-phase evaporation method, surfactant removal method, freeze-thaw method, and remote loading method, but are not limited to these, and any known method can be appropriately selected.
[0067] The pharmaceutical composition of the present invention can be administered orally or parenterally to mammals (e.g., humans, rats, mice, guinea pigs, rabbits, sheep, horses, pigs, cattle, dogs, cattle, monkeys), but parenteral administration is preferred. Therefore, a method for treating or preventing a disease in a mammal is also provided, characterized by administering an effective amount of the complex of the present invention to the mammal.
[0068] Suitable formulations for parenteral administration (e.g., subcutaneous injection, intramuscular injection, intravenous injection, local injection (topical application, topical application), intracerebroventricular administration, intrathecal administration, intraperitoneal administration, etc.) include aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, antibacterial agents, isotonic agents, etc. Also, aqueous and non-aqueous sterile suspensions are examples, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives, etc. These formulations can be sealed in containers in unit doses or multiple doses, such as ampoules or vials. Alternatively, the active ingredient and pharmacologically acceptable carrier can be freeze-dried and stored in a state where they can be dissolved or suspended in a suitable sterile vehicle immediately before use. Another suitable formulation for parenteral administration is a spray.
[0069] The content of the single-stranded nucleic acid of the present invention in the pharmaceutical composition is, for example, about 0.1 to 100% by weight of the total pharmaceutical composition.
[0070] The dosage of the pharmaceutical composition of the present invention varies depending on the purpose of administration, the method of administration, the type and severity of the target disease, and the circumstances of the recipient (sex, age, weight, etc.). For example, when administering systemically to an adult, a single dose of the single-stranded nucleic acid of the present invention is usually between 0.01 mg / kg and 1000 mg / kg, and when administered topically, a dose of between 0.001 mg / body and 100 mg / body is desirable. It is desirable to administer such a dose 1 to 10 times, more preferably 5 to 10 times.
[0071] The pharmaceutical composition of the present invention can be used in combination with, for example, a drug already on the market for treating a disease. These concomitant agents can be formulated together with the pharmaceutical composition of the present invention and administered as a single formulation, or they can be formulated separately from the pharmaceutical composition of the present invention and administered simultaneously or with a time delay, via the same or different route as the pharmaceutical composition of the present invention. Furthermore, the dosage of these concomitant agents may be the amount normally used when the agent is administered alone, or it may be a reduced amount.
[0072] The present invention will be described in detail below with reference to examples, etc., but the present invention is not limited to these. [Examples]
[0073] (Example 1: Test using naphthyridine carbamate dimer (NCD)) 1) General matters Surface plasmon resonance (SPR) measurements were performed using a BIAcore T200 instrument (GE Healthcare). All oligonucleotides were purchased from Invitrogen. The original plasmid construct used in these experiments, pcDNA3.1(+) ZKSCAN1 nt 400-1782 delta440-500 delta1449-1735, was donated by Jeremy Wilusz (Addgene plasmid # 60633; http: / / n2t.net / addgene:60633; RRID:Addgene_60633) (Liang, D. et al., Short Intronic Repeat Sequences Facilitate Circular RNA Production. Genes Dev. 2014, 28 (20), 2233-2247). Plasmid DNA was amplified using Escherichia coli (E. coli) strain DH5α, extracted, and purified using NucleoBond® Xtra Midi EF (Macherey-Nagel). HeLa cells (RIKEN BRC, RCB0007) were used for transfection and maintained at 37°C under 5% CO2 in Dulbecco's modified Eagle medium (Sigma, D6429) supplemented with 10% (v / v) fetal bovine serum (MP Biomedicals) and penicillin-streptomycin (Gibco).
[0074] The compounds described in the paper, NCD and QCD (in which the naphthyridine ring of NCD is substituted with a quinoline ring), were synthesized as previously reported. FuGENE HD™ Transfection Reagent (Promega) was used for plasmid transfection. In the RT-qPCR experiments, cell lysis and reverse transcription were performed using the Superprep™ II cell lysis & RT kit (TAKARA), and real-time PCR (qPCR) experiments were performed using the StepOne real-time PCR system (Applied Biosystem) with GoTaq™ qPCR master mix (Promega). For ribonuclease® (RNase®) treatment, cell lysis and total RNA extraction were performed using ISOGEN (Nippon Gene Co., Ltd.), and RNase® was purchased from Epicenter Technologies. Reverse transcription was performed using ReverTra Ace™ qPCR RT Master Mix with gDNA remover (TOYOBO).
