Humanized anti-CD7 antibodies
By modifying the variable regions of the heavy and light chains of the humanized CD7 antibody, the risks of immune response to murine antibodies and the challenges in the humanization process were resolved, achieving high affinity and thermal stability, and enhancing the efficacy of the antibody in the treatment of T-ALL/LBL.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-04
- Publication Date
- 2026-03-24
AI Technical Summary
Existing murine CD7 antibodies pose risks of immune reactions and side effects in clinical applications, and it is difficult to retain high affinity and thermal stability during humanization.
A humanized CD7 antibody was developed by transplanting the complementarity-determining regions of the heavy and light chain variable regions of a mouse TH69 antibody into a human framework. The full-length human light chain variable region was selected via phage display, preserving high affinity and thermal stability, and the Fc moiety was optimized to enhance effector function.
This reduces the risk of immunogenicity, retains nanomolar-level high affinity and thermal stability comparable to murine antibodies, and enhances the antibody's clinical development potential, particularly demonstrating highly efficient ADCC and ADCP activity in T-ALL/LBL treatment.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
[0001] This invention relates to an antibody that binds to CD7, wherein the antibody comprises a heavy chain variable region (V) defined by the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90%, preferably at least 95%, identity with it. H The region); and the light chain variable region (V) defined by the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having at least 90%, preferably at least 95% identity with it. L The three complementary determinant regions (CDRs) of the heavy chain variable region are determined by the amino acid sequences of SEQ ID NO: 3 to 5, and the three complementary determinant regions of the light chain variable region are determined by the amino acid sequences of SEQ ID NO: 6 to 8 (SEQ ID NO: 7 is “AAS”).
[0002] This specification references numerous sources, including patent applications and manufacturer's manuals. While the disclosures in these documents are not considered to be related to the patentability of this invention, they are incorporated herein by reference in their entirety. Specifically, all cited documents are incorporated in the same manner as if each document were individually and explicitly stated to be incorporated by reference.
[0003] In the development of antibody-based immunotherapies for T-cell acute lymphoblastic leukemia (T-ALL) and T-cell lymphoma, the CD7 antigen is an attractive target antigen.
[0004] One promising CD7-specific antibody candidate is the murine TH69 antibody described in WO 2003 / 051926. The murine TH69 antibody has shown potent antitumor activity in a T-ALL mouse model and has been used as the basis for the design of various immunotherapies, including immunotoxins and chimeric antigen receptor T cells (CAR T cells).
[0005] However, TH69 is a murine antibody. It is well known that the use of murine antibodies to treat various diseases (such as cancer, transplant rejection, rheumatic diseases, and autoimmune diseases) has not achieved the expected therapeutic effects. One of the main problems is the immune response triggered by murine antibodies. The human immune system recognizes murine antibodies from mice or rats as foreign substances and begins to produce antibodies against them. This can render the administered murine antibodies ineffective and can also cause adverse side effects such as anaphylactic shock or serum sickness.
[0006] Therefore, for further clinical development, humanized antibody variants are needed to reduce the risks of immunogenicity and anti-drug antibody formation when administered to patients. Humanization of murine antibodies is a well-established technique that avoids adverse immune responses by making humanized antibodies similar to human autoantibodies. Humanization of murine monoclonal antibodies has significantly improved their tolerability in vivo. Humanization involves replacing the mouse constant and variable regions with human sequences, resulting in products with significantly reduced immunogenicity (Harding et al. (2010), MAbs. 2010 May-Jun; 2 (3): 256–265).
[0007] However, it is known and has been found in attempts to humanize TH69 monoclonal antibodies that it is challenging to obtain humanized monoclonal antibodies that fully retain the nanomolar affinity and thermostability of mouse TH69 antibodies. Importantly, obtaining humanized versions of TH69 without adverse properties or even with favorable properties has proven challenging. The antibody of the present invention solves this challenging problem.
[0008] Therefore, a first aspect of the present invention relates to an antibody that binds to CD7, the antibody comprising a heavy chain variable region defined by the amino acid sequence of SEQ ID NO:1 or an amino acid sequence having at least 90%, preferably at least 95%, identity with it; and a light chain variable region defined by the amino acid sequence of SEQ ID NO:2 or an amino acid sequence having at least 90%, preferably at least 95%, identity with it, provided that the three complementary determining regions of the heavy chain variable region are defined by the amino acid sequences of SEQ ID NO:3 to 5, and the three complementary determining regions of the light chain variable region are defined by the amino acid sequences of SEQ ID NO:6 to 8 (SEQ ID NO:7 is “AAS”).
[0009] The term "antibody" as used in this invention includes, for example, polyclonal or monoclonal antibodies. Furthermore, derivatives or fragments thereof that retain target-binding specificity are also included in the term "antibody." Antibody fragments (particularly (antigen)-binding fragments) or derivatives particularly include Fab or Fab' fragments, Fd fragments, F(ab')2 fragments, Fv fragments or single-chain Fv fragments (scFv), single-domain heavy chain variable regions (V... H) or variable region domains (such as VHH or V-NAR domains), and multimeric forms such as microantibodies, biantibodies, triantibodies or trispecific antibodies, tetraantibodies or chemically conjugated Fab' multimers (see, for example, Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane “Using Antibodies: A Laboratory Manual” Cold Spring Harbor Laboratory Press, 1999; Altshuler EP, Serebryanaya DV, Katrukha AG. 2010, Biochemistry (Mosc)., vol. 75 (13), 1584; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23 (9), 1126). Multimeric forms particularly include bispecific antibodies that can bind two different types of antigens simultaneously and trispecific antibodies that can bind three different types of antigens simultaneously. The first antigen may be present on the protein of the present invention. The second and / or third antigen can be, for example, a tumor marker specifically expressed on cancer cells or a specific type of cancer cell. Non-limiting examples of bispecific antibody forms include biclonic antibodies (bispecific full-length human IgG antibodies), biparentally redirected antibodies (DART), DuoBodies (Genmab), and BiTE (composed of single-chain variable fragments (scFv) of two different antibodies) molecules (Kontermann and Brinkmann (2015), Drug Discovery Today, 20 (7):838-847). Antibodies conjugated with the antibodies of this invention are generally different from those of this invention. A second antibody can be used to conjugate a second binding specificity against antigens other than CD7 to the CD7 antibody of this invention, thereby producing a bispecific construct.
[0010] The term "antibody" also includes antibodies fused to the Fc fragment or their binding fragments (thus producing an Fc fusion protein). Conjugating the Fc portion of an antibody to the antibody of the present invention is another means of extending the in vivo half-life of the antibody of the present invention.
[0011] The term "antibody" in this invention refers to a humanized antibody; that is, an antibody whose remainder, except for the non-human complementarity-determining region, is of human origin.
[0012] Various antibody production techniques are well known in the art. Examples of such techniques are described, for example, in Harlow E and Lane D, Cold Spring Harbor Laboratory Press, 1988; Harlow E and Lane D, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999. The parental TH69 monoclonal antibody is a murine antibody prepared by immunizing mice with CD7-positive T-ALL cells. In addition, recombinant antibodies can be prepared from monoclonal antibodies or de novo using various display methods, such as phage display, ribosome display, mRNA display, or cell display. Systems suitable for the expression of recombinant (humanized) antibodies can be selected from, for example, bacteria, yeast, insects, mammalian cell lines, or transgenic animals or plants (see, for example, US patent 6,080,560; Holliger P, Hudson PJ. 2005, Nat Biotechnol., vol. 23 (9), 11265). Furthermore, the aforementioned techniques for producing single-chain antibodies (see, for example, US Patent 4,946,778) can be modified to produce single-chain antibodies specific to the CD7 epitope. The surface plasmon resonance technique used in the BIAcore system can be used to measure antibody affinity.
[0013] CD7 (Cluster 7) is a protein encoded by the CD7 gene in humans. The CD7 antigen is a glycoprotein present on the surface of thymocytes and mature T cells. It is one of the earliest antigens to appear on the surface of T lymphocyte lineage cells and is the most reliable clinical biomarker for T-cell acute lymphoblastic leukemia. CD7 is an attractive therapeutic target for T-cell lymphoblastic leukemia / lymphoma (T-ALL / LBL).
[0014] The antibody of this invention specifically binds to CD7.
[0015] The amino acid sequences of SEQ ID NO: 3 and 4 are identical to those of the murine monoclonal antibody TH69. H The first and second CDRs of the region are identical. The amino acid sequence of SEQ ID NO: 5 is identical to that of the murine monoclonal antibody TH69. HThe third CDR in the region is similar, except for one amino acid substitution at position 2. SEQ ID NO: 6 to 8 (SEQ ID NO: 7 is “AAS”) are three CDRs of the full-length human light chain variable region, not derived from the murine monoclonal antibody TH69. The corresponding nucleotide sequences of the six CDRs are shown in SEQ ID NO: 11 to 16 (SEQ ID NO: 15 is GCTGCATCC).
[0016] The amino acid sequences of SEQ ID NO: 1 and 2 are the heavy chain variable region and light chain variable region of an exemplary humanized TH69 antibody (huTH69; see the Examples section below), with corresponding nucleotide sequences of SEQ ID NO: 9 and 10.
[0017] According to a first aspect of the invention, an amino acid sequence having at least 90%, preferably at least 95%, identity with SEQ ID NO: 1 and SEQ ID NO: 2 is also included, provided that the six CDRs of SEQ ID NO: 3 to 8 (SEQ ID NO: 7 being “AAS”) remain unchanged. Since such amino acid sequences maintain a high degree of sequence identity with SEQ ID NO: 1 and SEQ ID NO: 2, it is reasonable to presume that such antibodies retain the advantageous properties of huTH69, which will be discussed below.
[0018] In this invention, the term "percentage (%) sequence identity" refers to the number of identical nucleotide / amino acid matches ("hit counts") between two or more aligned nucleic acid or amino acid sequences compared to the total number of nucleotide or amino acid residues of the total length of the template nucleic acid or amino acid sequence. In other words, by aligning two or more sequences or subsequences, the percentage (e.g., 90% or 95% identity) of identical amino acid residues or nucleotides is determined when comparing and aligning (sub)sequences to obtain maximum correspondence within a comparison window or specified region (e.g., using sequence comparison algorithms known in the art, or measured by manual alignment and visual inspection). This definition also applies to complementary sequences of any sequence to be aligned.
[0019] The nucleotide and amino acid sequence analysis and alignment related to this invention are preferably performed using the NCBI BLAST algorithm (Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), Nucleic Acids Res. 25:3389-3402). BLAST can be used for both nucleotide sequences (nucleotide BLAST) and amino acid sequences (protein BLAST). Other procedures suitable for nucleic acid and amino acid sequence alignment are known to those skilled in the art.
[0020] With increasing preference, the antibodies of the present invention have K values of 200 nM or less, 100 nM or less, 50 nM or less, 10 nM or less, 5 nM or less, and 2 nM or less. D Combined with CD7. As is known in the art, the specific K... D The value also depends on the specific antibody form; for example, Fab fragment or full-length antibody; see the examples below.
[0021] The term "K" D "Refers to the equilibrium dissociation constant (the reciprocal of the equilibrium binding constant or affinity constant), and is used in this paper according to the definition provided in this field."
[0022] The antibody of this invention binds to CD7 K D The values can be determined by known methods, including but not limited to surface plasmon resonance (SPR) spectroscopy, fluorescence titration, competitive enzyme-linked immunosorbent assay (ELISA), calorimetry (such as isothermal titration calorimetry, ITC), flow cytometry titration (FC titration), radioligand binding assay, and surface plasmon resonance spectroscopy (BIAcore). Such methods are well known in the art and have been described, for example, in De Jong, LAA et al.
[2005] J. Chromatogr. B 829 (1–2):1-25; Heinrich, L. et al.
[2010] J. Immunol. Methods352 (1-2):13-22.
[0023] Preferably, K is determined using surface plasmon resonance (SPR) spectroscopy. D Value. More preferably, K is determined by ELISA. DValue. The use of surface plasmon resonance spectroscopy is described in the appended embodiments (see the "Surface Plasmon Resonance Spectroscopy" section), and SPR spectroscopy is preferably performed according to the method described in the embodiments.
[0024] The antibody (huTH69-DE) of the present invention, as a purified protein, exhibits thermal stability at at least 40°C, at least 45°C, at least 47.5°C, at least 50°C, and at least 50.3°C, with increasing preference. The antibody (huTH69-wt) of the present invention, as a purified protein, exhibits thermal stability at at least 60°C, at least 65°C, at least 70°C, at least 72°C, and at least 72.3°C, with increasing preference. Thermal stability is preferably determined by a thermomigration assay.
[0025] The use of the thermal migration measurement method is described in the appended examples (see the "Thermal Migration Measurement" section), and the thermal migration measurement method is preferably performed according to the method in the examples.
[0026] A humanized version of the murine CD7 antibody TH69 (mTH69) was generated by transplanting the complementarity-determining region of the heavy chain variable region into a human framework and guiding the selection of the full-length human light chain variable region via phage display. As shown in the attached examples, surface plasmon resonance (SPR) spectroscopy analysis showed that the humanized TH69 (huTH69) retained nanomolar-level high affinity comparable to the chimeric TH69 (chimTH69) with the full-length murine variable region, and a high equilibrium dissociation constant (K0). D The molecular weight (M) of huTH69 was 1.79 nM. huTH69 exhibited thermostability comparable to chimTH69 antibodies and clinically approved antibodies such as cetuximab. The melting temperature of huTH69 with DE modification at the Fc moiety (huTH69-DE) was determined by thermomigration assay to be 50.3 °C, while that of huTH69 without DE modification (huTH69-wt) was 72.3 °C. Notably, DE modification at the Fc moiety (huTH69-DE compared to huTH69-wt) lowered the melting temperature (Amersdorffer J., et al., USPatent 20140227277. 2012.). Importantly, no adverse biochemical and biophysical properties (e.g., unpaired cysteine residues, N-glycosylation sites, asparagine deamidation, aspartic acid isomerization) that could negatively impact the clinical development potential of the humanized antibody were found in its variable region.
[0027] As described in the accompanying examples, a humanized version (huTH69) of the murine CD7 antibody TH69 (TH69 or mTH69) was generated by transplanting the CDR of the heavy chain variable region into a human framework and by guided selection of the full-length human light chain variable region from a human κ light chain library via phage display. The unique candidate huTH69 was the result of a complex and creative selection process in terms of the chosen humanization strategy and the screening procedures used. Obtaining the light chain of huTH69 is particularly difficult. Attempts to obtain the humanized light chain of TH69 via CDR transplantation failed. As an alternative to light chain humanization, guided selection was used to obtain the full-length human light chain variable region. An scFv antibody library was generated from the humanized heavy chain variable region transplanted from the CDR of TH69, and light chain variable region fragments (κ and λ light chains) were amplified from B cell RNA from eight healthy human donors. Two rounds of screening (panning) were performed on CD7-positive cell lines CEM, and phage display was used to select candidates from a library (1×10⁻⁶). 8 One κ light chain and 1×10 8 The huTH69 light chain was isolated from the λ light chain. Finally, in 1×10⁻⁶ light chains, the huTH69 light chain was isolated. 8 One κ light chain and 1×10 8 Of the λ light chains, only one CD7-specific light chain was enriched by phage display. As explained, only this huTH69 antibody with a humanized CDR-transplanted heavy chain and a full-length human light chain showed the same CD7 binding specificity as TH69.
[0028] According to a preferred embodiment of the first aspect of the present invention, the antibody comprises a heavy chain variable region differing from SEQ ID NO: 1 by no more than 5 amino acid substitutions, preferably no more than 3 amino acid substitutions, and most preferably comprises the heavy chain variable region of SEQ ID NO: 1; and / or a light chain variable region differing from SEQ ID NO: 2 by no more than 5 amino acid substitutions, preferably no more than 3 amino acid substitutions, and most preferably comprises the light chain variable region of SEQ ID NO: 2.
[0029] In this preferred embodiment, the framework regions within the heavy chain variable region and light chain variable region of SEQ ID NO: 1 and SEQ ID NO: 2 may each independently have no more than 5, preferably no more than 3, amino acid substitutions compared to the exact sequences of SEQ ID NO: 1 and SEQ ID NO: 2. The no more than 3 amino acid substitutions are preferably 2 amino acid substitutions, and most preferably 1 amino acid substitution.
[0030] Since the antibody of this preferred embodiment allows only a very small number of amino acid substitutions compared to SEQ ID NO: 1 and SEQ ID NO: 2, it is reasonable to assume that such antibodies retain the advantageous properties of huTH69 discussed above.
[0031] According to a more preferred embodiment of the first aspect of the present invention, the amino acid substitution is a conserved amino acid substitution.
[0032] As is well known, specific conserved amino acid substitutions within the antibody framework region do not significantly affect the antibody's properties.
[0033] The term "conservative amino acid substitution" refers to the replacement of one amino acid with another amino acid having a side chain with similar biochemical properties. Naturally occurring amino acids can be classified as shown in the table below:
[0034] Preferably, conservative amino acid substitution refers to (i) the replacement of an aliphatic amino acid (G, A, V, L, I) with another aliphatic amino acid, (ii) the replacement of an S / Se-containing amino acid (C, U, M) with another S / Se-containing amino acid, (iii) the replacement of an aromatic amino acid (F, Y, W) with another aromatic amino acid, (iv) the replacement of a basic amino acid (H, K, R) with another basic amino acid, (v) the replacement of an acidic amino acid (D, E) with another acidic amino acid, or (vi) the replacement of a hydrophilic amino acid (S, T, N, Q) with another hydrophilic amino acid.
[0035] According to a further preferred embodiment of the first aspect of the invention, CD7 is determined by the amino acid sequence of SEQ ID NO: 17.
[0036] SEQ ID NO: 17 shows the amino acid sequence of the human CD7 protein. The human CD7-positive T-ALL cell line (HSB-2) was used to generate and characterize mTH69. The recombinant purified CD7-Fc fusion protein was used for surface plasmon resonance (SPR) spectroscopy to characterize the chimTH69 and huTH69 antibodies.
[0037] According to another preferred embodiment of the first aspect of the invention, the antibody comprises the Fc domain of SEQ ID NO: 18.
[0038] As discussed above, a variant of huTH69 (huTH69-DE) carrying a so-called DE-modified Fc region was also produced. DE modification is known to improve Fc-mediated effector function by enhancing FcγR binding, and refers to the S239D and I332E amino acid substitutions in the CH2 domain of the Fc region. SEQ ID NO: 18 is a common sequence considering the unmodified Fc domain and the S239D and / or I332E substitutions. All four options covered by SEQ ID NO: 18 are suitable Fc domains: unmodified Fc domain, Fc domain with S239D, Fc domain with I332E, and Fc domain with both S239D and I332E, with the first and last options being preferred, and the last option being the most preferred.
[0039] Data in the accompanying examples show that huTH69 effectively triggers antibody-dependent cell-mediated cytotoxicity (ADCC) and antibody-dependent phagocytosis (ADCP). The function of these Fcγ receptor (FcγR)-mediated effectors was successfully enhanced by replacing the S239D and I332E amino acids in the CH2 domain of the Fc moiety.
[0040] Furthermore, data from the accompanying examples show that huTH69, as wild-type IgG1, unexpectedly triggered complement-dependent cytotoxicity more effectively than the parental chim TH69 antibody and selected published humanized CD7 antibodies (Heinrich G, et al. J Immunol. 1989 Dec 1;143 (11):3589-97, WO 2022 / 095803, WO 2020 / 212710 and WO 2022 / 257835). The activity of huTH69 was particularly high when target cells expressed lower levels of CD7 antigen.
[0041] According to a further preferred embodiment of the first aspect of the invention, the antibody is coupled to (a) a labeling group, (b) a toxin, (c) a drug, (d) a radioactive nucleotide, (e) a cytokine, (f) a chemokine, (g) an enzyme, (h) a component that regulates serum half-life, (i) an antibody or its Fc portion, or (j) an antibody mimic.
[0042] The labeling group is a group that allows the detection, preferably of antibodies, in the body of a subject. The labeling group is preferably a fluorescent dye. The fluorescent dye is preferably selected from Alexa Fluor dyes, BODIPY dyes, Cy dyes, Dy dyes, IRDye dyes, HiLyte Fluor dyes, Oregon dyes, TRITC, rhodamine, and fluorescein and their derivatives, including but not limited to components of NHS esters, maleimides, phosphine, and free acids. Other non-limiting examples of fluorescent proteins are green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (RFP), cyan fluorescent protein (CFP), and infrared fluorescent protein (IFP). The labeling group is also preferably a contrast agent. Contrast agents used herein are substances used to enhance the contrast of structures or fluids in vivo in medical imaging. Common contrast agents function based on X-ray attenuation or magnetic resonance signal enhancement.
[0043] The antibodies of the present invention can be used for photodynamic therapy by attaching suitable photosensitive functional groups, including but not limited to porphyrin, dihydroporphyrin, chlorophyll, phthalocyanine (e.g., IR700DX), phenothiazine onion salt, benzophenothiazine onion salt, squaric acid cyanine compounds, 1H-benzonaphthyl-1-one (phenalenone), BODIPY dye, ruthenium, rhodium and iridium complexes, hypericin, flavin, and gene-encoded proteins such as KillerRed protein.
[0044] The toxin is preferably a small organic compound or polypeptide, more preferably a toxic compound selected from, but not limited to, galicariin, maytansine, neo-carcinomacin, esporamycin, dynemicin, kedarcidin, madroopeptin, doxorubicin, daunorubicin, auristatin, ricin A chain, saccharin root toxin, truncated Pseudomonas exotoxin A, diphtheria toxin, and white tree toxin.
[0045] Drugs are compounds that can treat or prevent disease. The disease is preferably cancer, and most preferably T-cell lymphoblastic leukemia / lymphoma (T-ALL / LBL). As discussed above, CD7 is a therapeutic target for cancer treatment. CD7 can also be a target in clinical scenarios where T cells (or NK cells) contribute to pathological manifestations, such as graft-versus-host disease (GVHD).
[0046] Radioactive nucleotides are preferably selected from the gamma emission isotope group (more preferably) 99m Tc, 123 I, 125 I or 111 In) and / or a group of positron emitters (more preferably In) and / or a group of positron emitters 18 F,60 Cu、 62 Cu、 64 Cu、 68 Ga、 86 Y、 89 Zr or 124 I) and / or β emitter group (more preferably) 131 I, 90 Y、 177 Lu or 67 Cu) and / or α emitter group (preferred) 213 Bi、 212 Bi、 227 Th、 212 Ph、 223 Ra、 225 Ac or 211 At). Radioactive nucleotides are more preferably positron emitters because they are particularly suitable for diagnostic purposes, such as by positron emission tomography (PET) imaging or single-photon emission computed tomography (SPECT). For therapeutic applications, radioactive nucleotides are more preferably alpha emitters or beta emitters.
[0047] The preferred cytokines selected are interleukin-2 (IL-2), interleukin-12 (IL-12), tumor necrosis factor-α (TNF-α), interferon-α (IFN-α), interferon-β (IFN-β), interferon-γ (IFN-γ), interleukin-10 (IL-10), interleukin-15 (IL-15), interleukin-24 (IL-24), granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-9 (IL-9), interleukin-11 (IL-11), interleukin-13 (IL-13), and interleukin- 18 (IL-18), interleukin-21 (IL-21), LIF, CD80, B70, tumor necrosis factor-β (TNF-β), LT-β, CD40 ligand, Fas ligand, transforming growth factor-β (TGF-β), interleukin-1α (IL-1α), and interleukin-1β (IL-1β). As is known in the art, cytokines can support pro-inflammatory or anti-inflammatory responses of the immune system. Therefore, depending on the disease to be treated, fusion constructs containing pro-inflammatory or anti-inflammatory cytokines are preferred. For example, for cancer treatment, particularly prostate cancer, fusion constructs containing pro-inflammatory cytokines are generally preferred. Anti-inflammatory cytokines can be used, for example, to prevent autoimmune responses.
[0048] Chemokines are preferably selected from interleukin-8 (IL-8), GRO-α, GRO-β, GRO-γ, ENA-78, PF4, Mig, IP-10, SDF-1α / β, BUNZO / STRC33, I-TAC, BLC / BCA-1, MIP-1α, MIP-1β, MDC, TECK, TARC, RANTES, HCC-1, HCC-4, DC-CK1, MIP-3α, MIP-3β, MCP-1-5, eotaxin, Eotaxin-2, I-309, MPIF-1, 6Ckine, CTACK, MEC, lymphokactin, and fractalkine.
[0049] Enzymes are proteins that catalyze specific chemical or biochemical reactions. Antibody-enzyme fusion proteins have been used, for example, in two ways for cancer therapy targeting tumors. In one system, the antibody-enzyme is pre-targeted to the tumor, followed by the administration of an inactive prodrug, which is converted to its active form by the pre-targeted enzyme. This system has been described as antibody-directed enzyme prodrug therapy (ADEPT). Suitable enzymes for prodrug activation will be discussed further below in the section on enzymes. Another system uses the antibody-enzyme fusion protein as a direct therapeutic agent, where the enzyme itself is toxic. A key feature of this method is the use of an antibody to target the toxic enzyme and subsequently internalize it into tumor cells, thereby activating the cell death process. This antibody-enzyme system has been primarily used for the delivery of ribonucleases.
[0050] Enzymes can also be used for imaging in diagnostics. Co-couples in this regard include enzymes capable of catalyzing colorimetric, chemiluminescent, or fluorescent reactions, such as horseradish peroxidase (HRP), luciferase, α-galactosidase, and alkaline phosphatase (AP). Co-couples can also be enzymes capable of releasing or activating cytotoxic agents that have been brought to the vicinity of target tissue, such as enzymes for prodrug activation, such as those selected from carboxypeptidases, glucuronidases, and glucosidases (Bagshawe, KD
[2009] Curr. Drug Targets 10:152-157; Chen, K.-C.
[2011] BioconjugateChem. 22:938–948). For certain applications, truncated versions of the enzyme are preferred, for example by omitting the binding domain, provided that the truncated version retains or substantially retains the enzyme activity of the full-length enzyme. Therefore, with respect to truncated versions of enzymes, it should be understood that they retain or substantially retain the enzyme activity of the full-length enzyme.
[0051] A variety of compounds are available for extending the half-life of therapeutic agents, including antibodies. Two of the most common and preferred options are PEGylation and fusion with human serum albumin. Other options include chemical coupling of polymers and carbohydrates, post-translational modifications (such as N-glycosylation), and fusion with recombinant polymer mimics.
[0052] According to a more preferred embodiment of the first aspect of the invention, the antibody mimicry is selected from affibodies, adnectins, anticalins, DARPins, avimers, nanoofitin, affiliins, Kunitz domain peptides, Fynomers®, as well as trispecific binding molecules and probodies.
[0053] As used herein, the term "antibody mimic" refers to a compound or protein that, like an antibody, specifically binds to an antigen but is structurally unrelated to an antibody. Antibody mimics are typically artificial peptides or proteins with a molar mass of approximately 3 to 30 kDa. Antibody mimics are preferably selected from proteins containing anticalin, affibody, adnectin, DARPin, Avimer, nanofitin, affilin, β-Wrapin, ADAPT, monomer-binding protein, RasIn, FingR, pronectin, centyrins, affilin, affimer, adhiron, affitin, αRep, repebody, i-body, fynomer, or Kunitz domains.
[0054] Lipocarrier-derived binding proteins (also known as anticalins) are a class of non-immunoglobulin-binding proteins based on human lipocorticoid scaffolds. Lipocarriers comprise a diverse group of small (20 kDa) extracellular proteins found in a variety of species, from bacteria to humans, used for the transport or clearance of physiological compounds. Despite low sequence homology, the three-dimensional folding of lipocriers is highly conserved (Rothe and Skerra (2018), BioDrugs. 2018; 32 (3): 233–243.). Anticalins are a new class of artificial binding proteins obtained through combinatorial design based on compact and stable human lipocorticoid scaffolds. Due to their human origin, anticalins have the potential for low immunogenicity, and anticalins with different target specificities have demonstrated safety in multiple clinical trials. Lipocarrier-derived binding proteins are preferably lipocorticoid 2 (Lcn2)-derived binding proteins. Lipocarrier protein-2 (Lcn2), also known as neutrophil gelatinase-associated lipcarrier protein (NGAL), is a protein encoded by the LCN2 gene in humans. Human LCN2 mRNA is represented, for example, by the NCBI reference sequence: NM_005564.5 (available as of March 12, 2019), and the amino acid sequence of the human Lcn2 protein containing the signal peptide is represented, for example, by UniProt ID P80188-2 (available as of November 1, 1995).
[0055] In this invention, the “affinity” is an antibody mimic derived from the Z domain of staphylococcal protein A. The affinity is structurally based on a triple-helix bundle domain. The affinity has a molecular weight of approximately 6 kDa and is stable under high temperature and acidic or alkaline conditions. Target specificity is achieved by randomizing the amino acids in the two α-helices involved in the binding activity to the parent protein domain (Feldwisch, J&Tolmachev, V.
[2012] Methods Mol. Biol. 899:103-126).
[0056] In this invention, “adnectins” and “monomer-binding proteins” are based on the 10th extracellular domain (10Fn3) of human fibronectin type III, which employs an Ig-like sandwich fold with 2 to 3 exposed loops but lacks a central disulfide bond (Gebauer, M. & Skerra, A.
[2009] Curr. Opin. Chem. Biol. 13:245-255 and Koide et al. 1998, J. Mol. Biol. 284:1141–51). Adnectins and monomer-binding proteins with desired target specificity can be genetically engineered by introducing modifications into specific loops or other surface regions of the protein.
[0057] In this invention, “DARPin” is a designed ankyrin repeat domain that provides a rigid interface derived from three repeats that typically correspond to artificially shared sequences, with six positions of each repeat being randomized. Therefore, DARPin lacks structural flexibility (Gebauer, M. & Skerra, A.
[2009] Curr. Opin. Chem. Biol. 13:245-255).
[0058] As used herein, the term "Avimer" refers to a class of antibody mimics consisting of two or more peptide sequences, each 30 to 35 amino acids long, derived from the A domains of various membrane receptors and linked by linker peptides. Binding to the target molecule occurs through the A domains, and the domains with desired binding specificity can be selected, for example, by phage display technology. The target specificity of different A domains contained in an Avimer may be the same, but not necessarily the same (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10 (4):155-68).
[0059] "Nanofitin" and "Affitin" are antibody mimics of the DNA-binding protein Sac7d from *Sulfolobus acidocaldarius*. Nanofitin and Affitin typically have a molecular weight of approximately 7 kDa and are designed to specifically bind to target molecules by randomizing the amino acids on their binding surface (Mouratou B, Béhar G, Paillard-Laurance L, Colinet S, Pecorari F., (2012) Methods Mol Biol.; 805:315-31.).
[0060] As used herein, the term “Affitin” refers to an antibody mimic developed by using γ-B crystal proteins or ubiquitin as a scaffold and modifying the amino acids on the surface of these proteins through random mutagenesis. For example, Affitins with desired target specificity are selected using phage display or ribosome display techniques. Depending on the scaffold, the molecular weight of Affitin is approximately 10 or 20 kDa. As used herein, the term Affitin also refers to dimer or polymeric forms of Affitin (Weidle UH, et al., (2013), Cancer Genomics Proteomics; 10 (4):155-68).
[0061] As used herein, the term “β-Wrapins” refers to a homodimer of an affinity protein, which has a disulfide bond between two identical monomeric subunits (referred to as subunits 1 and 2) linked by a Cys 28 residue pair. The scaffold used in engineered β-Wrapins is ZAβ3, an Aβ-binding affinity protein that not only prevents the initial aggregation of Aβ monomers into toxic forms but also dissociates pre-formed oligomers by chelating and stabilizing the β-hairpin conformation of Aβ monomers (Orr et al. (2018), Computers & Chemical Engineering, 116 (4):322-332).
[0062] As used herein, the term “ABD-derived affinity protein (ADAPT)” refers to a class of antibody mimics created using the albumin-binding domain (ABD) of streptococcal protein G as a stable protein scaffold (Garousi et al. (2015), Cancer Res.; 75 (20):4364-71). By diversifying the surface of domains that do not directly participate in albumin binding, molecules that bind to new targets while retaining their albumin-binding ability can be selected. This strategy has been used to select binders for a variety of proteins, such as the cancer-associated epidermal growth factor receptor 3.
[0063] As used in this paper, “RasIns” are antibody mimics based on 10FnIII. Therefore, they use the 10th domain of human fibronectin as their scaffold. RasIns are disulfide-free intracellular antibodies. They have been shown to be stable in cells and when fused with fluorescent protein tags (Cetin et al. (2017), J Mol Biol.; 429 (4):562–573).
[0064] As used in this article, the term “FingRs (intracellular antibodies against fibronectin generated by mRNA display)” refers to recombinant antibody-like proteins also based on the 10FnIII scaffold (Gross et al. (2013), Neuron.; 78 (6): 971–985.).
[0065] As used herein, the term "Pronectins" refers to recombinant antibody-like proteins based on the 14th type III scaffold (14Fn3) of human fibronectin. Characterized fibronectin is ubiquitous in the human body. Human fibronectin is an extracellular protein naturally abundant in human serum. The intelligent loop diversity design is intended to closely mimic the natural human library and avoid sequence immunogenicity. The inherent properties of Pronectin are consistent with the pharmacological characteristics required for its success as a drug, including high potency, specificity, stability, advantageous small size, and high-yield production in E. coli and yeast (http: / / www.protelica.com / pronectin_tech.html).
[0066] As used herein, the term “Centyrins” refers to recombinant antibody-like proteins based on the shared tendinin FN3 framework (Tencon) (Diem et al. (2014), Protein Eng., Des. and Sel. 27, 419–429). Centyrins targeting various targets have been generated, such as human c-MET, rTNFα, and mIL-17A.
[0067] As used herein, “Affimers” refers to small proteins that bind to target molecules with similar specificity and affinity to antibodies. These engineered non-antibody-binding proteins are designed to mimic the molecular recognition properties of monoclonal antibodies in various applications. Furthermore, these affinity reagents have been optimized to improve their stability, enabling them to withstand a range of temperatures and pH, reduce their size, and enhance their expression in E. coli and mammalian cells. These 12–14 kDa proteins are derived from cysteine protease inhibitors of the cystatin family, which are naturally occurring cysteine protease inhibitors and share a common tertiary structure with an α-helix atop an antiparallel β-sheet (Tiede et al. (2017), eLife.; 6: e24903).
[0068] The recombinant antibody-like protein class referred to in this article as “Adhirons” is based on the shared sequence of phytocystatin inhibitors as a scaffold (Tiede et al. (2014) Protein Eng. Des. Sel.27, 145-55).
[0069] The recombinant antibody-like protein class referred to in this article as “αRep” originates from an α-helical HEAT-like repeat protein scaffold. More specifically, αRep proteins are derived from a naturally occurring modular protein family containing α-helical repeats associated with HEAT repeats, named after Huntington's protein, elongation factor 3 (EF3), protein phosphatase 2A (PP2A), and yeast kinase TOR. The association of multiple HEAT repeats forms α-solenoids of varying lengths, naturally occurring in a variety of cellular proteins involved in intracellular transport and protein-protein interactions (Hadpech et al. (2017), Scientific Reports;7:Article number 16335).
[0070] As used herein, the term “Repebodies” refers to recombinant antibody-like proteins composed of leucine-rich repeat (LRR) modules. More specifically, the binding scaffold of Repebodies is based on the variable lymphocyte receptor, a non-immunoglobulin antibody composed of LRR modules in jawless vertebrates. The template scaffold was first constructed by linking common repeat modules between the N-terminal and C-terminal cap motifs of the variable lymphocyte receptor. Based on the analysis of module similarity between individual repeat units using computational methods, the N-terminal domain of the template scaffold was redesigned based on the internalized protein B cap (Lee et al. (2012), Proc Natl Acad Sci; 109 (9): 3299-3304).
[0071] As used herein, the term "i-bodies" refers to recombinant antibody-like proteins constructed on a human protein scaffold and engineered with two loops mimicking the shape of shark antibodies. These loops are responsible for binding to or interacting with specific disease-causing targets (in circulation or on cells). i-bodies are human analogs of shark antibody antigen-binding domains that combine the advantages of monoclonal antibodies (high target specificity and affinity) with the favorable stability characteristics of small molecules. https: / / www.ibodies.eu / ).
[0072] As used herein, the term “Fynomer” refers to a non-immunoglobulin-derived binding polypeptide derived from the human Fyn SH3 domain. Fyn SH3-derived polypeptides are well known in the art and have been described, for example, in Grabulovski et al. (2007) JBC, 282, p. 3196-3204, WO 2008 / 022759, Bertschinger et al. (2007) Protein Eng Des Sel 20 (2):57-68, Gebauer and Skerra (2009) Curr Opinion in Chemical Biology 13:245-255, or Schlatter et al. (2012), MAbs 4:4, 1-12.
[0073] "Kunitz domain peptides" are derived from the Kunitz domain of Kunitz-type protease inhibitors, such as bovine pancreatic trypsin inhibitor (BPTI), amyloid precursor protein (APP), or tissue factor pathway inhibitor (TFPI). The Kunitz domain has a molecular weight of approximately 6 kDa and can be selected with the desired target specificity through display techniques (such as phage display) (Weidle et al., (2013), Cancer Genomics Proteomics; 10 (4):155-68).