[0075] 2) SPR assay Sensor preparation: For the SPR assay, RNA containing partial intron sequences including 5'-GGA-3' / 5'-GGA-3' and 5'-UCC-3' / 5'-GGA-3' was immobilized on a sensor chip SA (Cytiva) coated with streptavidin. The surface of the sensor chip was first treated with 50 mM NaOH and 1 M NaCl for 60 seconds, using 30 μl min. -1 It was washed three times at this flow rate.
[0076] Next, biotin-labeled RNA, biotin-TEG-5'-GCUGAGAU GGA AGGCGUGAGCUUUUGCUCACACCU GGA AUCCCAGC-3' (SEQ ID NO: 17), and biotin-TEG-5'-GCUGAGAU UCC AGGCGUGAGCUUUUGCUCACACCU GGA AUCCCAGC-3' (with the 5'-GGA-3' / 5'-GGA-3' and 5'-UCC-3' / 5'-GGA-3' regions underlined) (SEQ ID NO: 18) were mixed under the following conditions: 1 μM RNA in 10 mM HEPES, 500 mM NaCl, pH 7.4, 5 μl per 60-second flow. -1 The RNA was immobilized on the surface at the specified flow rate. The amounts of RNA immobilized on the sensor chip SA were 1217 RU and 1075 RU, respectively.
[0077] SPR Analysis Protocol: SPR analysis for the binding of NCD and QCD to the RNA immobilized surface was performed using BIAcore T-200. Subsequently, 0.0625, 0.125, 0.25, 0.5, and 1 μM of each compound were added in HBS-EP+ buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% v / v Surfactant P20, pH 7.4) (Cytiva) at 25°C for 30 μl min. -1 The assay was performed by flowing the solution at a flow rate of 30 μl min for a contact time of 60 seconds. Afterward, the bound compound was dissociated by flowing the running buffer for 120 seconds. Following the assay of each compound, 1.2 mM NaOH, 0.2 M NaCl, and 0.1 mM EDTA solutions were used for a contact time of 180 seconds at a flow rate of 30 μl min. -1 Surface regeneration was performed. The kinetic parameters of NCD and QCD binding to the RNA-immobilized surface were obtained using single-cycle kinetics.
[0078] 3) Preparation of plasmid constructs The desired mutation was introduced into the region encoding the circZKSCAN1-expressing pre-mRNA of the original construct (pcDNA3.1(+)ZKSCAN1 nt 400-1782 delta440-500 delta1449-1735, p-UAC, Figure 2) via PCR mutagenesis. The specific location of the introduced mutation is shown in Figure 1. First, a guanine point mutation was introduced into one of the complementary intron sequences using primers (5'-GTAGCTCACACCTGGAATCCCAGCAGCGG-3') (SEQ ID NO: 11) and (5'-CCGCTGCTGGGATTCCAGGTGTGAGCTAC-3') (SEQ ID NO: 12), along with PfuUltra High-fidelity DNA polymerase (Agilent) (Figure 1, gray arrow 1000-1035 nt region) to generate an intermediate construct. Next, the PCR products were treated with DpnI, transformed into E. coli DH5 cells for amplification, and isolated as described in the general information above.
[0079] Next, additional nucleotide mutations were introduced into intermediate constructs of other complementary intron sequences (Figure 1, gray arrows 1-40 nt region). For the p-GGA plasmid, the primer pairs (5'-GAATTCAAAGTGCTGAGATGGAAGGCGTGAGCCACCACC-3') (SEQ ID NO: 13) and (5'-GGTGGTGGCTCACGCCTTCCATCTCAGCACTTTGAATTC-3') (SEQ ID NO: 14) were used, and for the p-UCC plasmid, the primer pairs (5'-GAATTCAAAGTGCTGAGATTCCAGGCGTGAGCCACCACC-3') (SEQ ID NO: 15) and (5'-GGTGGTGGCTCACGCCTGGAATCTCAGCACTTTGAATTC-3') (SEQ ID NO: 16) were used. Then, each construct was amplified via E. coil DH5 cells and harvested as described above. The final sequences of the regions encoding Pre-mGGA and pre-mUCC are shown in Figures 3 and 4.