[0074] According to a more preferred embodiment of the first aspect of the present invention, the drug is selected from erlotinib (TARCEVA; Genentech / OSI Pharmaceuticals), bortezomib (VELCADE; Millennium Pharmaceuticals), fulvestrant (FASLODEX; AstraZeneca), sunitinib (SU11248; Pfizer), letrozole (FEMARA; Novartis), imatinib mesylate (GLEEVEC; Novartis), PTK787 / ZK222584 (Novartis), oxaliplatin (Eloxatin; Sanofi), 5- 5-fluorouracil (5-FU), leucovorin, rapamycin (sirolimus, RAPAMUNE; Wyeth), lapatinib (TYKERB, GSK572016; GlaxoSmithKline), lonafranil (SCH66336), sorafenib (BAY43-9006; Bayer Laboratories), gefitinib (IRESSA; AstraZeneca), AG1478, AG1571 (SU 5271; Sugen); alkylating agents such as thiotepa and cyclophosphamide (CYTOXAN®); alkyl sulfonates such as busulfan, indomethacin, and piperosulfan; aziridines such as benzodopa, carboquinone, meturedopa, and uredopa; ethyleneimine and methylmelamines including hexamethylmelamine, triethylmelamine, triethylphosphamide, triethylthiophosphamide, and trimethylolmelamine; acetate compounds (especially blatazine and blatazineone); camptothecin (including synthetic analogs topotecan); bryostatin; callystatin; CC-1065 (including its synthetic analogs adolexin, cazelexin, and pyzelexin); cryptophycins (especially cryptophycin 1 and cryptophycin 8); dolalastatin; docalamicin (including synthetic analogs KW-2189 and CB1-TM1); eleutherobin; Pancratistatin; sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, naphthalenemus, cholophosphamide, estradiol, ifosfamide, nitrogen mustard, nitrogen mustard hydrochloride oxide, melphalan, neonitrogen mustard, phenylacetic acid nitrogen mustard cholesterol, prednisolone, trofenoxam, uracil nitrogen mustard; nitrosoureas such as carmustine, chloramphenicol, formustine, lomustine, nimustine, and ranimnustine; antibiotics such as enediyne antibiotics (e.g., galicarmycin, especially galicarmycin γ1I and galicarmycin ωI1 (see, for example, Agnew, Chem Intl edEngl)., 33: 183-186 (1994)) and dynemicin, including dynemicin A; bisphosphonates such as clodrophosphonate; esporamin, neomycin chromophores and related chromophores, ethynylene antibiotic chromophores, aclarubicins, actinomycin, antrmycin, diazoserine, bleomycins, actinomycin C, carabicin, carninomycin, carcinomycin, chromomycin, daunorubicin, daunorubicin, detorubucin, 6-diazo-5-oxo-L-leucine, doxorubicin (ADRLIMYCIN®) (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrololino- Doxorubicin, liposomal doxorubicin and deoxydoxorubicin), epirubicin, esoxabicin, mesorubicin, mitomycins such as mitomycin C, mycophenolic acid, nogamycin, oligomycins, pepromycin, pofamimycin, puromycin, triamcinolone acetonide, rodorubicin, streptomigrin, streptozotocin, tuberculin, ubenimex, fentostatin and zorubicin; antimetabolites such as 5-fluorouracil (5-FU); folic acid analogs such as folate, methotrexate, pteroxate, trimethoprim; purine analogs such as fludarabine, 6-mercaptopurine, thioguanine, thioimidapurine and thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6- Azavir, carmoflu, cytarabine, dideoxyuridine, deoxyfluorouridine, enoxabin, and fluorouridine; androgens such as calotestosterone, drotaloferrin propionate, cyclothionol, meandrolone, and testrolide; antiadrenergics such as aminoglutethimide, mitotane, and trilostertan; folic acid supplements such as folinic acid; acetoglucan lactone; aldehydephosphoramide glycoside; aminolevulinic acid; enuracil; acridine; bestrabucil; bisacodyl; edatraxate; defofamine; colchicine; diazinon; efornithine; elliptinium acetate. acetate); Aposilone; Etoglobulin; Gallium nitrate; Hydroxyurea; Lentinan; Lonidainine; Maytans such as Maytans and Ansericins; Mitoguanidine; Mitoanthraquinone; Mopidanmol; Nitraerine; Pentostatin; Phenamet; Pirarubicin; Loxoanthraquinone; 2-Ethylhydrazine; Procarbazine; PSK® Polysaccharide Complex (JHS Natural Products, Eugene, Oreg).); Propylene; Rhizomycin; Sizofenamic acid; Germanium spiroamine; Tenuzonic acid; Triaminoquinone; 2,2',2''-trichlorotriethylamine; Trichothecenes (especially T-2 toxin, verracurin A, roridin A, and anguidine); Urethane; Vinpocetine; Dacarbazine; Mannitol mustard; Dibromomannitol; Dibromoeutherol; Piperobromide; Gacytosine; Cytarabine ('Ara-C'); Cyclophosphamide; Thiotepa; Taxanes, such as paclitaxel (Bristol-Myers Squibb Oncology, Princeton, NJ), ABRAXANETM polyoxyethylene castor oil-free, paclitaxel albumin engineered nanoparticle formulations (American Pharmaceutical Partners, Schaumber, I11.), and docetaxel (Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; platinum analogs such as cisplatin, carboplatin; vinblastine; platinum; etoposide, ifosfamide; mitoxantrone; vincristine; vinorelbine (NAVELBINE®); norfloxacin; teniposide; edaraxacin; daunorubicin; aminopterin; capecitabine; ibandronic acid; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DFMO); retinoids such as retinoic acid; capecitabine; and their pharmaceutically acceptable salts, solvates, and acids.
[0075] The preferred embodiments described above involve preferred antibody-drug conjugates (ADCs). Antibody-drug conjugates are among the fastest-growing anticancer drugs. This method involves conjugating a monoclonal antibody to a cytotoxic payload via a chemical linker, targeting a target antigen expressed on the surface of tumor cells, reducing systemic exposure and thus decreasing toxicity. TH69 binds to CD7, directing the antibody to tumor cells where the drug can combat the tumor.
[0076] According to a further preferred embodiment of the first aspect of the invention, the toxin is selected from auristatin (preferably monomethylauristatin E (MMAE) or monomethylauristatin F (MMAF)), domains II and HI of Pseudomonas exotoxin A, diphtheria toxin, ricin A, pokeweed antiviral protein, human pancreatic ribonuclease, gerdemycin, maytansine, calciferin, daunorubicin, doxorubicin, methotrexate, vinblastine, SG2285, dolalastatin, dolalastatin analogue auristatin, cryptophytin, camptothecin, rhizomycin derivatives, CC-1065, docalmicin, enediyne antibiotics, esporam, ipsholm, amatoxins (such as α-amanitin), deruxtecan, ethatecan analogues (including ethatecan), pyrrolobenzodiazepine (PBD) dimers, and toxins.
[0077] The principle of antibody-toxin conjugates is similar to that of ADCs. TH69 binds to CD7, directing the toxin to tumor cells, where it can exert toxic effects. The conceptual mechanism by which huTH69 delivers a truncated version of Pseudomonas exotoxin A is described in the appended Example 5.
[0078] The second aspect of the invention relates to a nucleic acid molecule or a set of two nucleic acid molecules, wherein the nucleic acid molecule encodes an antibody of the first aspect, wherein the first nucleic acid molecule encodes a heavy chain variable region of the first aspect antibody and the second nucleic acid molecule encodes a light chain variable region of the first aspect antibody.
[0079] Where a nucleic acid molecule is involved in an antibody coupled to a compound defined in paragraphs (a) to (j) above, it should be understood that such compound may also be encoded by a nucleic acid molecule, provided that the compound is a protein compound.
[0080] The term "nucleic acid molecule" as used in this invention includes DNA (such as cDNA or double-stranded or single-stranded genomic DNA) and RNA. In this respect, "DNA" (deoxyribonucleic acid) refers to any chain or sequence consisting of chemical building blocks called nucleotide bases—adenine (A), guanine (G), cytosine (C), and thymine (T)—linked to a deoxyribose backbone. DNA may have a single nucleotide base chain or two complementary strands that can form a double helix. "RNA" (ribonucleic acid) refers to any chain or sequence consisting of chemical building blocks called nucleotide bases—adenine (A), guanine (G), cytosine (C), and uracil (U)—linked to a ribose backbone. RNA typically has a single nucleotide base chain, such as mRNA. Single-stranded and double-stranded hybrid molecules are also included, namely DNA-DNA, DNA-RNA, and RNA-RNA. Nucleic acid molecules can also be modified in a variety of ways known in the art. Non-limiting examples of such modifications include methylation, “cap structures,” substitution of one or more naturally occurring nucleotides with analogs, and internucleotide modifications (e.g., modifications with uncharged linkages such as methylphosphonates, phosphate triesters, phosphoramides, carbamates, etc.) and modifications with charged linkages such as thiophosphates, dithiophosphates, etc.). Nucleic acid molecules (hereinafter also referred to as polynucleotides) may contain one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine, psoralen, etc.), chelating agents (e.g., metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. Polynucleotides can be derivatized by forming methyl or ethyl phosphate triesters or alkyl phosphoramide linkages. Also included are nucleic acid mimics known in the art, such as synthetic or semi-synthetic derivatives of DNA or RNA, and mixed polymers. Nucleic acid mimics or derivatives according to the present invention include phosphate-thiocyanate nucleic acids, aminophosphate nucleic acids, 2'-O-methoxyethyl ribonucleic acid, morpholinonucleotides, hexitol nucleic acids (HNA), peptide nucleic acids (PNA), and locked nucleic acids (LNA) (see Braasch and Corey, ChemBiol 2001, 8: 1). LNA is an RNA derivative in which the ribose ring is constrained by a methylene linker between the 2'-oxygen and 4'-carbon. Nucleic acids containing modified bases, such as thiouracil, thioguanine, and fluorouracil, are also included. Nucleic acid molecules typically carry genetic information, including information about cellular mechanisms for the production of proteins and / or peptides. The nucleic acid molecules of the present invention may include promoters, enhancers, reactive elements, signal sequences, polyadenylated sequences, introns, 5'- and 3'-uncoding regions, etc.
[0081] The nucleic acid molecules of this invention encode the antibodies of this invention. The antibodies of this invention can also be encoded by a set of two nucleic acid molecules. This is because antibodies (full-length antibodies or fragments, such as scFv or Fab) contain heavy and light chain sequences, which can self-assemble to form antibodies, for example, after expression in cells. The heavy and light chain sequences can be encoded by a set of two different nucleic acid molecules.
[0082] A third aspect of the invention relates to a vector comprising a nucleic acid molecule of the second aspect in an expressible form, or a set of two vectors comprising a set of two nucleic acid molecules of the second aspect in an expressible form.
[0083] The vector or a combination of two vectors may optionally also contain a nucleic acid molecule encoding a protein-like compound as defined in any of (a) to (j) in an expressible form.
[0084] The term "vector" as used in this invention preferably refers to plasmids, granules, viruses, bacteriophages, or other vectors commonly used in genetic engineering, which encode the antibodies of this invention in an expressible form. For the same reasons discussed when discussing a set of nucleic acid molecules of this invention, the antibodies of this invention may also be encoded by a set of vectors, preferably by a set of two vectors.
[0085] The nucleic acid molecules encoding the antibodies of this invention can, for example, be inserted into a variety of commercially available vectors. Non-limiting examples include prokaryotic plasmid vectors such as the pUC series, pBluescript (Stratagene), pET series expression vectors (Novagen), or pCRTOPO (Invitrogen), and vectors suitable for expression in mammalian cells such as pREP (Invitrogen), pcDNA3 (Invitrogen), pCEP4 (Invitrogen), pMC1neo (Stratagene), pXT1 (Stratagene), pSG5 (Stratagene), EBO-pSV2neo, pBPV-1, pdBPVMMTneo, pRSVgpt, pRSVneo, pSV2-dhfr, pIZD35, pLXIN, pSIR (Clontech), pIRES-EGFP (Clontech), pEAK-10 (Edge Biosystems), pTriEx-Hygro (Novagen), and pCINeo (Promega). Examples of plasmid vectors suitable for Pichia pastoris include, for example, plasmids pAO815, pPIC9K, and pPIC3.5K (all from Invitrogen).
[0086] The nucleic acid molecules inserted into the vector can be synthesized, for example, by standard methods or isolated from natural sources. The ligation of the coding sequence to transcriptional regulatory elements and / or other amino acid coding sequences can also be performed using established methods. It is ensured that the transcriptional regulatory elements (part of the expression cassette) expressed in prokaryotic or eukaryotic cells are well known to those skilled in the art. These elements include regulatory sequences that ensure transcription initiation (e.g., translation initiation codons, promoters (such as native or heterologous promoters and / or insulators; see above), internal ribosome entry sites (IRES) (Owens, Proc. Natl. Acad. Sci. USA 98 (2001), 1471-1476), and optionally polyadenylation signals that ensure transcription termination and transcript stabilization. Additional regulatory elements may include transcriptional enhancers and translational enhancers. Preferably, the polynucleotide encoding the antibody of the present invention is operatively linked to such expression control sequences that allow expression in prokaryotic or eukaryotic cells. The vector may further contain a nucleic acid sequence encoding a secretion signal as an additional regulatory element. Such sequences are well known to those skilled in the art. Furthermore, depending on the expression system used, a leader sequence capable of directing the expressed polypeptide to a cellular compartment may be added to the coding sequence of the polynucleotide of the present invention. Such leader sequences are well known to those skilled in the art.
[0087] Furthermore, preferred vectors contain selection markers. Examples of selection markers include genes encoding resistance to neomycin, ampicillin, hygromycin, and kanamycin. Specially designed vectors allow DNA to shuttle between different hosts, such as bacterial-fungal cells or bacterial-animal cells (e.g., the Gateway system available at Invitrogen). Expression vectors according to the invention can direct the replication and expression of the polynucleotides and encoded peptides or fusion proteins of the invention. In addition to introduction via vectors (such as phage vectors or viral vectors (e.g., adenovirus, retrovirus)), the nucleic acid molecules described herein can be designed for direct introduction or introduction into cells via liposomes. Furthermore, baculovirus systems or systems based on vaccinia virus or Simemlik Forest virus can be used as eukaryotic expression systems for the nucleic acid molecules of the invention.
[0088] The fourth aspect of the present invention relates to a host cell comprising the nucleic acid molecule of the second aspect or a set of two nucleic acid molecules, or the carrier of the third aspect or a set of two carriers, wherein the host cell is preferably an anti-tumor leukocyte, and the anti-tumor leukocyte is preferably a chimeric antigen receptor T cell (CAR T-cell), a T cell receptor engineered T cell (TCR T-cell), a chimeric antigen receptor NK cell (CAR NK-cell), an NK cell receptor engineered NK cell (NCRNK cell), a TCR / CAR hybrid T cell, an NCR / CAR hybrid NK cell, a tumor-infiltrating lymphocyte (TIL), or a CAR macrophage.
[0089] The host cell is preferably a non-human host cell or a human host cell.
[0090] The term "host cell" means any cell of any organism that is selected, modified, transformed, cultured, or used or manipulated in any way to produce the antibodies of the present invention, and optionally to produce protein compounds as defined in any of paragraphs (a) to (j). Thus, host cells are generally isolated or in vitro cells and / or isolated cells, or may be part of a non-human transgenic animal.
[0091] The host cells of the present invention are typically generated by introducing the nucleic acid molecules and / or vectors of the present invention into host cells, wherein the nucleic acid molecules and / or vectors, in their presence, mediate the expression of the nucleic acid molecules of the present invention encoding the antibodies of the present invention. The host from which the host cells are derived or isolated can be any prokaryotic or eukaryotic cell or organism, preferably other than human embryonic stem cells obtained directly by destroying human embryos.
[0092] Suitable prokaryotes (bacteria) that can be used as hosts for this invention are those commonly used for cloning and / or expression, such as *Escherichia coli* (e.g., *E. coli* strains BL21, HB101, DH5α, XL1 Blue, Y1090, and JM101), *Salmonella typhimurium*, *Serratia marcescens*, *Burkholderia glumae*, *Pseudomonas putida*, *Pseudomonas fluorescens*, *Pseudomonas stutzeri*, *Streptomyces lividans*, *Lactococcus lactis*, *Mycobacterium smegmatis*, *Streptomyces coelicolor*, or *Bacillus subtilis*. The appropriate culture medium and conditions for the aforementioned host cells are well known in the art.
[0093] Suitable eukaryotic host cells can be vertebrate cells, insect cells, fungal / yeast cells, nematode cells, or plant cells. Fungal / yeast cells can be *Saccharomyces cerevisiae* cells, *Pichia pastoris* cells, *Kluyveromyces lactis* cells, or *Aspergillus* cells. Preferred examples of host cells genetically engineered using the nucleic acid molecules or vectors of the present invention are cells of yeast, *Escherichia coli*, and / or *Bacillus* species (e.g., *Bacillus subtilis*). In a preferred embodiment, the host cell is a yeast cell (e.g., *Saccharomyces cerevisiae*, *Kluyveromyces lactis*, or *Pichia pastoris*).
[0094] In various preferred embodiments, the host cell is a mammalian host cell, such as Chinese hamster ovary (CHO) cells, mouse myeloma lymphoblasts, human embryonic kidney cells (HEK-293), human embryonic retinal cells (Crucell Per.C6), or human amniotic fluid cells (Glycotope and CEVEC). These cells are commonly used in the art for the production of recombinant proteins. CHO cells are the most commonly used mammalian host cells for the industrial production of recombinant protein therapeutics for humans.
[0095] Antitumor leukocytes are also preferred as host cells because they can be used as therapeutic cells, particularly in tumor immunotherapy. Furthermore, the humanized variable regions described herein can serve as a basis for developing various immunotherapeutic strategies, including CAR T cells / CAR NK cells / CAR macrophages.
[0096] Antitumor leukocytes (or antitumor effector leukocytes) are leukocytes capable of triggering a cytolytic response that leads to tumor cell death. These leukocytes are specialized for and possess the ability to eliminate tumor cells. The first class includes clonal expansion of T lymphocytes that express unique T cell receptors (TCRs) and recognize tumor epitopes in the context of major histocompatibility complex (MHC) molecules. These T cells, optionally along with B cells that produce tumor-specific antibodies and dendritic cells (DCs) that process and present tumor epitopes, mediate adaptive immunity against tumors. The second class of effector cells includes natural killer (NK) cells, NK-T cells, and macrophages (M). These cells are not restricted by MHC molecules when interacting with tumor targets, and they mediate innate immunity. Each effector cell type, whether specific or non-specific, comprises cell subsets at different stages of differentiation and activation. This means that each effector cell type is potentially capable of targeting tumor cells in a heterogeneous mixture of cells with different functional capabilities, depending on their differentiation, maturation, and / or activation stage (Holland, Frei; Cancer Medicine; 6th edition. chapter “Antitumor Effector Cells in Humans”). All of the above-described types of antitumor leukocytes are applicable to this invention.
[0097] The anti-tumor leukocytes mentioned in this article are preferably T cells, NK cells, or macrophages.
[0098] T cells, or T lymphocytes, can be distinguished from other lymphocytes by the presence of T cell receptors (TCRs) on their cell surface. One of the functions of T cells is to mediate immune-mediated cell death, which is carried out by two main subtypes: CD8+ “cytotoxic” T cells and CD4+ “helper” T cells. CD8+ T cells are cytotoxic, meaning they are able to directly kill selected cells. According to the invention, these selected cells are tumor cells (such as cancer cells). CD4+ cells act as “helper cells.” Unlike CD8+ cytotoxic T cells, these CD4+ helper T cells function by further activating memory B cells and cytotoxic T cells, resulting in a stronger immune response against tumor cells according to the invention. The specific adaptive immune response regulated by T helper cells depends on their subtype, which is distinguished by the types of cytokines they secrete. The T cells are preferably CD8+ cytotoxic T cells or a mixture of CD8+ cytotoxic T cells and CD4+ helper T cells.
[0099] Natural killer (NK) cells are key cytotoxic lymphocytes in the innate immune system, belonging to the rapidly expanding family of innate lymphocytes (ILCs), comprising 5-20% of all circulating lymphocytes in humans. NK cells play a role in the innate immune system similar to cytotoxic T cells in the adaptive immune response of vertebrates. NK cells provide a rapid response to virus-infected cells and other intracellular pathogens, becoming active approximately 3 days after infection, and responding to tumor formation. Normally, immune cells detect the major histocompatibility complex (MHC) presented on the surface of infected cells, triggering the release of cytokines that lead to the death of infected cells through lysis or apoptosis. However, NK cells are unique because they are able to recognize and kill stressed cells in the absence of antibodies and MHC, allowing for a more rapid immune response. They are named "natural killer cells" because they do not require activation to kill cells lacking the class I MHC "self" marker. This role is particularly important because harmful cells lacking the class I MHC marker cannot be detected and destroyed by other immune cells, such as T cells.
[0100] The anti-tumor leukocytes are preferably chimeric antigen receptor T cells (CAR T cells), T cell receptor engineered T cells (TCR T cells), chimeric antigen receptor NK cells (CAR NK cells), NK cell receptor engineered NK cells (NCR NK cells), TCR / CAR hybrid T cells, NCR / CAR hybrid NK cells, chimeric antigen receptor macrophages (CAR macrophages), or tumor-infiltrating lymphocytes (TILs).
[0101] Chimeric antigen receptor (CAR) T cells are T cells that have been genetically engineered to produce chimeric T cell receptors (CARs) for immunotherapy. These receptors are chimeric because they combine antigen-binding and T cell activation functions into a single receptor. CAR-T cell therapy uses CAR-engineered T cells to treat tumors such as cancer. At the heart of CAR-T immunotherapy is the modification of T cells to recognize tumor cells, thereby more effectively targeting and destroying them. To generate CAR T cells, T cells are harvested from a subject, genetically modified, and then infused back into the patient to attack the subject's tumor. CAR T cells can be CD4+ and / or CD8+ cells. A 1:1 ratio of the two cell types is preferred because it provides a synergistic anti-tumor effect.
[0102] CAR T cells are engineered to be specifically transferred to immune effector cells (such as T cells) that specifically eliminate tumor cells carrying antigens. The CAR may contain antibody-derived scFv, CD3ζ, and a transmembrane domain (so-called first-generation CARs). In this way, the engineered CAR can recognize specific tumor-associated antigens. Therefore, the CAR can bind to unprocessed tumor surface antigens without MHC processing, while the TCR binds to both intracellular anti-stress peptides and surface antigen peptides embedded in MHC molecules.
[0103] In contrast, TCRs are α / β heterodimers that bind MHC-binding antigens. As discussed above, CARs recognize tumor antigens, leading to T cell activation, and their function differs from that of TCRs. CAR-T cell therapy suffers from off-target toxicity when targeting tumor-specific antigens. Compared to CARs, TCRs have several structural advantages in T cell-based therapies, such as more subunits in their receptor structure (10 subunits vs. 1 subunit), more immune receptor tyrosine activation motifs (ITAMs) (10 vs. 3), less antigen dependence (1 vs. 100), and more co-stimulatory receptors (CD3, CD4, CD28, etc.) (Zhao et al. (2021) Front. Immunol., | https: / / doi.org / 10.3389 / fimmu.2021.658753).
[0104] The difference between CAR NK cells and CAR T cells is that the chimeric antigen receptor is introduced into NK cells instead of T cells. Like CAR T cells, CAR-NK cells can be engineered to target multiple antigens, enhance their proliferation and persistence in vivo, increase their infiltration into solid tumors, overcome the resistant tumor microenvironment, and ultimately achieve an effective anti-tumor response.
[0105] The difference between CAR macrophages and CAR T cells / CAR NK cells lies in the introduction of chimeric antigen receptors into macrophages. Like CAR T cells / CAR NK cells, CAR macrophages can be engineered to target multiple antigens, enhance in vivo persistence, increase infiltration into solid tumors, overcome the resistant tumor microenvironment, and ultimately achieve an effective anti-tumor response.
[0106] Natural cytotoxic receptor (NCR) NK cells are genetically engineered NK cells that express the NCR. The NCR has been proposed to bind to numerous cellular ligands associated with NK cell surveillance of tumor cells. Many of these interactions have been shown to induce NK cell cytotoxicity and cytokine secretion. However, the NCR may also modulate other anti-tumor pathways. The NCR and its ligands have been successfully targeted for tumor immunotherapy, such as cancer. The NCR is classically defined as an activated receptor that delivers potent signals to NK cells to lyse harmful cells and produce inflammatory cytokines.
[0107] TCR / CAR hybrid T cells are T cells that have been genetically engineered to express both TCR and CAR. Similarly, NCR / CAR hybrid NK cells are T cells that have been genetically engineered to express both NCR and CAR.
[0108] Tumor-infiltrating lymphocytes (TILs) are white blood cells that have left the bloodstream and migrated towards the tumor. TILs are involved in killing tumor cells. The presence of lymphocytes in a tumor is generally associated with better clinical outcomes.
[0109] The tumor-infiltrating lymphocytes are preferably tumor-infiltrating T cells or tumor-infiltrating NK cells.
[0110] In adoptive T-cell transfer therapy, TILs are expanded in vitro from surgically resected tumors (cut into small fragments) or from single-cell suspensions isolated from tumor fragments. Multiple separate cultures are established, cultured individually, and their tumor-specific recognition ability is assessed. TILs are typically expanded in 24-well plates with a high dose of IL-2 for several weeks. Then, selected TIL lines exhibiting optimal tumor responsiveness are further expanded in a “rapid expansion protocol (REP),” which uses anti-CD3 activation, typically for two weeks. After the final REP, the TILs are infused back into the patient to treat the patient’s tumor. This also applies to adoptive NK-cell transfer using TILs.
[0111] Furthermore, the anti-tumor lymphocytes are preferably autologous anti-tumor lymphocytes.
[0112] In autologous lymphocyte-based antitumor therapies, lymphocytes are obtained from a subject with a tumor, genetically engineered (e.g., to produce CAR T cells) and / or selected and / or expanded (e.g., to produce TILs) outside the body, and then infused back into the same subject. These autologous therapies are subject-specific because the therapeutic cells are produced by the subject's own cells.
[0113] The present invention also relates to a transgenic animal, preferably a non-human transgenic animal comprising the vector of the present invention or a combination of two vectors.
[0114] Transgenic animals can be used to produce antibodies, as reviewed, for example, in Brüggemann (2014), Arch Immunol TherExp (Warsz). 2015; 63 (2): 101–108. The transgenic animals are preferably mammals other than humans. Antibodies can also be produced in a manner that allows them to be obtained from the milk of the transgenic mammal. Therefore, the mammals are preferably goats, sheep, or cows.
[0115] The fifth aspect of the invention relates to a method for producing an antibody of the first aspect, comprising (a) culturing a host of the fourth aspect under conditions that allow for the synthesis of the antibody; and (b) recovering the antibody from the culture.
[0116] In the discussion of various embodiments of the invention below, the term "antibody" should be understood to optionally include protein compounds as defined in any one of (a) to (j), and, where applicable, non-protein compounds as defined in any one of (a) to (j).
[0117] The term "culture" refers to the process of growing host cells under controlled conditions. These conditions can vary depending on the host cells used. Methods for establishing optimized culture conditions are well known to those skilled in the art. Furthermore, methods for establishing, maintaining, and manipulating cell cultures have been extensively described in the prior art.
[0118] The methods for isolating the antibodies of this invention are well known in the art, including but not limited to ion exchange chromatography, gel filtration chromatography (size exclusion chromatography), affinity chromatography, high performance liquid chromatography (HPLC), reversed phase HPLC, disk gel electrophoresis, or immunoprecipitation, for example, see Antibody Purification Handbook, GE Healthcare, 18-1037-46.
[0119] In this invention, "recovering the antibody from the culture" refers to obtaining a process product, whereby a process can be induced in a host cell through which information in a nucleic acid molecule encoding the antibody of this invention is used for the synthesis of the antibody of this invention. Multiple steps in this process can be modulated by methods known in the art, including transcription, RNA splicing, translation, and post-translational modifications of the antibody of this invention. Therefore, such modulation allows control over the timing, location, and amount of antibody production.
[0120] The sixth aspect of the invention relates to a diagnostic or pharmaceutical composition comprising the antibody, nucleic acid molecule or a group of two nucleic acid molecules, a vector or a group of two vectors, or a host cell (or a combination thereof).
[0121] According to the present invention, the term "pharmaceutical composition" refers to a composition intended for administration to a subject (preferably a human subject). Regarding the pharmaceutical composition, the subject may be a patient, i.e., a subject suffering from a disease. According to the present invention, the term "diagnostic composition" also refers to a composition intended for administration to a subject (preferably a human subject). "Diagnostic composition" may also refer to a composition intended for contact with a sample from a subject (preferably a human subject) under in vitro or ex vivo conditions.
[0122] The diagnostic or pharmaceutical compositions of the present invention comprise the compounds described above. They may optionally comprise other molecules capable of altering the properties of the compounds of the present invention, thereby, for example, stabilizing, modulating, and / or activating their function. The compositions may be in solid or liquid form or any other suitable form, and in particular may be in the form of powder, tablets, solutions, or aerosols. The compositions may optionally additionally comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutically acceptable carriers are well known in the art, including phosphate-buffered saline solutions, water, emulsions (such as oil / water emulsions), various types of wetting agents, sterile solutions, organic solvents, including dimethyl sulfoxide (DMSO), etc. Compositions comprising such carriers can be formulated using known conventional methods.
[0123] Diagnostic compositions are used to diagnose diseases (e.g., the presence, location, and / or severity of a disease) in a subject or in vitro or ex vivo based on samples from the subject, while pharmaceutical compositions are used to treat or prevent the development of a disease in a subject.
[0124] The pharmaceutical composition may be administered to subjects at an appropriate dose to achieve a therapeutic or disease prevention effect. The dosing regimen will be determined by the attending physician based on clinical factors. As is known in the medical field, the dose for any patient depends on many factors, including the patient's body size, body surface area, age, the specific compound to be administered, sex, time and route of administration, overall health condition, and other medications administered concurrently. The therapeutically effective dose in a given situation can be readily determined through routine testing and is within the skill and judgment of a general clinician or physician. Typically, the routine dosing regimen for the pharmaceutical composition should be 1 to 50 mg antibody / kg body weight every 1, 2, 3, or 4 weeks. However, a more preferred dose may be 2 to 25 mg / kg every 1, 2, 3, or 4 weeks, or even more preferably 3 to 20 mg / kg every 1, 2, 3, or 4 weeks. The treatment duration required to observe changes and the time interval for a response after treatment depend on the desired effect. The specific dose can be determined through routine testing known to those skilled in the art.
[0125] The seventh aspect of the invention relates to the use of the antibody, nucleic acid molecule or a group of two nucleic acid molecules, a vector or a group of two vectors or host cells of the invention in a method for treating, inhibiting or diagnosing tumors in vivo, wherein the tumor is preferably a T-cell tumor, lymphoma or leukemia, and most preferably a T-cell lymphoma or acute lymphoblastic leukemia.
[0126] The tumor may be benign or malignant, preferably malignant. Malignant tumors are also referred to herein as cancer. The tumor is also preferably a solid tumor, and the cancer is preferably a solid carcinoma.
[0127] Alternatively, the tumor is preferably a T-cell tumor, lymphoma, or leukemia, most preferably a T-cell lymphoma or acute lymphoblastic leukemia. As discussed above, targeting CD7 is particularly useful in the diagnosis and treatment of these types of tumors.
[0128] With regard to the embodiments characterized in this specification, and particularly in the claims, it is intended that each embodiment mentioned in a dependent claim be combined with each embodiment of each (independent or dependent) claim to which the dependent claim is to be. For example, in a case where independent claim 1 lists three alternatives A, B, and C, dependent claim 2 lists three alternatives D, E, and F, and claim 3 depends on claims 1 and 2 and lists three alternatives G, H, and I, it should be understood that this specification expressly discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless otherwise specifically stated.
[0129] Similarly, even where no alternatives are listed in the independent and / or dependent claims, it should be understood that any combination of the subject matter covered by a dependent claim is considered explicitly disclosed if it references multiple preceding claims. For example, in the case of independent claim 1, dependent claim 2 which is dependent on claim 1, and dependent claim 3 which is dependent on claims 2 and 1, the combination of the subject matter of claims 3 and 1, as well as the combination of the subject matter of claims 3, 2, and 1, are all explicitly disclosed. If there is a further dependent claim 4 which is dependent on any one of claims 1 to 3, then the combination of the subject matter of claims 4 and 1, the combination of the subject matter of claims 4, 2, and 1, the combination of the subject matter of claims 4, 3, and 1, and the combination of the subject matter of claims 4, 3, 2, and 1 are all explicitly disclosed.
[0130] The above considerations also apply to all appended claims.
[0131] The attached diagram is described below: Figure 1. Generation and identification of humanized TH69. (a) Heavy chain variable region (V) of humanized mouse TH69 (mTH69) transplanted via CDR. H ), and the light chain variable region (V) amplified from B cell RNA from 8 human donors. L(a) FVV fragments were used to generate a single-chain Fv (scFv) antibody library. Humanized TH69 (huTH69) was isolated from the library by two rounds of phage display panning on the CD7-positive cell line CEM. (b) Amino acid sequences of the heavy chain variable region and light chain variable region of TH69 before (mVH / mVL; SEQ ID NO: 21 and 22) and after (huVH / huVL; SEQ ID NO: 1 and 2) humanization by CDR transplantation or guided selection. The complementarity-determining region (CDR) is marked according to the IMGT definition (bold / underline). Reversion mutations in the heavy chain variable region are indicated in red. CDR: complementarity-determining region; VH: heavy chain variable region; VL: light chain variable region.
[0132] Figure 2: Humanized scFv huTH69 specifically binds to CD7 in a cell-linked immunosorbent assay (ELISA). 1×10 6 One black CEM cell (1×10⁶ cells) of unincubated parental mTH69. 6 CEM cells (gray) pre-incubated with parental mTH69 and 1×10 6 CD7 knockout CEM cells (CD7-KO-CEM, white), with 1×10 10 One colony-forming unit (CFU) was used to incubate huTH69 or mTH69 as the scFv phage. HER2-specific phage (4D5-scFv) was used as a negative control. Mean ± SEM of n = 3 independent experiments, *p ≤ 0.05, two-way ANOVA (Bonferroni post-hoc test).
[0133] Figure 3. Purification and binding properties of optimized humanized TH69. (a) Schematic diagram of the structure of chimeric and humanized TH69 antibodies. The schematic IgG1 model structure is based on the pdb file provided by Dr. Mike Clark and modified using Chimera X and MODELLER software (Clark, MR Chem Immunol, 1997. 65: p. 88-110.; Goddard, TD, et al., Protein Sci, 2018. 27 (1): p. 14-25.; Sali, A. and TL Blundell, J Mol Biol, 1993. 234 (3): p. 779-815.). In huTH69-DE, red marks indicate: CDRs as defined by IMGT and four reversion mutations to the murine V gene between CDR2 and CDR3. (b) Purity of huTH69-DE and chimTH69-DE was analyzed by size exclusion chromatography. (c) Purity and molecular weight of huTH69-DE relative to chimTH69-DE were verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Coomassie brilliant blue staining) and Western blot analysis (immunoassay for heavy and light chains (HC and LC)) under reducing and non-reducing conditions. (d) Concentration-dependent binding of huTH69-DE relative to chimTH69-DE was tested by flow cytometry on the CD7-positive cell line CEM. Mean ± SEM of three independent experiments.
[0134] Figure 4. Stability characteristics of Fc-engineered humanized TH69 antibody. Stability of wild-type and Fc-optimized TH69 variants relative to the approved human IgG1 antibody cetuximab and tafasitamab-like antibody (CD19-DE) was tested in a thermal migration assay. Mean ± SEM of 3 independent experiments.
[0135] Figure 5. The humanized and Fc-optimized antibody huTH69-DE triggered effective FcγR-mediated effector function in different T-ALL cell lines, comparable to chimTH69-DE. (a) In a standard chromium release assay, antibody-dependent cytotoxicity (ADCC) was measured for 4 hours in CD7-positive tumor cell lines (CEM, HSB-2, and MOLT-16) with increasing concentrations of each antibody and peripheral blood mononuclear cells (PBMCs) from healthy donors at an effector cell:target cell (E:T) ratio of 40:1. Antibody-mediated tumor cell lysis was calculated for huTH69-DE, chimTH69-DE, chimTH69-wt, and the control antibody 4D5-DE. (a) Mean ± SEM of n = 3 independent experiments, *p ≤ 0.05, no significant difference in ns, two-way ANOVA (Bonferroni post-hoc test) (black *: huTH69-DE vs. chimTH69-DE; color *: DE vs. wt). (b) High-throughput fluorescence microscopy analysis for 4 hours was performed to assess antibody-dependent cell-mediated phagocytosis (ADCP). CEM, HSB-2, and MOLT-16 cells were labeled with pH-sensitive red fluorescent dyes and incubated with polarized M0 macrophages and 10 μg / ml of each antibody at a 1:1 E:T ratio. Phagocytosis was expressed as the number of red targets per image. Mean ± SEM of n = 3 independent experiments, *p ≤ 0.05, no significant difference in ns, two-way ANOVA (Bonferroni post-hoc test).
[0136] Figure 6. Fc-optimized huTH69-DE exhibits similar internalization kinetics to chimTH69-DE in CD7-positive cell lines. Internalization of chimTH69-DE and huTH69-DE (1 μg / ml) in CD7-positive cell lines (CEM, HSB-2, MOLT-16) was measured within 24 hours using high-throughput fluorescence microscopy. Antibodies were labeled with a pH-sensitive red fluorescent dye. CD19-DE antibody and untreated cells served as negative controls. Internalization was measured as the total red target area (μm²) per image. 2 The mean of n=3 independent experiments ± SEM, *p≤0.05, ns showed no significant difference, and a two-way ANOVA (Bonferroni post-hoc test) was used.
[0137] Figure 7. The direct antiproliferative effect mediated by the Fc-optimized antibody-drug conjugate (ADC) huTH69-DE-MMAE on cell lines with high CD7 expression is comparable to that of the chimeric ADC chimTH69-DE-MMAE. (A) CD7-positive cell line HSB-2 was treated with increasing concentrations of huTH69-DE-MMAE, chimTH69-DE-MMAE, huTH69-DE, or chimTH69-DE for 96 hours, and cell viability was assessed by MTT assay. n = mean ± SEM of 3 independent experiments. (B) As a control for antigen-specific effects, cells were pretreated with a 10-fold molar excess of parental mouse TH69 antibody for 30 minutes to mask the CD7 epitope (blocking), and then incubated with huTH69-DE-MMAE (2.08 nM) for 96 hours. Cell viability was assessed by MTT assay. n = mean ± SEM of 3 independent experiments.
[0138] Figure 8. The direct antiproliferative effect mediated by the Fc-optimized ADC huTH69-DE-MMAE on CD7-positive cell lines with low CD7 expression was higher than that mediated by the chimeric ADC chimTH69-DE-MMAE. (AB) CD7-positive cell lines CEM (A) and Karpas-45 (B) with intermediate to low CD7 expression were treated with increasing concentrations of huTH69-DE-MMAE, chimTH69-DE-MMAE, huTH69-DE, or chimTH69-DE for 96 hours, and cell viability was measured by MTT assay. n = mean ± SEM of 3 independent experiments, *p≤0.05 (huTH69-DE-MMAE vs. chimTH69-DE-MMAE), two-way ANOVA (Tukey multiple comparison test). (C) As a control, CD7 knockout cell line CEM-CD7KO was treated with increasing concentrations of huTH69-DE-MMAE, chimTH69-DE-MMAE, huTH69-DE, or chimTH69-DE for 96 hours, and cell viability was determined by MTT assay. The mean ± SEM of n=2 independent experiments is presented.
[0139] Figure 9: Strategies employed for the humanization of TH69. (A) In the first humanization strategy, both the heavy and light variable regions of mouse TH69 (mTH69) were humanized via CDR transplantation (CDR-huTH69). (B) In the second humanization strategy, an scFv antibody library was generated from the CDR-transplanted humanized mouse TH69 heavy variable region and light variable region fragments (κ and λ light chains) amplified from B cell RNA from eight human donors. As described in the examples above, our final candidate (huTH69) was isolated from the candidate library through two rounds of phage display screening (panning) on the CD7-positive cell line CEM.
[0140] Figure 10: Purification of huTH69 generated by CDR transplantation of heavy chain variable regions and light chain variable regions. (A) Schematic diagram of the structure of the CDR-transplanted humanized TH69 antibody (CDR-huTH69) and the hybrid TH69 antibody (hybTH69-huVH-chimVL) composed of CDR-transplanted heavy chain and chimeric light chain. (B) Purity of CDR-huTH69 and hybTH69-huVH-chimVL relative to chimTH69 analyzed by size exclusion chromatography. (C) SDS-PAGE (Coomassie Brilliant Blue staining) under reducing and non-reducing conditions to verify the purity and molecular weight of CDR-huTH69 and the hybrid antibody relative to control IgG1.