[0080] 4) Reverse transcription quantitative PCR (RT-qPCR experiment) HeLa cells, 1 x 10 4 Cells were seeded in a 96-well plate at a cell / well density and incubated for 4 hours to allow the cells to adhere to the bottom of the wells. Next, according to the manufacturer's instructions, the cells were transfected with the previously obtained p-GGA and p-UCC expression plasmids using Fugene HDTM in a ratio (FuGENE:plasmid = 5:2, v / w). After culturing at 37°C and 5% CO2 for 24 hours, the medium was replaced with fresh medium containing NCD or QCD (NCD: 0, 0.5, 1, 3, and 5 μM; QCD: 5 μM), and the cells were cultured for a further 24 hours. The transfected cells were lysed, and total RNA was reverse transcribed to cDNA using the Superprep® II cell lysis & rt kit according to the manufacturer's instructions. The resulting cDNA was diluted 5-fold before qPCR analysis.
[0081] qPCR experiments were performed using cDNA as a template with the StepOne Real-Time PCR System (Applied Biosystem) and GoTaq® qPCR Master Mix (promega). Each 10 μl reaction contained 1 μl of cDNA solution, 0.2 μl each of forward and reverse primers (10 μM), 0.1 μl of 100 x CXR dye, and 5 μl of GoTaq® qPCR Master Mix. A negative control without the cDNA template or a sample without reverse transcriptase was included in each assay. Table 1 below shows all the sequence information for the beta-actin used in Examples 1-3 (SEQ ID NOs: 1 and 2), the primers used for detecting various target circRNAs and constructing plasmids (SEQ ID NOs: 3-6, 11-16), ASO1-4 (SEQ ID NOs: 7-10), the sequences related to the SPR assay in Example 1 (SEQ ID NOs: 17 and 18), the sequences related to the SPR assay in Example 2 (SEQ ID NOs: 19), the sequences related to the ICT in Example 2 (SEQ ID NOs: 20), and the sequences used to design ASO1 in Figure 5 (SEQ ID NOs: 21 and 22). For [a] in Table 1, ASO1-4 are completely modified with 2'-omethyl phosphorothioate.
[0082] [Table 1]
[0083] The relative ploidy of circRNA was calculated using the comparative ΔΔCt method (Livak, KJ et al., Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25 (4), 402-408.), and beta-actin was used as an endogenous control. Outliers of the minimum and maximum values were excluded from the nine data points obtained for each sample. The qPCR products were analyzed by 8% (29:1, acylamide / bisacrylamide) polyacrylamide gel electrophoresis to confirm the size of the amplicons. The specificity of the primer pairs was also confirmed by the presence of a single peak in the melting curve after PCR amplification and sequencing of the amplicons.
[0084] 5) Ribonuclease R (RNase R) treatment HeLa cells seeded in a 24-well plate (5 x 10 4 Cells (per well) were first transfected with a p-GGA expression plasmid and processed in the same manner as described above. Total RNA was extracted using an ISOGEN RNA extraction kit according to the manufacturer's instructions. The obtained total RNA was treated with DNase I and precipitated with ethanol. The RNA pellet was dissolved in water, and 360 ng of total RNA was incubated at 37°C for 15 minutes in or without 1U RNase R. The resulting solution was subjected to direct reverse transcription using ReverTra Ace® qPCR RT Master Mix containing a gDNA remover, according to the manufacturer's instructions. Expression was then analyzed by qPCR as described above, and this experiment was performed three times independently.
[0085] 6) Results Using the comparative Ct (ΔΔCt) method, the relative quantity (RQ) of circZKSCAN1 was determined in the presence of different concentrations of the ligand. The raw Ct of circZKSCAN1 was first normalized against the mRNA of β-actin to obtain the Ct value. Next, the ΔCt value of the treated sample was further normalized against the sample in the absence of the ligand (NCD = 0 μM) to obtain ΔΔCt. Subsequently, the RQ value was calculated from the obtained ΔΔCt value (RQ = 2 -ΔΔCt ).
[0086] It was found that the use of NCD that binds to RCM can significantly increase the production of the desired circular RNA compared to the case of using QCD that does not bind to RCM (Figure 8). From this result, the finding was obtained that the production of circular RNA might be increased by strengthening the binding of RCM or the like. In this regard, considering that a specific sequence is required for the binding of NCD and the like, other methods than directly strengthening RCM were next examined with the intention of increasing the production of circular RNA without being restricted by the sequence.
[0087] (Example 2: Test using ASO1) 1) General matters Surface plasmon resonance (SPR) measurements were performed using a BIAcore T200 instrument (GE Healthcare). Isothermal titration calorimetry (ITC) measurements were performed using a calorimeter (MicroCal iTC200, Malvern Panalytical), and data analysis was performed using Origin 7.0 software. Tm melting temperature measurements were performed using a UV-2700 UV-Vis spectrophotometer (SHIMADZU). All oligonucleotides were purchased from Invitrogen. The original plasmid construct used in these experiments (here, p-UAC): pcDNA3.1(+) ZKSCAN1 nt 400-1782 delta440-500 delta1449-1735 was donated by Jeremy Wilusz (Addgene plasmid # 60633; http: / / n2t.net / addgene:60633; RRID:Addgene_60633) (Liang, D. et al., Short Intronic Repeat Sequences Facilitate Circular RNA Production. Genes Dev. 2014, 28 (20), 2233-2247), and p-GGA was prepared as described above. HeLa cells (RIKEN BRC, RCB0007) were used for transfection and maintained at 37°C under 5% CO2 in Dulbecco's modified Eagle medium (Sigma, D6429) supplemented with 10% (v / v) fetal bovine serum (MP Biomedicals) and penicillin-streptomycin (Gibco).
[0088] All 2'-omethyl phosphorothioate-modified antisense oligonucleotides (2'-OMe PS ASO) were purchased from GeneDesign. For plasmid transfection, FuGENE HD™ transfection reagent (Promega) was used, and for ASO transfection, Lipofectamine 3000 (Thermo Fisher Scientific) was used. For RT-qPCR experiments, cell lysis and reverse transcription were performed using the Superprep™ II cell lysis & RT kit (TAKARA), and then real-time PCR (qPCR) experiments were performed using the StepOne real-time PCR system (Applied Biosystem) with GoTaq™ qPCR master mix (Promega).
[0089] 2) Design of ASO ASO1 was designed according to the 5' upstream and 3' downstream sequences of the reverse complementary sequences (RCS) 1 and 2 (wherein "RCM" and "RCS" are interchangeable) in the pre-mRNA expressed from the plasmid construct (p-UAC or p-GGA, Figures 2 and 3). Briefly, two antisense sequence fragments, each 12 nt in length, were initially designed using the sequence immediately upstream of RCS1 and the sequence downstream of RCS2 as the target sense strand. The antisense sequence fragments were also carefully designed to enhance binding affinity while avoiding self-complementarity and dimerization. Next, the resulting sequence fragments were ligated via a single non-base pairing uracil linker, resulting in an antisense oligonucleotide design that hybridizes and crosslinks to the ends of RCS1 and 2 (Figure 5).
[0090] 3) SPR assay Sensor preparation: For the SPR assay, RNA containing RCS1 and RCS2 partial intron sequences, including adjacent sequences, was immobilized on a sensor chip SA (Cytiva) coated with streptavidin. The surface of the sensor chip was first treated with 50 mM NaOH and 1 M NaCl for 60 seconds, using 30 μl min. -1 Washed three times at the flow rate. Next, biotin-labeled RNA,
[0091] [ka]
[0092] (The subsequences of RCS1 and RCS2 are underlined, and the ASO-binding sequence is shown in bold) under the following conditions: 1 μM RNA in 10 mM HEPES, 500 mM NaCl, pH 7.4, 5 μL min per 60 seconds of flow. -1 The RNA was immobilized on the surface at a flow rate of [amount]. The amount of RNA immobilized on the sensor chip SA was 990 RU.
[0093] SPR Analysis Protocol: SPR analysis of the binding of the designed ASO to the RNA immobilized surface was performed on a BIAcore T-200. Subsequently, 0.0625, 0.125, 0.25, 0.5, and 1 μM of each compound were added in HBS-EP+ buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% v / v Surfactant P20, pH 7.4) (Cytiva) at 25°C for 30 μl min. -1 The assay was performed by flowing the solution at a flow rate of 30 μl min for a contact time of 60 seconds. Afterward, the bound compound was dissociated by flowing the running buffer for 120 seconds. Following the assay of each compound, 1.2 mM NaOH, 0.2 M NaCl, and 0.1 mM EDTA solutions were used for a contact time of 180 seconds at a flow rate of 30 μl min. -1 Surface regeneration was performed. The kinetic parameters of ASO binding to the RNA-immobilized surface were obtained using single-cycle kinetics.