[0141] Figure 11: Characterization of huTH69 generated by CDR transplantation of heavy chain variable regions and light chain variable regions. (A) Schematic diagram of the structure of CDR-transplanted humanized TH69 antibody (CDR-huTH69). (B) Concentration-dependent binding of CDR-huTH69 to chimTH69 was tested by flow cytometry on the CD7-positive cell line CEM. A representative experiment is presented. (C) In a standard chromium release assay, CD7-positive tumor cell line (CEM) was subjected to ADCC assays for 4 hours with increasing concentrations of each antibody and peripheral blood mononuclear cells (PBMCs) from healthy donors at an effector:target (E:T) ratio of 40:1. Tumor cell lysis rates of CDR-huTH69-wt, chimTH69-wt, and control antibody 4D5-wt were calculated. (A) Mean ± SEM from three independent experiments, *p≤0.05, no significant difference in ns, two-way ANOVA (Bonferroni post-hoc test). (D) Schematic diagram of the structure of the hybrid TH69 antibody (hybTH69-huVH-chimVL) composed of CDR transplanted heavy chain and chimeric light chain. (E) Concentration-dependent binding of hybTH69-huVH-chimVL to chimTH69 tested by flow cytometry on CD7-positive cell line CEM. Mean ± SEM from three independent experiments, *p≤0.05, no significant difference in ns, two-way ANOVA (Bonferroni post-hoc test). (F) ADCC assay of CD7-positive tumor cell line (CEM) at a standard chromium release assay with increasing concentrations of each antibody and PBMCs from healthy donors at an E:T ratio of 40:1. The tumor cell lysis rates of hybTH69-huVH-chimVL, chimTH69-wt, and the control antibody 4D5-DE were calculated. The mean ± SEM of three independent experiments were used; *p≤0.05, ns showed no significant difference. Two-way ANOVA (Bonferroni post-hoc test) was employed.
[0142] Figure 12: Binding analysis of monoclonal phage antibodies. (A+B) 1×10 6 One CEM cell (CD7 positive; black) and 1×10 6SKBR3 cells (CD7 negative; white) were incubated with phages displaying huTH69-scFv candidates (CDR transplanted heavy chain variable region and κ light chain (A) or λ light chain (B)) or mTH69-scFv and tested by ELISA. Phages bound to the cell surface were detected using anti-M13-HRP antibody, and absorbance was measured at 405 nm after incubation with ABTS substrate. (C) 1×10 6 1 CEM cell (CD7 positive; black), 1×10 6 10 CD7 knockout CEM cells (CD7KO-CEM; CD7 negative; white) and 1×10 6 CEM cells (gray) pre-incubated with parental mTH69, with 1×10⁻⁶ cells. 10 Colony-forming units (CFUs) of different huTH69-scFv (κ:κ light chain; λ:λ light chain) or mTH69-scFv phages were incubated and tested using ELISA. HER2-specific phage (4D5-scFv) was used as a negative control. Cell surface-bound phages were detected using anti-M13-HRP antibody, and absorbance at 405 nm was measured after incubation with ABTS substrate.
[0143] Figure 13: Characterization of huTH69-DE conjugated with mertansine (DM1), deruxtecan (Dx), or monomethylolpropionate E (MMAE). (A) Absorption spectra of the generated ADC were measured in the range of 230 nm to 440 nm and compared with equimolar amounts of unconjugated huTH69-DE. Characteristic absorption peaks of the drugs used are indicated by arrows (DM1: 255 nm, Dx: 365 nm, MMAE: 243 nm). (B) Concentration-dependent binding of huTH69-DE ADC was tested by flow cytometry on the CD7-positive cell line CEM.
[0144] Figure 14: Fc-engineered huTH69-DE, after conjugation with maytansin (DM1), deruxtecan (Dx), or monomethylolpropamine E (MMAE), mediates a direct antiproliferative effect against cell lines expressing the target antigen. (AC) CD7-positive cell line CEM and CD7 knockout cell line CEM-CD7KO were treated with increasing concentrations of huTH69-DE-DM1 (A), huTH69-DE-Dx (B), and huTH69-DE-MMAE (C) for 96 hours, and cell viability was determined by MTT assay. The unconjugated antibody huTH69-DE served as a control. Mean ± SEM of two independent assays.
[0145] Figure 15: The humanized antibody huTH69 exerts a direct antiproliferative effect on cell lines expressing the target antigen after non-covalently linking the α-κ-ETA' fusion protein to a truncated Pseudomonas exotoxin A (ETA'). CD7-positive cell lines CEM were treated with escalating concentrations of huTH69 for 72 hours in the presence (black) or absence (gray) of 1 μg / ml α-κ-ETA' fusion protein. At a concentration of 1 μg / ml, the α-κ-ETA' fusion protein itself produced only a negligible decrease in cell viability (dashed line). The mean ± SEM of three independent assays is presented.
[0146] Figure 16: Comparison of humanization levels of huTH69, parental antibody mTH69, and various published CD7 antibodies by calculating humanization scores. (AB) OASis identity (A) and OASis percentile (B) of huTH69 (black), parental antibody mTH69 (white), and a group of published CD7 antibodies (gray) were calculated to compare the humanization levels of variable regions (heavy chain variable regions and light chain variable regions).
[0147] Figure 17: Comparison of post-translational modification / degradation susceptibility of huTH69 and various published CD7 antibodies through sequence-based susceptibility motif analysis. The post-translational modification / degradation susceptibility of huTH69 and a group of published CD7 antibodies was analyzed. Methionine (M), aspartic acid isomerization motifs (D (G / S / D / N / R / Y)), and asparagine deamidation motifs (N (G / H / S / N / T / Q / F / W / Y)) in the CDRs of the heavy chain variable region and light chain variable region were rated as highly critical for antibody modification / degradation and were counted for comparison.
[0148] Figure 18: Comparison of effector cell-mediated lysis of leukemia cells by huTH69 and various published CD7 antibodies using a chromium release assay. In the chromium release assay, PBMCs were used as effector cells to analyze the ability of huTH69 to trigger NK cell-mediated leukemia cell lysis relative to other published CD7 antibodies (antibody backbone: human IgG1). (A) Dose-dependent lysis of CEM cells was assessed by a 4-hour chromium release assay at an E:T ratio of 40:1. Data are presented as mean ± SEM from three experiments using different effector cell donors. (B) Differences in the ability to trigger NK cell-mediated lysis were observed at subsaturated concentrations, such as 0.016 μg / ml antibody concentration. (C) The half-maximal effective concentration (EC50) was calculated from the dose-response curves, and the fold change of each CD7 antibody relative to huTH69, set as coefficient 1, was calculated.
[0149] Figure 19: Comparison of complement-dependent cytotoxicity (CDC) of huTH69, chimTH69, and various published CD7 antibodies using a chromium release assay. (AB) In a standard chromium release assay, CDC was measured for 4 hours in CD7-positive tumor cell lines CEM (A) and HSB-2 (B) using 25% concentrations of serum / plasma from different healthy donors with increasing concentrations of huTH69 and chimTH69 (IgG1 wild-type backbone). Mean ± SEM of n=3 independent experiments (CEM) and n=2 independent experiments (HSB-2), *p≤0.05 (huTH69 vs. chimTH69), two-way ANOVA (Bonferroni multiple comparison test). (CD) In the standard chromium release assay, CD7-positive tumor cell lines CEM (C) and HSB-2 (D) were measured for 4 hours using serum / plasma from different healthy donors at a concentration of 25% and with increasing concentrations of huTH69 and each CD7 antibody (IgG1 wild-type backbone). Mean ± SEM of n=3 independent experiments (CEM) and n=2 independent experiments (HSB-2), *p≤0.05 (all antibodies in the huTH69 vs. CD7 antibody group), two-way ANOVA (Dunnett's multiple comparison test).
[0150] Figure 20: Location of the huTH69 epitope in the extracellular region of CD7 determined by screening for single and grouped amino acid exchanges. (A) The extracellular portion of CD7 can be divided into a disordered region and a well-structured immunoglobulin-like domain. (B) A group of CHO-S cells were generated, expressing the human CD7 extracellular region with selected single and grouped amino acid exchanges distributed on the Ig-like domain. (C) Binding of the humanized antibody huTH69, the chimeric antibody chimTH69, and a group of published CD7 antibodies to wild-type CD7 molecules and mutant variants was measured by flow cytometry. MFI: mean fluorescence intensity.
[0151] The examples are used to illustrate the claimed invention.
[0152] Example 1 - Humanized huTH69 antibody retains the binding properties of parental mTH69 antibody To prepare a humanized CD7 antibody based on mTH69, this study employed a strategy combining complementarity-determining region (CDR) transplantation and guided selection (Figure 1a). The heavy chain variable region (VH) of mTH69 was humanized through CDR transplantation. The human V and J genes IGHV3-23 and IGHJ6 were identified as similar to the murine genes of mTH69 and were used as the receptor framework for the CDRs (according to the IMGT definition). Furthermore, four reversion mutations were introduced between CDR2 and CDR3. This increased the percentage of identity of this region with the closest human V gene from 82.7% to 92.9% (Table 1, Figure 1b) (Ehrenmann, F. and MP Lefranc, Cold Spring Harb Protoc, 2011. 2011 (6): p.737-49.).
[0153] Table 1 Humanization Score
[0154] Note: V gene identity % (Ehrenmann, F. and MP Lefranc, Cold Spring HarbProtoc, 2011. 2011 (6): p. 737-49.; Jones, TD, et al., MAbs, 2016. 8 (1): p. 1-9.); T20 score (Gao, SH, et al., BMC Biotechnol, 2013. 13: p. 55.); OASis identity (Prihoda, D., et al., MAbs, 2022. 14 (1): p. 2020203.) According to the 2014 definitions of the World Health Organization and the American Medical Association, the constructed VH can be assessed as humanized (identity ≥85%) (Jones, TD, et al., MAbs, 2016. 8 (1): p. 1-9.). Furthermore, two different scoring systems were used to analyze its degree of humanization: the T20 score based on multiple sequence alignment of the human antibody library increased from 79.40 to 88.58, reaching the human-like standard (>80) (Gao, SH, et al., BMC Biotechnol, 2013. 13: p. 55.). Based on a comparison of the 9-peptide with a human antibody peptide database (medium threshold), the OASis identity was improved from 55% to 75%, consistent with the levels of other approved humanized antibodies (Table 1) (Prihoda, D., et al., MAbs, 2022. 14(1): p. 2020203.). Both scoring systems showed that the increased degree of humanization was associated with a decrease in clinical immunogenicity, therefore the humanized VH of this invention is expected to reduce the risk of clinical immunogenicity (Gao, SH, et al., BMC Biotechnol, 2013. 13: p. 55.; Prihoda, D., et al., MAbs, 2022. 14(1): p. 2020203.).
[0155] For the humanization of the light chain (LC), this study employed a substitution strategy, replacing the mTH69 VL with a full-length human light chain variable region (VL) through guided selection (Fig. 1a). To this end, total RNA was isolated from B cells of eight healthy donors, and a human light chain variable region library was prepared (Fig. 1a), with RNA integrity verified. cDNA was synthesized using the mixed total RNA as a template, and the κ LC light chain variable region was amplified using a degenerate primer mixture. In parallel, the heavy chain variable region was amplified using humanized TH69 heavy chain (HC) as a template. The heavy chain and light chain variable regions were assembled by PCR, generating a fragment of approximately 800 bp, which was inserted into pJB12 phagemids and transformed into XL1 Blue E. coli, yielding 1.4 × 10¹² fragments. 8 The colony-forming units (CFU) were estimated to be 100% using colony-selective PCR. Panning was performed using the CD7-positive T-ALL cell line CEM. After the first and second rounds of panning, 24,990 and 1×10⁶ cells were eluted from the cells, respectively. 7 One phage, enriched by 36 times (Table 2).
[0156] Table 2. Enrichment of phages by panning CFU = Colony Forming Unit; Ratio = Output Phage Count / Input Phage Count; Enrichment Factor = Second Round Ratio / First Round Ratio
[0157] Following the second round of selection, phage particles were prepared from 18 bacterial colonies and analyzed using Sanger sequencing. Seventeen candidate strains shared the same scFv nucleotide sequence (named huTH69-scFv) and exhibited specific binding to CEM cells in the initial whole-cell phage ELISA, while the remaining candidate strain showed no binding activity (data not shown). The V and J genes of the isolated huTH69-scFv human VL were identified as IGKV1-39 and IGKJ4, respectively. Figure 1 b). The calculated percentage of identity between VL and IGKV1-39 was 92.9%. Therefore, the full-length huTH69 antibody can be assessed as humanized (Table 1). Furthermore, based on the calculated T20 score (91.12) and OASis identity (100%), this VL can be assessed as human-like or human (Table 1).
[0158] To rule out potential significant epitope drift, the binding characteristics of phages displaying huTH69-scFv or mTH69-scFv were compared in whole-cell ELISA. The results showed that pre-incubation of CEM cells with the parental mTH69 antibody significantly blocked the binding of both huTH69-scFv and mTH69-scFv, and neither bound to CD7 knockout CEM cells (CD7-KO-CEM), indicating that huTH69-scFv and mTH69 have the same specificity for CD7 (Figure 2).
[0159] To further characterize the novel humanized variable region biochemically and functionally, huTH69-scFv and mTH69-scFv were converted into human IgG1 antibodies containing the κ light chain (Figure 3a). To improve Fc-mediated effector function, S239D and I332E amino acid substitutions (DE modification) were introduced into the CH2 domain of the Fc moiety to enhance FcγR binding (Lazar, GA, et al., Proc Natl Acad Sci USA, 2006. 103 (11): p. 4005-10.). Humanized (huTH69-DE) and chimeric (chimTH69-DE) Fc engineered antibody variants were produced in Chinese hamster ovary cells and purified by affinity chromatography and size exclusion chromatography (SEC). Purity and molecular weight were verified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) combined with Coomassie brilliant blue staining or immunoblotting (Figure 3c). Under non-reducing conditions, the theoretical molecular weight of the huTH69-DE antibody was approximately 150 kDa; under reducing conditions, the expected molecular weights of the heavy and light chains were approximately 50 kDa and 25 kDa, respectively, similar to the chimeric antibody variant chimTH69-DE (Figure 3c). SEC analysis verified antibody purity by a single protein peak (Figure 3b). No high molecular weight peak was detected, indicating that humanization did not lead to antibody aggregation. To determine the affinity of chimeric and humanized TH69 antibodies, Fab fragments were prepared from IgG, and their binding to the CD7-Fc fusion protein was analyzed by surface plasmon resonance (SPR) spectroscopy. The equilibrium dissociation constants (K0) of humanized TH69 and chimeric TH69 were also determined. D The concentrations were 1.79 nM and 0.265 nM, respectively, indicating a slight decrease in affinity after humanization. In the bivalent IgG form, huTH69-DE and chimTH69-DE showed almost identical concentration-dependent binding activity to CD7-positive CEM cells in flow cytometry, with half-maximal effective concentrations (EC50) of 1.79 nM and 0.265 nM, respectively.50 Both were within the nanomolar range (huTH69-DE: 10.11 nM; chimTH69-DE: 13.67 nM) (Figure 3d). These data suggest that the affinity effect in the IgG form may compensate for the loss of affinity.
[0160] Example 2 - Fc-engineered huTH69 antibody exhibits high thermal stability and good developability. The thermal stability of the novel antibodies was assessed using a thermal migration assay. The Fc-engineered chimeric and humanized TH69 antibodies showed similar melting curves, with melting temperatures of 50°C and 50.3°C, respectively (Figure 4). As reported regarding the clinically approved CD19 antibody tafasitamab (MOR208, melting temperature 47°C (Amersdorffer J., et al., US Patent 20140227277. 2012.), and the tafasitamab-like antibody CD19-DE, melting temperature 49.8°C), the melting temperature of the Fc-engineered antibody variants was lower than that of the unmodified human IgG1 antibody due to DE modification of the Fc portion. To rule out the possibility that DE modification masked the negative impact of humanization on thermal stability, the thermal migration assay was repeated using Fc wild-type antibodies (chimTH69-wt and huTH69-wt). The results showed that the melting curves and melting temperatures of chimeric and humanized TH69 antibodies were still similar (chimTH69-wt: 70.6℃; huTH69-wt: 72.3℃), which is at the same level as the melting temperature of approved IgG1 antibodies (such as cetuximab, melting temperature 69.9℃).
[0161] Further extended biochemical / biophysical characterization of the novel humanized antibody huTH69-DE was conducted to preliminarily rule out post-translational modifications or degradations that might adversely affect clinical development. First, the amino acid sequence was successfully validated by peptide mapping using liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS). Subsequently, common post-translational modification sites or degradations in the variable region of huTH69-DE were predicted through sequence analysis, and experimental validation was performed using LC-ESI-MS data. Sequence analysis showed that there were no N-glycosylation sites or additional unpaired cysteine residues in the variable regions of both the heavy and light chains of huTH69-DE (Table 3).
[0162] Table 3. Predicted and detected post-translational modifications / degradations in the heavy and light chain variable regions of huTH69-DE. nd = Not detected; X1 = Any amino acid except proline; X2 = Any amino acid; Bold mutation = Occurred in CDR
[0163] The V region contains three easily oxidized methionine amino acids, two of which are located in the VH region and one in the VL region. Only 1.3% (relative content) of the methionine at site M24 in the VL region was oxidized, and only 2.4% (relative content) of the methionine at site M101 in the VH region was oxidized, while the methionine at site M53 in the VH region remained unoxidized (Table 3). Furthermore, these low-frequency oxidation sites are located outside the complementarity-determining region and may not affect the activity of humanized antibodies. Asparagine deamidation, aspartic acid isomerization, and lysine glycosylation are associated with susceptible motifs and can be used to predict potential degradation / modification of antibody sequences (Lu, X., et al., MAbs, 2019. 11 (1): p. 45-57.; Jacobitz, AW, et al., J Pharm Sci, 2020. 109 (1): p. 293-300). Four asparagine deamidation motifs, three aspartic acid isomerization motifs, and one lysine glycosylation motif (located in the complementarity-determining region) were found in the variable region of huTH69-DE. However, these modifications / degradations were not detected in LC-ESI-MS analysis (Table 3). Based on LC-ESI-MS data, no other post-translational modifications or degradations were predicted or observed in the variable region of huTH69-DE.
[0164] The charge variants of monoclonal antibodies describe the sum of modifications and degradations that may occur during the manufacturing process. Capillary isoelectric focusing (cIEF) analysis of the isoelectric point (pI) and relative charge variants revealed that the isoelectric point of huTH69-DE is 8.47 (52.51% acidic peak, 38.04% main peak, and 9.46% basic peak). Analytical data from 23 published approved monoclonal antibodies (Goyon, A., et al., J Chromatogr B Analyt Technol Biomed Life Sci, 2017. 1065-1066: p. 119-128.) show isoelectric points ranging from 6.1 to 9.4 (18%-60% acidic peak, 20%-70% main peak, and 1%-40% basic peak), confirming that the novel humanized antibody of this invention is within the successful development range for clinically approved monoclonal antibodies. By customizing and optimizing the manufacturing process of huTH69-DE, further reductions in charge variants can be achieved. In summary, these data indicate that no features were found that could potentially hinder its further clinical development.
[0165] Example 3 - Fc-engineered huTH69-DE antibody induces natural killer cell-mediated leukemia cell killing and macrophage-mediated phagocytosis, and exhibits similar internalization kinetics in CD7-positive cell lines. To investigate whether the humanized and Fc-optimized TH69 antibody could trigger Fc-mediated effector functions as effectively as the chimeric TH69-DE antibody, antibody-dependent cytotoxicity (ADCC) and antibody-dependent phagocytosis (ADCP) were measured using T-ALL cell lines CEM, MOLT-16, and HSB-2. Comparable ADCC activity was observed in all CD7-positive T-ALL cell lines. huTH69-DE and chimTH69-DE induced tumor cell lysis in a strictly dose-dependent manner (Figure 5a). No significant difference was found in tumor lysis of MOLT-16 and HSB-2 cells between the humanized and chimeric Fc-optimized antibody variants. Only at specific antibody concentrations did a small but significant difference exist in tumor lysis of CEM cells (black *). Nevertheless, the huTH69-DE antibody achieved a median effective concentration (EC50) for all three T-ALL cell lines. 50 The values (CEM: 12.75 pM; MOLT16: 9.7 pM; HSB-2: 2.62 pM) and the EC50 values of the chimTH69-DE antibody were compared. 50 The values (CEM: 8.83 pM; MOLT16: 6.93 pM; HSB-2: 2.94 pM) were comparable. Compared with the chimeric wild-type antibody chimTH69-wt, the Fc-optimized antibody variant showed significantly higher tumor lysis efficiency against T-ALL cell lines. Figure 5 a) Using CEM, MOLT-16, and HSB-2 cells as target cell lines and monocyte-derived macrophages from healthy donors as effector cells, the phagocytic activity of TH69 antibody variants was compared (Figure 5b). The huTH69-DE antibody triggered significant ADCP in different T-ALL cell lines, with effects comparable to the chimeric antibody variants chimTH69-DE and chimTH69-wt (Figure 5b). In summary, the humanized Fc-engineered antibody huTH69-DE can mediate ADCC and ADCP in different T-ALL cell lines, with effects comparable to the chimeric Fc-optimized antibody chimTH69-DE, indicating that antibody humanization has no negative impact on its Fc-mediated effector function.