[0094] 4) ITC assay A 600 μl solution of RNA1 (1 μM) was prepared in sodium phosphate buffer (10 mM, pH 7.0) containing NaCl (100 mM), and a portion of the solution was placed in the cell of a calorimeter. The temperature in the cell was maintained at 25°C during the experiment. Next, a 200 μl solution of ASO1 (10 μM) containing sodium phosphate buffer (10 mM, pH 7.0) and NaCl (100 mM) was prepared as the titrator. Then, titration was performed using a 40 μl syringe of the calorimeter. The titration experiment was performed at 25°C (stirred at 750 rpm) by injecting the titrator into the sample cell 19 times from the syringe (0.4 μl in the first injection, 2 μl in subsequent injections).
[0095] The initial time before the first injection was 60 seconds. Each injection lasted 4 seconds, and the interval between the two closest injections was 150 seconds. Dilution heat data during titration was obtained by injecting the titrant into a buffer-only cell (200 μl), as described above. Before fitting analysis, the data point corresponding to the first injection was removed, and the thermal data was corrected by subtracting the dilution heat. The coupled isotherms were fitted to the Origin model by least squares analysis.
[0096] 5) Reverse transcription quantitative PCR (RT-qPCR experiment) HeLa cells, 1 x 10 4 The cells were seeded into a 96-well plate at a cell / well density and incubated for 4 hours to allow the cells to adhere to the bottom of the wells. Then, following the manufacturer's instructions, Fugene HD TMp-GGA and p-UAC expression plasmids were transfected using FuGENE at a ratio of 5:2 (v / w). After culturing at 37°C in 5% CO2 for 24 hours, the medium was replaced with fresh medium, and ASO was transfected using Lipofectamine 3000 according to the manufacturer's instructions. The cells were then cultured for a further 24 hours. The transfected cells were lysed, and total RNA was reverse transcribed to cDNA using the Superprep® II cell lysis & rt kit according to the manufacturer's instructions. The resulting cDNA was diluted 2-fold before qPCR analysis.
[0097] qPCR experiments were performed using cDNA as a template with the StepOne Real-Time PCR System (Applied Biosystem) and GoTaq® qPCR Master Mix (promega). Each 10 μl reaction contained 1 μl of cDNA solution, 0.2 μl each of forward and reverse primers (10 μM), 0.1 μl of 100 x CXR dye, and 5 μl of GoTaq® qPCR Master Mix. A negative control without the cDNA template or a sample without reverse transcriptase was included in each assay. The primers used for beta-actin detection and various target circRNAs are shown in Table 1 above.
[0098] The relative ploidy of circRNA was calculated using the comparative ΔΔCt method (Livak, KJ et al., Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25 (4), 402-408.), and beta-actin was used as an endogenous control. Outliers of the minimum and maximum values were excluded from the nine data points obtained for each sample. The qPCR products were analyzed by 8% (29:1, acylamide / bisacrylamide) polyacrylamide gel electrophoresis to confirm the size of the amplicons. The specificity of the primer pairs was also confirmed by the presence of a single peak in the melting curve after PCR amplification and sequencing of the amplicons.
[0099] 6) Results The relative amount (RQ) of circZKSCAN1 was determined in the presence of different ligand concentrations using the comparative Ct (ΔΔCt) method. First, the Ct value of circZKSCAN1 was normalized relative to β-actin mRNA to obtain the Ct value. Next, the ΔCt value of the treated sample was further normalized relative to the sample in the absence of ligand (NCD=0μM) to obtain ΔΔCt. Subsequently, the RQ value was calculated from the obtained ΔΔCt value (RQ = 2 -ΔΔCt ).
[0100] Administration of ASO1 targeting the RCM vicinity of pre-mRNA resulted in a significant increase in circRNA synthesis in both full-match and mismatch cases (Figure 9). Furthermore, administration of ASO2 and ASO3, which are scramble sequences of ASO1, did not result in any significant changes (Figure 9). These results indicate that binding of ASO to a specific site (near the RCM) of pre-mRNA increases circular RNA biosynthesis, regardless of the presence of stable RCM interactions.