[0166] CD7 is described as a target antigen that can be rapidly internalized after antibody binding, thus representing a suitable target antigen for immunotoxins or antibody-drug conjugates (ADCs). To analyze the internalization kinetics of chimTH69-DE and huTH69-DE in T-ALL cell lines, antibodies were labeled with a pH-sensitive red fluorescent dye and internalization was measured within 24 hours using high-throughput fluorescence microscopy. The results showed that the Fc-optimized antibody variants huTH69-DE and chimTH69-DE had comparable internalization in CD7-positive cell lines CEM, HSB-2, and MOLT-16 (Figure 6). Therefore, similar to chimeric antibodies (Gehlert et al., unpublished), the humanized Fc-engineered antibody huTH69-DE shows promise as a potent ADC. To this end, the huTH69-DE antibody was conjugated to the cytotoxic compound monomethyl olistatin E (MMAE) via a cathepsin B-cleavable linker (mc-vc-PABC) to obtain the ADC huTH69-DE-MMAE. Drug-antibody ratio (DAR) analysis showed that each antibody conjugated with 3.2 MMAE molecules had a DAR. The direct cytotoxic effect of huTH69-DE-MMAE relative to chimTH69-DE-MMAE on the CD7-positive T-ALL cell line HSB-2 was characterized. huTH69-DE-MMAE showed a concentration-dependent reduction in cell viability, similar to chimeric ADCs, with a half-maximal inhibitory concentration (IC50). 50 The concentrations were in the low nanomolar range (Fig. 7A; ~0.13 nM). As additional evidence of the antigen-specific activity of huTH69-DE-MMAE, a blocking experiment was performed. HSB-2 cells were pretreated with an excess of parental mouse TH69 to mask the CD7 epitope, followed by incubation with huTH69-DE-MMAE. As expected, no decrease in cell viability was detected after blocking CD7, demonstrating that huTH69-DE-MMAE possesses target antigen-specific cytotoxicity (Fig. 7B). Interestingly, for the CEM and Karpas-45 cell lines, huTH69-DE-MMAE showed a significantly stronger effect in reducing cell viability than the ADC based on the non-humanized chimeric antibody (chimTH69-DE-MMAE). The IC50 values of the chimeric and humanized ADCs against Karpas-45 cells were measured. 50 The value decreased by 6.45 times (IC). 50 huTH69-DE-MMAE: 1.79 nM vs. IC 50chimTH69-DE-MMAE (11.55 nM), IC50 for CEM cells 50 The value decreased by 2.21 times (IC). 50 huTH69-DE-MMAE: 0.71 nM vs. IC 50 chimTH69-DE-MMAE: 1.57 nM). Furthermore, humanization of TH69 increased the maximum inhibition rates against CEM and Karpas-45 cell lines by 19% and 11%, respectively (Figures 8A-B). To further demonstrate the specificity of huTH69-DE-MMAE, the CD7 knockout cell line CEM-CD7KO was incubated with increasing concentrations of huTH69-DE-MMAE and chimTH69-DE-MMAE. As expected, no significant decrease in the viability of CD7-negative cells was observed, demonstrating that the ADC used had target antigen-specific cytotoxicity. Figure 8 C). For all cell lines used, neither the unconjugated antibodies huTH69-DE nor chimTH69-DE showed any growth inhibition. Figure 7 and Figure 8 ).
[0167] The HSB-2 cell line had the highest number of CD7 molecules on its surface and exhibited the greatest sensitivity to the MMAE ADC. CEM and Karpas-45 cells showed moderate to low CD7 expression levels. However, humanization improved the efficiency of the derived CD7-targeting ADC. These data were largely unexpected, as the humanized antibody variants exhibited reduced binding affinity. Therefore, it is hypothesized that during humanization, the mechanism of action was unexpectedly improved by altering affinity / binding power and possibly slightly changing fine specificity / epitope. For example, these parameters may have altered the mode of action by affecting the intracellular processing of the ADC after internalization (e.g., intracellular transport) or the fate of the bound CD7 molecules after internalization (e.g., CD7 regeneration to the cell surface).
[0168] In summary, Fc-engineered huTH69-DE antibody induced ADCC and ADCP in CD7-positive cell lines and exhibited similar internalization kinetics. Surprisingly, when used for ADCs, huTH69 demonstrated superior performance compared to chimTH69 antibody, particularly effective in targeting cells with low CD7 expression levels and previously considered less sensitive to chimeric antibody-based CD7-targeting ADCs.
[0169] Example 4 - More details on the screening of humanized antibody huTH69 As described in the above embodiments, huTH69 of mTH69 is generated by transplanting the CDR of the heavy chain variable region into the human framework and by guiding the selection of the full-length human light chain variable region from the human κ light chain library through phage display. The unique candidate huTH69 is the result of a combination of the selected humanization strategy and the screening process used.
[0170] TH69 adopts a humanization strategy Currently, the most widely used method for antibody humanization is likely to be the transplantation of the CDRs (Central Derivatives) of the heavy chain variable region (VH) and light chain variable region (VL) of a non-human antibody into a human framework sequence serving as the host. This method has been used for the TH69 antibody. The CDRs of the heavy chain variable region were transplanted into the human genes IGHV3-23 and IGHJ6. In previous unsuccessful attempts, the CDRs of the light chain variable region were also transplanted into the human framework (human genes IGKV1-33 and IGKJ2) (Figure 9A). The humanized antibody “CDR-huTH69” (containing wild-type Fc and DE modifications) was produced in Chinese hamster ovary cells and purified by affinity chromatography and size exclusion chromatography (SEC). Purity and molecular weight were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) combined with Coomassie brilliant blue staining (Figure 10C). Size exclusion chromatography analysis showed a single protein peak, verifying its purity (Figure 10B). However, compared to the chimTH69 antibody, the CDR-huTH69 antibody showed lower molecular weight peaks in size exclusion chromatography and SDS-PAGE. Under non-reducing conditions, the molecular weight of the CDR-huTH69 antibody was approximately 100 kDa, lower than the calculated molecular weight of the IgG1 antibody (approximately 150 kDa) (Figure 10C). Under reducing conditions, the CDR-huTH69 antibody showed only a single protein band with a molecular weight of 50 kDa, instead of the two protein bands (approximately 50 kDa heavy chain and approximately 25 kDa light chain) expected for the control IgG1 antibody (Figure 10C). These results indicate that CDR-huTH69 was incorrectly assembled, lacked humanized light chains after purification (or contained very low levels), or that the CDR-grafted light chains of CDR-huTH69 were degraded after production.
[0171] Based on the above observations, this study planned to verify the characteristics and function of the CDR-transplanted heavy chain by preparing a hybrid TH69 antibody (hybTH69-huVH-chimVL; Figure 10A) composed of a CDR-transplanted heavy chain and a chimeric light chain containing the variable region of the initial mouse antibody. Size exclusion chromatography analysis showed that the single protein peak of this antibody was similar to that of the chimeric TH69 antibody (chimTH69), verifying its purity (Figure 10B). Under non-reducing conditions, the hybTH69-huVH-chimVL antibody showed a molecular weight of approximately 150 kDa (consistent with the calculated value); and under reducing conditions, the expected protein bands of the heavy and light chains with molecular weights of approximately 50 kDa and 25 kDa, respectively, were similar to the control IgG1 antibody (Figure 10C). These results indicate that the full-length IgG antibody containing our CDR-transplanted heavy chain has been correctly produced and purified. In addition, a hybrid antibody (hybTH69-chimVH-CDRhuVL) composed of a chimeric heavy chain containing the variable region of the initial mouse antibody and a CDR transplanted light chain; Figure 10 C) Under reducing conditions, only a protein band with a molecular weight of 50 kDa was shown, consistent with the results of the full-length CDR transplantation antibody CDR-huTH69-wt or CDR-huTH69-DE (Figure 10C), indicating that the problem lies in the light chain.
[0172] Compared to the chimeric TH69 antibody, binding analysis and functional characterization of the CDR-huTH69 antibody (Figure 11A-C) showed lower binding affinity to CD7-positive CEM cells (Figure 11B) and significantly lower ADCC efficacy against the T-ALL cell line CEM (Figure 11C). In contrast, the heterozygous antibody hybTH69-huVH-chimVL (Figure 11D) showed no difference in concentration-dependent binding to CEM cells (Figure 11E) and its ability to induce tumor cell lysis via ADCC (Figure 11F) compared to the chimeric antibody. These results confirm the function of the humanized heavy chain.
[0173] Full-length human κ light chains were prepared by guided selection. Due to the problems arising from the preparation of humanized light chains of TH69 via CDR transplantation, this study employed an alternative method for light chain humanization. As described in Example 1, guided selection was used to replace the variable region of the mTH69 light chain with the variable region of a full-length human light chain. A scFv antibody library was constructed from the humanized VH transplanted from the TH69 CDR, and the VL fragment (κ and λ light chains) was amplified from the RNA of B cells from eight healthy human donors. Figure 9B). The VH of humanized TH69 transplanted with CDR without any problems during preparation and characterization was preserved to prevent potential epitope drift and to accept the CD7 specificity and functional properties of mTH69.
[0174] Two rounds of screening (panning) were performed on CD7-positive cell line CEM using phage display to select candidates from a library (1×10⁻⁶). 8 One κ light chain and 1×10 8 Our final unique candidate, huTH69, was isolated from the κ and λ light chains. Following a second round of panning, phage particles from 18 κ and λ light chain bacterial colonies were prepared, and their specific binding to CD7-positive CEM cells and CD7-negative SKBR3 control cells was analyzed using an initial whole-cell phage ELISA (Fig. 12A+B). Seventeen κ light chain candidates showed specific binding to CD7-positive CEM cells but no binding to CD7-negative control cell lines, while the remaining candidate (K7) showed no binding to CEM cells (Fig. 12A). In contrast, only nine λ light chain candidates showed binding to CD7-positive CEM cells but no or low binding to CD7-negative SKBR3 cells, while the remaining nine candidates showed no binding or nonspecific binding (Fig. 12B). Sanger sequencing analysis revealed that 17 κ light chain candidates binding to CEM cells shared the same scFv nucleotide sequence, while λ light chain candidates exhibited different scFv nucleotide sequences (data not shown). To rule out potential significant epitope drift or CD7-independent binding, the binding characteristics of selected phages displaying huTH69-scFv (with κ and λ light chains having different nucleotide sequences) or mTH69-scFv were further compared by whole-cell ELISA (Figure 12C). Binding of huTH69-K1-scFv (K1: κ light chain candidate sequence used to generate the final huTH69 antibody) and mTH69-scFv was significantly blocked by pre-incubation of CEM cells with parental mTH69 antibody, and no binding was observed with CD7 knockout CEM cells (CD7KO-CEM), indicating that huTH69-K1-scFv and mTH69 have the same CD7 specificity ( Figure 12 C). Different λ light chain candidates showed no binding or binding was unrelated to CD7 in CEM and CD7KO-CEM cells. Figure 12 C).
[0175] In 1×10 8 One κ light chain and 1×10 8Of the λ light chains, only one CD7-specific light chain was enriched by phage display. As described in Example 1, the huTH69-IgG1 antibody containing the humanized CDR transplanted heavy chain and the full-length human light chain has the same binding specificity to CD7 as the chimeric TH69 antibody and can induce effective Fc-mediated effector function.
[0176] Analysis of the humanization scores of the previously CDR-transplanted light chain and the fully human κ light chain (after guided selection) further revealed the advantages of the selected humanization strategy. After guided selection, the V gene identity percentage of VL was 92.9%, while the V gene identity percentage after CDR transplantation was only 89.5% (Table 4).
[0177] Table 4 Humanization Score
[0178] For more information on humanized scoring, see Example 1.
[0179] V gene identity percentage (Ehrenmann, F. and MP Lefranc, Cold Spring HarbProtoc, 2011. 2011 (6): p. 737-49.; Jones, TD, et al., MAbs, 2016. 8 (1): p. 1-9.); T20 score (Gao, SH, et al., BMC Biotechnol, 2013. 13: p. 55.); OASis identity (Prihoda, D., et al., MAbs, 2022. 14 (1): p. 2020203.) As expected from guided selection of full-length human light chains, the variable regions of the light chains can be assessed as human-like or human based on the calculated T20 score (91.12) and OASis identity (100%) (Table 4). In contrast, CDR transplanted light chain variable regions assigned lower humanization scores based on the calculated T20 score (88.3) and OASis identity (83%) (Table 4). It has been reported that increased humanization is associated with reduced clinical immunogenicity; therefore, guided selection of full-length human κ light chains is expected to reduce clinical immunogenicity.
[0180] Example 5 - Humanized antibody huTH69, after being conjugated with maytansine (DM1), delutecan (Dx), or monomethyl olprestatin E (MMAE), or non-covalently linked with truncated Pseudomonas exotoxin A (ETA′), specifically reduces the viability of leukemia cells. The identified CD7 antibody huTH69 exhibits efficient internalization after binding to the cell surface membrane protein CD7. To test whether huTH69 can be used as a carrier antibody for a broader drug group, huTH69-DE was conjugated with the ethatec derivative topoisomerase I inhibitor delutec (Dx), the microtubule inhibitor maytansine (DM1), and monomethyl olritatin E (MMAE). DM1 was conjugated to the surface amine via an SMCC (succinimide-trans-4-(maleimide-methyl)cyclohexane-1-carboxylate) linker, while Dx and MMAE were conjugated to thiol groups via enzyme-cleavable peptide linkers after antibody reduction. Upon generation, the three ADCs exhibited characteristic absorption peaks of the drugs used in the UV-Vis region, indicating successful conjugation (Figure 13A). The binding ability of the huTH69-DE ADC to the CD7-positive cell line CEM remained unchanged, with the half-maximal effective concentration (EC50) value within the nanomolar range (Figure 13B), indicating that the overall structure of the ADC was intact. The three huTH69-DE-based ADCs were further tested in cell viability assays using the CD7-positive cell line CEM and the CD7 knockout cell line CEM-CD7KO. Figure 14 As shown, all three ADCs reduced leukemia cell viability in a concentration-dependent manner. Among them, huTH69-DE-MMAE showed the strongest reducing effect at low concentrations compared to huTH69-DE-DM1 and huTH69-DE-Dx. None of the generated ADCs reduced the viability of CD7-negative CEM-CD7KO cells, validating their antigen-restricted cytotoxic effects.
[0181] Besides small organic molecules, antibodies can also bind to peptide toxins such as Pseudomonas exotoxin A or diphtheria toxin. After antibody internalization, the toxin is released into the cell's endosomal system and exerts its toxic effect. To test this type of loading, CD7-positive CEM cells were incubated with a fusion protein of an anti-human κ light chain specific domain antibody (α-κ) and a truncated Pseudomonas exotoxin A (ETA′) (Kellner C, et al., J Immunol Methods. 2011 Aug 31;371(1-2):122-33). At the concentrations shown, the fusion protein itself did not decrease cell viability. However, upon the addition of huTH69, a strong concentration-dependent decrease in cell viability was observed (Figure 15). Because huTH69 internalizes upon binding to CD7 on the cell surface, the non-covalently bound ETA′ can enter the endosomal system along with the antibody and exert its toxic effect.
[0182] In summary, huTH69 can be used in combination with different small molecule organic compounds in ADCs, or with peptide toxins, indicating its broad applicability in the generation of antibody-drug conjugates.
[0183] Example 6 - The selected huTH69 humanization strategy resulted in a significantly higher humanization score compared to several published CD7 antibodies. The overall goal of humanization is to reduce the risk of an immune response in patients to the non-human variable regions of animal-derived therapeutic antibodies. Such responses can lead to serious side effects and / or reduced effective doses of the therapeutic antibody or antibody derivative (Baert F, et al. N Engl J Med. 2003 Feb 13;348 (7):601-8). However, humanization remains a challenging task: reducing the proportion of non-human regions in the antibody while preserving its binding properties is crucial. Humanization scoring methods have been developed to quantify the success of humanization. One of the most advanced methods is the OASis scoring system (Prihoda D, et al. MAbs 2022 Jan-Dec;14 (1):2020203). The system outputs two values: (a) OASis identity, which compares the 9-peptide of the input antibody sequence with a human antibody database and returns the proportion of its "human" peptide; and (b) OASis percentile, which compares the input antibody sequence with clinically available therapeutic antibodies, with the 100% percentile corresponding to the therapeutic antibody with the highest degree of humanization in clinical practice. In summary, both OASis identity and OASis percentile values should be as high as possible to verify a high degree of humanization and a low risk of immunogenicity in humans. For comparison, huTH69 was analyzed together with humanized CD7 antibodies h189-1 and 189-4 (WO 2022 / 095803; primary candidate: h189-4) of parental antibody m189, humanized mouse-derived CD7 antibodies G09 and F05 (WO 2020 / 212710; primary candidate G09), humanized antibody huCD7scFv (WO 2022 / 257835), and human single-domain antibody #53 (containing only the heavy chain variable region) (CN115991776 A). In addition, the murine antibody RFT2 (Heinrich G, et al. J Immunol. 1989 Dec 1;143 (11):3589-97) and the parental antibody mTH69 (Peipp M, et al. Cancer Res. 2002 May15;62 (10):2848-55; WO 2003 / 051926) were added to this group.
[0184] In both scoring systems, huTH69 showed the highest score compared to other humanized / human CD7 antibodies described in WO 2020 / 095503 (Figure 16). Interestingly, the antibody huCD7scFv, described as humanized, was rated as non-humanized and unexpectedly matched the parental mTH69 antibody. In summary, a strategy combining CDR transplantation with guided selection based on phage display was employed to achieve high humanization of huTH69.
[0185] Example 7 - Compared with a variety of published CD7 antibodies, the selected huTH69 VL and the designed VH showed extremely low vulnerability to post-translational modifications / degradation. For the development of therapeutic antibodies or antibody derivatives, it is crucial to select lead candidates with high resistance to post-translational modifications and degradation. Low antibody stability can lead to problems during manufacturing and administration (Jarasch, A. et al., J Pharm Sci. 2015 Jun;104 (6):1885-1898). Three common problems that may arise are methionine oxidation, aspartic acid isomerization, and asparagine deamidation. In particular, surface-exposed residues in the complementarity-determining region are susceptible to modification / degradation, which can lead to aggregation or interfere with the binding properties of therapeutic antibodies. Aspartic acid isomerization and asparagine deamidation occur in amino acid sequence motifs, which are strong indicators of this modification / degradation vulnerability (Vatsa, S. mAbs 2022, 14 (1); Lu, X. et al. mAbs 2018, 11 (1): 45–57). Figure 17 shows the number of methionine, aspartic acid isomerization motifs and asparagine deamidation motifs in the CDRs of the heavy and light chain variable regions of huTH69 and published CD7 antibodies (h189-1 and 189-4 from WO 2022 / 095803; G09 and F05 from WO 2020 / 212710; single-domain antibody #53 from CN 115991776 (containing only the heavy chain variable region); and RFT2 from Heinrich G, et al. J Immunol. 1989 Dec 1;143 (11):3589-97). CD7 antibody huTH69 exhibits low vulnerability, containing only one potential asparagine deamidation site. In contrast, prior art CD7 antibody G09 (WO 2020 / 212710), for example, is likely affected by all three degradation / modification pathways. In summary, as further described in Example 2 above, huTH69 has high development potential.
[0186] Example 8 - Humanized CD7 antibody huTH69 induces effector cell and complement-mediated killing of leukemia cells with higher efficiency than several published CD7 antibodies. The ability of monoclonal antibodies to trigger Fc-mediated effector functions such as antibody-dependent cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC) is influenced by a variety of parameters. In addition to the specific characteristics of the target antigen and the antigen density on the target cell (Derer, S. et al., J Immunol. 2012 Dec 1;189 (11):5230-9), the epitope of antibody binding and the antibody affinity / affinity (Tang, Y. et al. J Immunol. 2007 Sep 1;179 (5):2815-23) have been shown to affect ADCC and CDC activities (Oostindie, SC et al. Nat Rev Drug Discov.2022 Oct;21 (10):715-735).
[0187] In the classic chromium release assay, CEM cells were used as target cells and peripheral blood mononuclear cells (PBMCs) as effector cells. The ability of the humanized huTH69 antibody to mediate ADCC via wild-type Fc was compared with that of selected publicly available CD7-specific antibodies. All antibodies triggered target cell lysis in a dose-dependent manner. Importantly, compared with antibodies RFT2 (Heinrich G, et al. J Immunol. 1989 Dec 1;143 (11):3589-97), G09 (WO 2020 / 212710), F05 (WO 2020 / 212710), h189-1 (WO 2022 / 095803), and h189-4 (WO 2022 / 095803), huTH69 triggered half-maximal lysis at lower antibody concentrations and exhibited higher lysis capacity at subsaturated concentrations (e.g., 0.016 µg / ml) (Figure 18).
[0188] In a classic chromium release assay, using CEM and HSB-2 cells as target cells and serum / plasma from healthy donors as complement sources, the ability of the humanized huTH69 antibody to mediate CDC via wild-type Fc was compared with that of the chimeric antibody chimTH69 and a selected group of CD7-specific antibodies. Surprisingly, the huTH69 antibody-mediated CDC against CEM and HSB-2 was significantly more efficient than that of the chimeric antibody chimTH69 (Figures 19A-B). Furthermore, huTH69 mediated CDC against CEM and HSB-2 cell lines, while the previously described CD7 antibody, when used in a human IgG1 background (containing wild-type Fc), triggered less or no complement activation against CD7-positive cell lines (Figures 19C-D).
[0189] These data demonstrate that huTH69 possesses unique technical and biological advantages that distinguish this antibody from other previously described human or humanized CD7 antibodies.
[0190] Example 9 - Compared with various published humanized CD7 antibodies, the humanized CD7 antibody huTH69 binds to a unique epitope on the extracellular portion of CD7. Epitopes corresponding to antigens are an important characteristic of therapeutic antibodies. On the one hand, target cells expressing antigens are affected by epitopes (e.g., internalization after cross-linking or cell death induction). On the other hand, antibody epitopes affect the orientation and distance of the antibody constant region on target cells, thereby affecting the function of effectors mediated by the patient's immune system (e.g., ADCC or CDC) (Dechant, M. et al. Cancer Res. 2008 Jul 1;68 (13):4998-5003). Antibody epitopes can be identified by screening for antigens with mutations on the protein surface that may affect antibody binding properties. The extracellular portion of the human CD7 membrane protein consists of a disordered region and an N-terminal immunoglobulin-like domain (Aruffo, A. et al. EMBO J. 1987Nov;6 (11):3313-6; UniProt: P09564; Fig. 20A). The disordered region has various post-translational modifications and is structurally inflexible. In contrast, the immunoglobulin-like domain has a well-structured structure and is a potential binding region for CD7 antibodies.
[0191] Multiple amino acid substitutions were inserted into the CD7 Ig-like domain, and these substitutions were dispersed throughout the protein surface. The mutant CD7 variant was expressed in CHO-S cells and could be detected on the cell surface by flow cytometry. Figure 20B, grayscale image). The binding of huTH69, chimTH69, and a group of CD7 antibodies (as described in Example 8) to mutated CD7 variants was measured by flow cytometry. Interestingly, binding of huTH69 and chimTH69 was undetectable when amino acids G53, R55, I117, and V120 were altered (Fig. 20C). These amino acids are involved in the formation of two neatly aligned N-terminal loops (UniProt: AF-P09564-F1 (AlphaFold)). These phenomena were not observed in other CD7 antibodies in the test group. Furthermore, the binding behavior of chimTH69 to huTH69 differed regarding the effect of amino acid D68 on the measured fluorescence signal. Therefore, huTH69 exhibits a unique epitope on the immunoglobulin-like domain of human CD7 compared to the selected prior art CD7 antibodies. The significant differences in binding compared to other CD7 antibodies, as well as the differences in binding compared to chimTH69, may explain the unique and unexpected properties of huTH69 in killing target cells.
[0192] Example 10 - Discussion / Conclusion This article describes a novel humanized version of a murine TH69 hybridoma antibody generated through a strategy combining CDR transplantation and guided selection. The huTH69 antibody exhibits favorable biophysical properties (such as thermal stability) conducive to further clinical development. Furthermore, the antibody epitopes, the degree to which selected effector functions are triggered, and the level of humanization give huTH69 significant advantages over a panel of previously disclosed CD7 antibodies and parental murine / chimeric TH69 antibodies. The unique humanized variable region is well-suited as a starting point for developing a variety of antibody-based immunotherapies for the treatment of T-ALL and other CD7-positive malignancies, including but not limited to Fc-optimized antibodies, bispecific antibodies, multifunctional fusion proteins, immunotoxins, antibody-drug conjugates (ADCs), and CAR T-cell / CAR NK cell therapies.
[0193] Example 11 - Materials and Methods Cell separation Peripheral blood mononuclear cells (PBMCs) were isolated from healthy donors by density gradient centrifugation, and B cells were purified from PBMCs using the Miltenyi Biotec B Cell Isolation Kit II (130-091-151) following the manufacturer's recommendations via magnetic bead activated cell sorting (MACS). PBMCs were incubated in PromoCell medium at 37°C for 30 minutes to generate mononuclear cells. Mononuclear cells were then differentiated into macrophages in serum-free X-vivo medium (Lonza) containing 50 U / mL penicillin, 50 µg / mL streptomycin, and 50 ng / mL recombinant macrophage colony-stimulating factor (MCSF; PeproTech) for 11 to 14 days.
[0194] eukaryotic cell culture CCRF-CEM, MOLT-16, and HSB-2 cells were purchased from the German Center for Microbiology and Cell Culture Collection (DSMZ Nos. ACC 240, ACC 29, ACC 435) and cultured in RPMI 1640 GlutaMAX medium containing 10% fetal bovine serum (FCS), 1% penicillin, and streptomycin (all from Thermo Fisher Scientific; product numbers: 72400-021, 10270-106, 15140-122). CCRF-CEM CD7 knockout cells were generated using CRISPR / Cas9 technology. In brief, 2.5 × 10⁶ cells were cultured... 6 CEM cells were transfected using 1.5 µM Alt-R® Sp Cas9 nuclease V3 (IntegratedDNA Technologies) and 4.4 µM guide RNA (gRNA synthesized by Synthego based on a published sequence (Gomes-Silva, D., et al., Blood, 2017. 130 (3): p. 285-296.)) via the MaxCyte (STX) scalable transfection system, following the manufacturer's recommendations. CD7-negative cell fractions were isolated using a BD FACSAria automated cell sorter.
[0195] Humanization and humanization scoring of VH via CDR transplantation To identify the human V and J genes as the CDR transplant recipient framework, the murine heavy chain variable region sequence was analyzed using IMGT / DomainGapAlign, with the species defined as Homo sapiens (Ehrenmann, F. and MP Lefranc, Cold Spring Harb Protoc, 2011. 2011 (6): p. 737-49.; Ehrenmann, etal., Nucleic Acids Res, 2010. 38 (Database issue): p. D301-7.). Humanization was scored using three different methods: the percentage of V gene identity was calculated using IMGT / DomainGapAlign, with the species defined as Homo sapiens (Ehrenmann, F. and MP Lefranc, Cold Spring Harb Protoc, 2011. 2011 (6): p. 737-49.). Following the method of Gao et al., T20 scores were calculated using full-length sequences (Gao, SH, et al., BMC Biotechnol, 2013. 13: p. 55). OASis identity was determined using the BioPhi platform (medium threshold (50% prevalence)) (Prihoda, D., et al., MAbs, 2022. 14 (1): p. 2020203.).
[0196] Generation of scFv antibody libraries Total RNA was extracted from 2–14 million B cells from 8 healthy donors using TRIzol (Thermo Fisher Scientific; Product No.: 15596026), and quality was controlled by agarose-formaldehyde gel electrophoresis of 2 µg of mixed total RNA. Oligomeric (dT) was used. 15Primers and reverse transcriptase SuperScript IV (Thermo Fisher Scientific; Product No.: 18090010) were used to synthesize cDNA using 20 µg of mixed total RNA as a template, following the manufacturer's instructions. The light chain variable region of the κ light chain was amplified by PCR using a degenerate primer mixture binding to the V gene and the CL region. The PCR reaction mixture contained 2 μl cDNA, 35.5 μl RNase-free and DNase-free water, 10 μl 5× reaction buffer, 1 μl dNTP mixture (10 mM each; Thermo Fisher Scientific; Product No.: 18427013), 0.5 μl forward primer mixture (100 μM), 0.5 μl reverse primer mixture (100 μM), and 0.5 μl PhusionPlus polymerase (Thermo Fisher Scientific; Product No.: F630S). Initial denaturation was performed at 98°C for 30 seconds, followed by 30 cycles (10 seconds at 98°C, 10 seconds at 60°C, and 15 seconds at 72°C), and a final extension at 72°C for 5 minutes. A light chain variable region fragment of approximately 400 bp was separated by agarose gel electrophoresis and gel extracted using the Qiagen QIAquick kit (product number: 28706) according to the manufacturer's instructions. To add the adapter sequence to the huTH69 heavy chain variable region, PCR was performed using a 10 ng plasmid (pSec-huTH69-HC) as a template, employing primers that bind the leader sequence and the J gene. PCR and purification were performed as described above. The heavy chain and light chain variable regions were assembled by nested PCR. The forward primers bound the V region of the huTH69 heavy chain variable region, while the reverse primer mixture bound the J gene of the light chain. For the PCR reaction, 60 ng of purified huTH69 heavy chain variable region PCR product and 60 ng of purified light chain variable region PCR product were added to 10 μl of 5× reaction buffer, 1 μl of dNTP mixture (10 mM each; Thermo Fisher Scientific; product number: 18427013), 0.5 μl of forward primer (100 μM), 0.5 μl of reverse primer mixture (100 μM), and 0.5 μl of Phusion Plus polymerase (Thermo Fisher Scientific; product number: F630S), for a final volume of 50 µl.The approximately 800 bp scFv was separated by agarose gel electrophoresis and purified by gel extraction using a QIAquick kit according to the manufacturer's instructions. The purified PCR product and pJB12 phage particles (Burmester, J. and A. Plückthun, Antibody Engineering, 2001, Springer Berlin Heidelberg p. 19-40.) were digested with 1 U SfiI restriction endonuclease (NEB; product number: R0123L), purified by agarose gel electrophoresis, and assembled using NEB's T4 ligase (product number: M0202T) according to the manufacturer's instructions. The reaction mixture was treated with 10 volumes of n-butanol (Carl Roth; product number: 7724.1) and centrifuged (25,000 g, 5 min). The precipitate was washed twice with 70% ethanol and dissolved in distilled water. Using a MicroPulser electroporator (Bio-Rad; product number: 1652100), *E. coli* XL1Blue (Agilent; product number: 200228) was transformed using a desalting ligation reaction according to the manufacturer's instructions, and plated using standard procedures. Insertion rates were estimated by colony screening PCR using flanking primers on phages (forward: CGTATTGTTGTGTGGAATTGTGAGCGG; (SEQ ID NO: 19), reverse: CATAGCCCCCTTATTAGCGTTTGCC; SEQ ID NO: 20) and isolated single bacterial colony samples as templates. Samples containing approximately 1,000 bp fragments were considered insertion-positive. Bacteria were suspended in 2-YT medium containing 20% glycerol, aliquoted, and rapidly frozen for storage at -80°C.
[0197] Phage display using cell panning E. coli containing the pJB12-scFv library were inoculated into 500 ml of SB medium (SB medium containing 20 g / L yeast extract, 30 g / L tryptone, 10 g / L MOPS (pH 7.0), supplemented with 30 μg / ml chloramphenicol, 10 μg / ml tetracycline and 1% glucose; all purchased from Carl Roth; product numbers: 8952.2, 2363.2, 6979.2, X997.2, 3886.3, 0237.3), and bacteriophages were prepared according to the method described above and titrated by measuring colony forming units (CFU) (Peipp, M., et al., J Immunol Methods, 2001. 251 (1-2): p. 161-76.; Kay, BK, et al., 1996: Elsevier Science.). 10 12 One phage was added to 2 ml of phosphate-buffered saline (PBS) containing 4% bovine serum albumin (BSA; Carl Roth; product number: 8076.3) at a concentration of 2 × 10⁶ ppm. 6 In CEM cells, cells were incubated in a roller incubator at 4°C for 30 minutes. Cells were washed five times with ice-cold PBS supplemented with 2% bovine serum albumin, followed by two more washes with ice-cold PBS. For elution, cells were incubated with trypsin (1 mg / ml PBS; Sigma-Aldrich; product number: T1426) at room temperature for 10 minutes and centrifuged (18,000×g, 10 minutes). The supernatant was added to 10 ml of XL1 Blue Escherichia coli (OD600 = 0.5, containing 10 μg / ml tetracycline) and incubated at 37°C for 30 minutes. Bacteria were plated on 2×YT agar plates containing 30 μg / ml chloramphenicol, 10 μg / ml tetracycline, and 1% glucose to prepare phages for the second round of panning.
[0198] Sanger sequencing Following the second round of screening, individual bacterial colonies were inoculated into 5 ml SB medium (supplemented with 30 μg / ml chloramphenicol, 10 μg / ml tetracycline, and 1% glucose). Phage particles were isolated from *E. coli* using the Macery-Nagel NucleoBond Mini kit (product number: 740588.250) according to the manufacturer's instructions. Sanger sequencing was performed at the Kiel Institute for Clinical Molecular Biology (IKMB).
[0199] Whole-cell enzyme-linked immunosorbent assay (ELISA) Individual bacterial colonies were inoculated into 100 ml of SB medium (supplemented with 30 μg / ml chloramphenicol, 10 μg / ml tetracycline, and 1% glucose), and bacteriophages were prepared and titrated according to the above method. The phages were then coated into 96-well plates overnight, with 1 × 10⁻⁶ cells per well. 6 Block cells with PBS supplemented with 4% bovine serum albumin on ice for 30 minutes. 1×10 10 One CFU of phage was mixed with cells in a total volume of 100 µl and incubated at 4°C for 1 hour. The plates were washed three times with cold PBS (supplemented with 0.1% bovine serum albumin) and then incubated at 4°C for 1 hour with anti-M13 horseradish peroxidase (HRP) antibody (GE Healthcare; product number: 27-9421-01). After washing, 100 µl of ABTS solution (Roche; product number: 11112422001) was added to each well, and the absorbance was measured at 405 nm using a Sunrise microplate reader (Tecan; reference wavelength 492 nm) after 15 minutes.
[0200] The generation of chimeric and humanized IgG1 The murine and humanized heavy chain variable regions were fused with the human IgG1 constant region with or without S239D / I332E amino acid substitutions and inserted into the expression vector. The murine and human light chain variable regions were fused with the human κ light chain constant region and inserted into the expression vector. Endotoxin-free plasmid DNA was purified using a Maccherry-Nagel Nucleo Bond 2000 EF and sequenced correctly by Sanger sequencing (IKMB Kiel). For expression, the corresponding heavy and light chain expression vectors were electroporated into Chinese hamster ovary cells (CHO-S) using a MaxCyte (STX) large-scale electroporation system, following the manufacturer's recommendations. Antibodies were purified from the cell supernatant using Capture Select IgG-CH1-XL affinity matrix (ThermoFisher) followed by size exclusion chromatography (ÄKTA pure, GE Healthcare / Cytiva). Antibody variants based on G09 (WO 2020 / 212710), F05 (WO 2020 / 212710), h189-1 (WO 2022 / 095803), h189-4 (WO 2022 / 095803), and RFT2 (Heinrich G, et al. J Immunol. 1989 Dec 1;143 (11):3589-97) were generated using the same production procedure in a human IgG1 background.
[0201] SDS-PAGE and Western blot analysis Load 2 μg of purified antibody onto a 12% Tris-acrylamide gel (reducing conditions) or a 4-15% pre-prepared polyacrylamide gel (Mini-PROTEAN® TGX™, BioRad) (non-reducing conditions), and stain directly with Coomassie Brilliant Blue (Carl Roth GmbH) or blot onto a polyvinylidene fluoride (PVDF) membrane according to standard procedures. Block the membrane with Tris-buffered saline (TBS) containing 5% bovine serum albumin or skim milk powder at room temperature for 1 hour. For heavy chain detection, incubate anti-IgG-POX antibody (Sigma-Aldrich) at a final dilution of 1:5000 overnight at 4°C; for light chain detection, incubate anti-human κ-light chain antibody (Sigma-Aldrich) at a final dilution of 1:10000 overnight at 4°C. The blot was washed with TBST buffer, and horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Invitrogen) was added as a secondary antibody to a final dilution of 1:5000. The blot was incubated at room temperature for 1 hour. Finally, the blot was analyzed using a chemiluminescent substrate (Pierce, Thermo Fisher Scientific) and a ChemiDoc imaging system (Biorad).
[0202] Surface plasmon resonance spectroscopy CD7-Fc expression vectors were electroporated into CHO-S cells using a MaxCyte (STX) large-scale electroporation system to express the CD7-Fc fusion protein. The fusion protein was purified from cell supernatant using Capture Select IgG-Fc (multi-species) affinity matrix (ThermoFisher) followed by size exclusion chromatography (ÄKTA pure, GE Healthcare / Cytiva). Fab fragments were prepared from huTH69-DE and chimTH69-DE using a Pierce Fab preparation kit (ThermoFisher) according to the manufacturer's instructions. To analyze the binding kinetics of the antibody fragments to the CD7-Fc fusion protein, a series of dilutions of the fragments were prepared in surface plasmon resonance (SPR) running buffer (12 mM phosphate, 137 mM sodium chloride, 2.7 mM potassium chloride, 0.5 mM EDTA, 0.005% polysorbate 20, pH 7.4). The CD7-Fc fusion protein was immobilized on a CMD50L hydrogel biosensor chip (Xantec) via amine coupling. Diluted samples were injected into the system (2SPR, Reichert) for 60 seconds. The antigen-Fab fragment complex was allowed to dissociate for 320 seconds, and the biosensor chip was regenerated by injecting regeneration buffer (10 mM glycine hydrochloride, pH 1.5) for 60 seconds. All samples were subjected to dual reference (through a blank sample and a reference channel without immobilized antigen). The resulting SPR sensor maps were analyzed using TraceDrawer software (Reichert). Data were evaluated using a 1:1 binding model to determine the interaction kinetic constants ka, kd, and KD.
[0203] Flow cytometry analysis To analyze the concentration-dependent binding of the antibody, 3 × 10 5 Cells were washed in PBS (PBA buffer) containing 1% BSA and 0.1% sodium azide and incubated on ice for 60 minutes with increasing concentrations of the indicated antibody. Cells were washed three times with 1 ml PBA buffer and then stained on ice for 30 minutes with secondary antibodies: anti-human κ-FITC antibody (Southern Biotech) or anti-human IgG-Fc-FITC antibody (Jackson Immuno Research). Flow cytometry analysis was performed on a Navios flow cytometer (Beckman Coulter) and analyzed using Kaluza analysis software (Beckman Coulter).