[0101] (Example 3: Test using ASO4) 1) General matters All oligonucleotides were purchased from Invitrogen. HeLa cells (RIKEN BRC, RCB0007) were used for transfection and maintained at 37°C under 5% CO2 in Dulbecco's modified Eagle medium (Sigma, D6429) supplemented with 10% (v / v) fetal bovine serum (MP Biomedicals) and penicillin-streptomycin (Gibco). All 2'-omethyl phosphorothioate-modified antisense oligonucleotides (2'-OMe PS ASO) were purchased from GeneDesign. For RT-qPCR experiments, total RNA was obtained using a NucleoSpin® RNA spin column (MACHEREY-NAGEL). Reverse transcription was performed using ReverTra Ace® qPCR RT Master Mix with gDNA remover (TOYOBO).
[0102] Real-time PCR (qPCR) experiments were performed using the GoTaq® qPCR master mix (Promega) and the StepOne real-time PCR system (Applied Biosystem). Intron sequence information was extracted from fasta files using the Biopython package for Python (version 1.79), and the folding energy of candidate ASOs was calculated using the ViennaRNA package for Python (version 2.5.0). The complete sequences of known human circRNAs are based on sequence data obtained from circAtlas 2.0 (Wu, W. et al., CircAtlas: an integrated resource of one million highly accurate circular RNAs from 1070 vertebrate transcriptomes. Genome Biology 2020, 21 (1), 101).
[0103] 2) Design of ASO ASO4 was hybridized by targeting two different sequences within an intron adjacent to a circularized exon, forming an antisense crosslink structure to bring the splice site closer together. Briefly, ASO was designed as follows: First, intron sequences near the circularized exon (upstream of exon 3 and downstream of exon 9 of the CHEK2 gene) were obtained from a genome database in fasta file format (www.ncbi.nlm.nih.gov / genome / gdv / ). Next, for each intron sequence, a list of all possible consecutive 14 nt length sequence fragments was created. Then, all possible sequence combinations between the two lists were generated using a 3 nt adenosine linker between the sequences, and subsequently converted to their respective reverse complementary sequences.
[0104] The resulting sequence was filtered according to the following parameter: bridging distance (d bridge = 150 ± 20 nt), folding energy (E fold > -4 kcal / mol) (Van Roon-Mom. Et al., Overview on applications of antisense-mediated exon skipping. In Methods in Molecular Biology 2012 Vol. 867, page 117-130.), and dimerization energy (E dimer > -14 kcal / mol) (Van Roon-Mom. Et al., Overview on applications of antisense-mediated exon skipping. In Methods in Molecular Biology 2012 Vol. 867, pages 117-130.).
[0105] If the parameters are defined as follows, the bridge distance (d bridge): The total distance between the 5' splice site (ss) and the ASO binding site to the 3'ss (Figure 6), and the target crosslink distance were determined based on the range of most common sequence lengths for endogenous circRNA (mode = 150±50 nt, mean = 425 nt, median = 290 nt); folding energy (E fold ): Calculated free energy of ASO when it folds internally to form a hairpin structure; dimerization energy (E dimer ): The calculated free energy of two ASOs that undergo intermolecular hybridization to form a dimer.
[0106] Next, a list of sequence combinations satisfying the above parameters was generated. ASO4 was then selected from this list due to its low folding and dimerization energy (Figure 7). Furthermore, in all the above steps, sequences containing four or more consecutive nucleic acid bases of the same type were removed.
[0107] 3) Reverse transcription quantitative PCR (RT-qPCR experiment) HeLa cells were placed in a 24-well plate in a 5 x 10⁶ arrangement. 4 Cells were seeded at a cell / well density and incubated at 37°C and 5% CO2 for 24 hours. Before transfecting the cells with ASO4 using Lipofectamine 3000, the medium was replaced with fresh medium as directed by the manufacturer, and the cells were incubated for a further 24 hours. Transfected cells were lysed, and total RNA was reverse transcribed to cDNA using ReverTra Ace® qPCR RT Master Mix (TOYOBO) containing gDNA Remover as directed by the manufacturer.
[0108] qPCR experiments were performed using cDNA as a template with the StepOne Real-Time PCR System (Applied Biosystem) and GoTaq® qPCR Master Mix (Promega). Each 10 μl reaction contained 1 μl of cDNA solution, 0.2 μl each of forward and reverse primers (10 μM), 0.1 μl of 100 x CXR dye, and 5 μl of GoTaq® qPCR Master Mix. A negative control without the cDNA template or a sample without reverse transcriptase was included in each assay. The primers used for beta-actin detection and various target circRNAs are shown in Table 1 above.