[0204] Thermal migration measurement method Thermo-migratory assays were performed using SYPRO Orange (Thermo Fisher Scientific; product number: S6650). 1 µl of 500×SYPRO Orange was added to 20 µl of 1 mg / ml antibody (diluted with phosphate buffer) in a white 96-well thin-walled PCR plate. The plate was sealed and heated in a LightCycler 480 (Roche) from 20°C to 99°C at a rate of 0.06°C / second. Fluorescence was recorded simultaneously using 483 nm as the excitation wavelength and 568 nm as the emission wavelength.
[0205] Sequence verification was performed using liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS). huTH69-DE was reburied in 50 mM phosphate buffer (pH 5.8) by ultrafiltration (molecular weight cutoff 10 kDa). Descaling was removed from the centrifuge column. The sample was reduced and denatured with dithiothreitol (DTT) in the presence of urea or guanidine hydrochloride, alkylated with iodoacetamide (IAA), and digested with trypsin and chymotrypsin under enzyme-specific conditions. The sample was acidified in approximately 0.5% trifluoroacetic acid (TFA) and separated using a reversed-phase column (AcquityPremier CSH130 C18 peptide, 2.1 × 100 mm, 1.7 µm, Waters) on a Waters Acquity Premier H-class ultra-high performance liquid chromatography (UPLC) system. The eluent was water containing 0.1% formic acid (FA) and acetonitrile containing 0.1% formic acid. Mass spectrometry analysis was performed using a Compact QTOF mass spectrometer (Bruker Daltonik). The LC-ESI-MS and -MS / MS spectra were processed and annotated using Mascot (Matrix Science), and searched in a custom sequence database.
[0206] Variable region modification and degradation analysis huTH69-DE was reburied in 50 mM phosphate buffer (pH 5.8) (low artifact workflow) or 50 mM ammonium bicarbonate (pH 8.0) (stressed samples) via ultrafiltration (molecular weight cutoff 10 kDa). Descaling was removed from the centrifuge column by removing the detergent. Samples were reduced and denatured with dithiothreitol in the presence of urea, alkylated with iodoacetamide, and digested with trypsin under enzyme-specific conditions. To identify and quantify other potential deamidated or oxidized peptides, samples were reburied to pH 8.0, incubated at 70°C for 30 min, and analyzed in parallel. Incubation at high pH and high temperature resulted in increased protein deamidation / oxidation, allowing for better identification of potential modification sites. Samples were acidified in approximately 0.5% trifluoroacetic acid and separated using a reversed-phase column (AcquityPremier CSH130 C18 peptide, 2.1 × 100 mm, 1.7 µm, Waters) on a UPLC system (Waters Acquity Premier H-class). The eluents were water and acetonitrile containing 0.1% formic acid. Mass spectrometry analysis was performed using a Compact QTOF mass spectrometer (Bruker Daltonik). Recorded LC-ESI-MS and -MS / MS spectra were processed and annotated using Mascot (Matrix Science) and searched in a custom sequence database. Modified peptides were identified by precise mass and retention time, and quantified by mass spectrometric signal intensity.
[0207] Capillary isoelectric focusing Samples were desalted in 1:50 diluted PBS (pH 7.4) using an Amicon Ultra-0.5 centrifugal filter (Millipore). Protein concentration was determined by UV measurement at 280 nm. Capillary isoelectric focusing (cIEF) was performed on a CESI 8000 PLUS system (Sciex) using an eCAP neutral capillary with a length up to the detector (inner diameter: 50 µm). Samples were detected using a UV detector set to 280 nm. Samples were mixed with 3.75 M urea capillary isoelectric focusing gel, Pharmalyte 3-10, isoelectric point (pI) peptide markers (pI 10.0, pI 9.5, pI 7, pI 5.5, and pI 4.1, Sciex), and cathode and anodic stabilizers. Capillary isoelectric focusing separation consisted of two steps: focusing and migration. Protein focusing was performed at 25.0 kV using phosphoric acid (anolyte) and sodium hydroxide solution (cathodic solution). Chemi-migration was performed at 30.0 kV using phosphoric acid (anolyte) and acetic acid solution (cathodic solution). The recorded electrophoresis images were integrated and analyzed using 32 Karat™ software (Beckman Coulter / Sciex).
[0208] Chromium release test As previously described (Gehlert, CL, et al., Front Immunol, 2022. 13: p.957874.), the ability of the novel antibody to trigger ADCC and CDC was measured by a chromium release assay after 4 hours of incubation. In short, using radioactivity... 51 CrO4 2- Tumor cells were labeled and incubated with healthy donor PBMCs (effect cell:target cell (E:T) ratio of 40:1) or 25% plasma / serum in the presence of the indicated antibody. Lepiludine (Refludan) (Bayer HealthCare Pharmaceuticals) was added to the plasma as an anticoagulant at a concentration of 10 µg / ml. The percentage of dissolution was calculated based on counts per minute (cpm) using the following formula: Dissolution% = (Experimental cpm × Baseline cpm) / (Maximum cpm × Baseline cpm) × 100.
[0209] Phagocytosis assay To analyze ADCP, target cells were labeled with the pH-sensitive red fluorescent dye pHrodo (ThermoFisher Scientific) according to the manufacturer's protocol. 10 4Macrophages were seeded into 96-well flat-bottom plates and allowed to adhere for 1 hour at room temperature. Labeled target cells were added to the macrophages to achieve an effector cell:target cell ratio of 1:1, using antibody at a final concentration of 10 µg / mL. Incubation was performed under physiological conditions using an IncuCyte high-throughput fluorescence microscope system (Satorius), with fluorescence images captured every 20 minutes for 4 hours. Phagocytosis was defined as the number of red targets per image over time (showing phagocytosed T-ALL cells) (Baumann, N., et al., Cancer Sci, 2021. 112 (8): p. 3029-3040.).
[0210] Internalization assay To analyze antibody internalization, 6×10 4 Antigen-positive cells were seeded into 96-well flat-bottom plates. Antibodies were labeled with a pH-sensitive red fluorescent dye (human Fabfluor-pH antibody-labeled dye; Thermo Fisher Scientific) according to the manufacturer's protocol. The labeled antibody was added to the cells to a final concentration of 1 µg / ml. Cells were incubated and measured under physiological conditions using an IncuCyte high-throughput fluorescence microscope system (Satorius), with fluorescence images captured every 20 minutes for 24 hours. Internalization was defined as the total red target area (μm²) in each image over time. 2 ).
[0211] Cell viability assay Direct growth inhibition was analyzed by 3-(4,5-dimethylthiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay (Cell Proliferation Kit I, Roche). 1×10⁻⁶ cells were used. 4 Cells / well were seeded into 100 µL of medium in 96-well flat-bottomed culture plates and treated with serial dilutions of the indicated antibody for 96 hours. MTT reagent and lysis solution were added as directed by the manufacturer, and cell viability was quantified as the percentage of growth inhibition relative to untreated control cells.
[0212] Preparation and characterization of antibody-drug conjugates of mertansine, delutec, and monomethylolpropionate E. Human IgG1 antibody was conjugated to maytansine (DM1) using the PerKits™ Antibody Conjugation Kit (CellMosaic) via the SMCC (succinimide-trans-4-(maleimide-methyl)cyclohexane-1-carboxylate) linker, and to derutec (Dx) via the maleimide-containing enzyme-cleaved peptide linker GGFG. Monomethyl olistatin E (MMAE) was conjugated using the enzyme-cleaved mc-vc-PABC linker via contract manufacturing (Cfm Oskar Tropitzsch GmbH). The generated ADCs were analyzed by spectrometry (NanoDrop One, Thermo Fischer Scientific) and further analyzed by flow cytometry as described above.
[0213] Expression and purification of α-κ-ETA′ fusion protein As previously disclosed, a fusion protein of an anti-human κ light chain specific domain antibody (α-κ) and a truncated Pseudomonas exotoxin A (ETA′) was expressed and purified (Kellner C, et al., J Immunol Methods. 2011 Aug31;371 (1-2):122-33).
[0214] Generation of CD7-expressing CHO-S cells used for binding analysis The human CD7 nucleotide sequence (NCBI reference sequence: NM_006137) with or without the stated amino acid substitution was inserted into the expression vector (pcDNA3.1 (+)). Endotoxin-free plasmid DNA was purified and Chinese hamster ovary cells (CHO-S) were electroporated using a MaxCyte (STX) large-scale electroporation system, following the manufacturer's recommendations. After 24 hours, the expression of CD7 with or without the stated amino acid substitution mutation was verified by flow cytometry. Binding to the selected CD7 antibody was analyzed by flow cytometry following the above method.
[0215] Data processing and statistical analysis Data were analyzed using GraphPad Prism 9 (GraphPad Software Inc.). Data are presented as mean ± SEM. Unless otherwise stated in the corresponding graph description, differences between groups were analyzed by two-tailed t-tests or two-way ANOVA (Bonferroni post-hoc test). p < 0.05 was considered statistically significant. Curves were fitted using a nonlinear regression model with an sigmoid dose-response pattern (variable slope).
Claims
1. An antibody that binds to CD7, wherein the antibody comprises: V is determined by the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 90%, preferably at least 95% identity with it. H District; and V is determined by the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having at least 90%, preferably at least 95% identity with it. L district, The condition is The V H The three CDRs of the region are determined by the amino acid sequences of SEQ ID NO: 3 to SEQ ID NO: 5, and The V L The three CDRs of the region are determined by the amino acid sequences of SEQ ID NO: 6 to SEQ ID NO: 8 (SEQ ID NO: 7 is "AAS").
2. The antibody of claim 1, wherein the antibody comprises: V that differs from SEQ ID NO: 1 by no more than 5 amino acid substitutions, preferably no more than 3. H The region, most preferably containing V of SEQ ID NO:
1. H District; and / or V differs from SEQ ID NO: 2 by no more than 5 amino acid substitutions, preferably no more than 3 amino acid substitutions. L The region, most preferably containing V of SEQ ID NO:
2. L district.
3. The antibody of claim 2, wherein the amino acid substitution is a conserved amino acid substitution.
4. The antibody according to any one of claims 1 to 3, wherein the CD7 is determined by the amino acid sequence of SEQ ID NO:
17.
5. The antibody according to any one of claims 1 to 4, wherein the antibody comprises the Fc domain of SEQ ID NO:
18.
6. The antibody according to any one of claims 1 to 5, wherein the antibody is conjugated with: (a) Labeled groups, (b) Toxins, (c) Medicines, (d) Radioactive nucleotides, (e) Cytokines, (f) Chemokines, (g) enzymes, (h) Components that regulate serum half-life, (i) Antibodies, or (j) Antibody mimics.
7. The antibody of claim 6, wherein the antibody mimic is selected from affibodies, adnectins, anticalins, DARPins, avimers, nanoofitin, affiliins, Kunitz domain peptides, Fynomers®, and trispecific binding molecules and probodies.
8. The antibody according to claim 6, wherein the drug is selected from erlotinib (TARCEVA; Genentech / OSIPharm.), bortezomib (VELCADE; MilleniumPharm.), fulvestrant (FASLODEX; AstraZeneca), sunitinib (SU11248; Pfizer), letrozole (FEMARA; Novartis), imatinib mesylate (GLEEVEC; Novartis), PTK787 / ZK222584 (Novartis), oxaliplatin (Eloxatin; Sanofi), 5- 5-fluorouracil (5-FU), leucovorin, rapamycin (sirolimus, RAPAMUNE; Wyeth), lapatinib (TYKERB, GSK572016; GlaxoSmithKline), lonafranil (SCH66336), sorafenib (BAY43-9006; Bayer Laboratories), gefitinib (IRESSA; AstraZeneca), AG1478, AG1571 (SU 5271; Sugen); alkylating agents such as thiotepa and cyclophosphamide (CYTOXAN®); alkyl sulfonates such as busulfan, indomethacin, and piperosulfan; aziridines such as benzodopa, carboquinone, meturedopa, and uredopa; ethyleneimine and methylmelamines including hexamethylmelamine, triethylmelamine, triethylphosphamide, triethylthiophosphamide, and trimethylolmelamine; acetate compounds (especially blatazine and blatazineone); camptothecin (including synthetic analogs topotecan); bryostatin; callystatin; CC-1065 (including its synthetic analogs adolexin, cazelexin, and pyzelexin); cryptophycins (especially cryptophycin 1 and cryptophycin 8); dolalastatin; docalamicin (including synthetic analogs KW-2189 and CB1-TM1); eleutherobin; Pancratistatin; sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, naphthalenemus, cholophosphamide, estradiol, ifosfamide, nitrogen mustard, nitrogen mustard hydrochloride oxide, melphalan, neonitrogen mustard, phenylacetic acid nitrogen mustard cholesterol, prednisolone, trofenoxam, uracil nitrogen mustard; nitrosoureas such as carmustine, chloramphenicol, formustine, lomustine, nimustine, and ranimnustine; antibiotics such as enediyne antibiotics (e.g., galicarmycin, especially galicarmycin γ1I and galicarmycin ωI1 (see, for example, Agnew, Chem Intl edEngl)., 33: 183-186 (1994)) and dynemicin, including dynemicin A; bisphosphonates such as clodrophosphonate; esporamin, neomycin chromophores and related chromophores, ethynylene antibiotic chromophores, aclarubicins, actinomycin, antrmycin, diazoserine, bleomycins, actinomycin C, carabicin, carninomycin, carcinomycin, chromomycin, daunorubicin, daunorubicin, detorubucin, 6-diazo-5-oxo-L-leucine, doxorubicin (ADRLIMYCIN®) (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrololino- Doxorubicin, liposomal doxorubicin and deoxydoxorubicin), epirubicin, esoxabicin, mesorubicin, mitomycins such as mitomycin C, mycophenolic acid, nogamycin, oligomycins, pepromycin, pofamimycin, puromycin, triamcinolone acetonide, rodorubicin, streptomigrin, streptozotocin, tuberculin, ubenimex, fentostatin and zorubicin; antimetabolites such as 5-fluorouracil (5-FU); folic acid analogs such as folate, methotrexate, pteroxate, trimethoprim; purine analogs such as fludarabine, 6-mercaptopurine, thioguanine, thioimidapurine and thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6- Azavir, carmoflu, cytarabine, dideoxyuridine, deoxyfluorouridine, enoxabin, and fluorouridine; androgens such as calotestosterone, drotaloferrin propionate, cyclothionol, meandrolone, and testrolide; antiadrenergics such as aminoglutethimide, mitotane, and trilostertan; folic acid supplements such as folinic acid; acetoglucan lactone; aldehydephosphoramide glycoside; aminolevulinic acid; enuracil; acridine; bestrabucil; bisacodyl; edatraxate; defofamine; colchicine; diazinon; efornithine; elliptinium acetate. acetate); Aposilone; Etoglobulin; Gallium nitrate; Hydroxyurea; Lentinan; Lonidainine; Maytans such as Maytans and Ansericins; Mitoguanidine; Mitoanthraquinone; Mopidanmol; Nitraerine; Pentostatin; Phenamet; Pirarubicin; Loxoanthraquinone; 2-Ethylhydrazine; Procarbazine; PSK® Polysaccharide Complex (JHS Natural Products, Eugene, Oreg).); Propylene; Rhizomycin; Sizofenamic acid; Germanium spiroamine; Tenuzonic acid; Triaminoquinone; 2,2',2''-trichlorotriethylamine; Trichothecenes (especially T-2 toxin, verracurin A, roridin A, and anguidine); Urethane; Vinpocetine; Dacarbazine; Mannitol mustard; Dibromomannitol; Dibromoeutherol; Piperobromide; Gacytosine; Cytarabine ('Ara-C'); Cyclophosphamide; Thiotepa; Taxanes, such as paclitaxel (Bristol-Myers Squibb Oncology, Princeton, NJ), ABRAXANETM polyoxyethylene castor oil-free, paclitaxel albumin engineered nanoparticle formulations (American Pharmaceutical Partners, Schaumber, I11.), and docetaxel (Rhone-Poulenc Rorer, Antony, France); chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; platinum analogs such as cisplatin, carboplatin; vinblastine; platinum; etoposide, ifosfamide; mitoxantrone; vincristine; vinorelbine (NAVELBINE®); norfloxacin; teniposide; edaraxacin; daunorubicin; aminopterin; capecitabine; ibandronic acid; CPT-11; topoisomerase inhibitor RFS 2000; difluoromethylornithine (DFMO); retinoids such as retinoic acid; capecitabine; and their pharmaceutically acceptable salts, solvates, and acids.
9. The antibody according to claim 6, wherein the toxin is selected from auristatin (preferably monomethylauristatin E (MMAE) or monomethylauristatin F (MMAF)), domains II and HI of Pseudomonas exotoxin A, diphtheria toxin, ricin A, pokeweed antiviral protein, human pancreatic ribonuclease, gerdemycin, maytansine, calciferin, daunorubicin, doxorubicin, methotrexate, vinblastine, SG2285, dolalastatin, dolalastatin analogue auristatin, cryptophytin, camptothecin, rhizomycin derivatives, CC-1065, docalmicin, enediyne antibiotics, esporam, ipsholm, amatoxins (such as α-amaminine), deruxtecan, ethatecan analogues, pyrrolobenzodiazepine (PBD) dimers, and toxins.
10. A single nucleic acid molecule or a group of two nucleic acid molecules, wherein: The nucleic acid molecule encodes the antibody according to any one of claims 1 to 9; and Of the two nucleic acid molecules in the set, the first nucleic acid molecule encodes the V of the antibody according to any one of claims 1 to 9. H The region, and the second nucleic acid molecule encodes the V of the antibody according to any one of claims 1 to 9. L district.
11. A vector comprising an expressible form of the nucleic acid molecule of claim 10; or a set of two vectors comprising an expressible form of one set of two nucleic acid molecules of claim 10.
12. A host cell comprising the nucleic acid molecule of claim 10 or a group of two nucleic acid molecules, or the vector of claim 11 or a group of two vectors, wherein the host cell is preferably an anti-tumor leukocyte, and wherein the anti-tumor leukocyte is preferably a chimeric antigen receptor T cell (CAR T-cell), a T cell receptor engineered T cell (TCR T-cell), a chimeric antigen receptor NK cell (CAR NK-cell), an NK cell receptor engineered NK cell (NCR NK-cell), a TCR / CAR hybrid T cell, an NCR / CAR hybrid NK cell, a tumor-infiltrating lymphocyte (TIL), or a CAR macrophage.
13. A method for producing the antibody according to any one of claims 1 to 12, comprising: (a) Culturing the host of claim 12 under conditions that allow for the synthesis of the antibody; as well as (b) The antibody is recovered from the culture.
14. A diagnostic composition or pharmaceutical composition comprising the antibody of any one of claims 1 to 9, the nucleic acid molecule of claim 10 or a group of two nucleic acid molecules, the vector of claim 11 or a group of two vectors, or the host cell of claim 12.
15. The antibody of any one of claims 1 to 9, the nucleic acid molecule of claim 10 or a group of two nucleic acid molecules, the vector of claim 11 or a group of two vectors, or the host cell of claim 12, used in a method for treating, inhibiting or diagnosing tumors in vivo, wherein the tumor is preferably a T-cell tumor, lymphoma or leukemia, and most preferably a T-cell lymphoma or acute lymphoblastic leukemia.
Citation Information
Patent Citations
Completely humanized antibody targeting CD7 and application thereof
CN115991776A
Single polypeptide chain binding molecules
US4946778A
Method for producing antibodies in plant cells
US6080560A
Anti-CD7 fusion protein
WO2003051926A2
Concentrated oxygen pressure boosting device and concentrated oxygen pressure boosting method
WO2020095503A1