[0109] The relative ploidy of circRNA was calculated using the comparative ΔΔCt method (Livak, KJ et al., Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25 (4), 402-408.), and beta-actin was used as an endogenous control. Outliers of the minimum and maximum values were excluded from the nine data points obtained for each sample. The qPCR products were analyzed by 8% (29:1, acylamide / bisacrylamide) polyacrylamide gel electrophoresis to confirm the size of the amplicons. The specificity of the primer pairs was also confirmed by the presence of a single peak in the melting curve after PCR amplification and sequencing of the amplicons.
[0110] 4) Results The relative amount (RQ) of circZKSCAN1 was determined in the presence of different ligand concentrations using the comparative Ct (ΔΔCt) method. First, the Ct value of circZKSCAN1 was normalized relative to β-actin mRNA to obtain the Ct value. Next, the ΔCt value of the treated sample was further normalized relative to the sample in the absence of ligand (NCD=0μM) to obtain ΔΔCt. Subsequently, the RQ value was calculated from the obtained ΔΔCt value (RQ = 2 -ΔΔCt ).
[0111] The ASO4 designed in this embodiment binds to a specific site on the pre-mRNA of circCHEK2, a circular RNA associated with tumor growth in various cancers, including breast cancer, hepatocellular carcinoma, gastric cancer, and colorectal cancer. When ASO4 was administered to HeLa cells, a concentration-dependent increase in circCHEK2 biosynthesis was observed (Figure 10). On the other hand, no such increase was observed with scrambled ASO (Scram), in which the ASO4 sequence was randomized (Figure 10). These results strongly suggest that the biosynthesis of specific circular RNAs can be promoted by administering single-stranded nucleic acids that target and bind to a specific site (near the RCM) of pre-mRNA to cells. [Industrial applicability]
[0112] This invention is useful because it makes it possible to design and manufacture synthetic nucleic acids that can control the amount of synthesis of various circular RNAs. Furthermore, it becomes possible to develop molecular probes that contribute to elucidating the function of disease-related circular RNAs using the manufactured synthetic nucleic acids as a platform. Moreover, by increasing the amount of biosynthesis of disease-related circular RNAs using these synthetic nucleic acids, it may be possible to suppress the onset and severity of diseases.
Claims
1. (i) a complementary sequence for a region of at least five consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence for a region of at least five consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) A complementary sequence for a region consisting of at least five consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence for a region consisting of at least five consecutive bases from the 5' end of the RCM to 50 bases upstream. Single-stranded nucleic acids, including [the specified component].
2. The single-stranded nucleic acid according to claim 1, wherein at least one nucleotide constituting the single-stranded nucleic acid is an artificial nucleic acid.
3. The single-stranded nucleic acid according to claim 2, wherein all nucleotides constituting the single-stranded nucleic acid are artificial nucleic acids.
4. The single-stranded nucleic acid according to any one of claims 1 to 3, wherein the two complementary sequences are linked by a linker.
5. The single-stranded nucleic acid according to claim 1, wherein the base length of the single-stranded nucleic acid is 10 to 40 bases.
6. (i) a single-stranded nucleic acid comprising a complementary sequence to a region of at least five consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence to a region of at least five consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) Single-stranded nucleic acid comprising a complementary sequence to a region of at least five consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence to a region of at least five consecutive bases from the 5' end of the RCM to 50 bases upstream. A circular RNA expression enhancer containing [specific ingredient / material].
7. (i) a single-stranded nucleic acid comprising a complementary sequence to a region of at least five consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence to a region of at least five consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) Single-stranded nucleic acid comprising a complementary sequence to a region of at least five consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence to a region of at least five consecutive bases from the 5' end of the RCM to 50 bases upstream. A kit that includes this.
8. Cells, and the following: (i) a single-stranded nucleic acid comprising a complementary sequence to a region of at least five consecutive bases from the 5' end of the RCM up to 50 bases upstream, and a complementary sequence to a region of at least five consecutive bases from the 3' end of the RCM down to 50 bases downstream, and / or (ii) Single-stranded nucleic acid comprising a complementary sequence to a region of at least five consecutive bases from the 3' end of the RCM to 50 bases downstream, and a complementary sequence to a region of at least five consecutive bases from the 5' end of the RCM to 50 bases upstream. A method for enhancing the expression of circular RNA, including contacting it with another substance.