Beta-hairpin defense peptide as well as derivative and application thereof

Abstract

The invention relates to a beta-hairpin defense peptide as well as a derivative and application thereof, the beta-hairpin defense peptide is Jz-Def, and the amino acid sequence of the beta-hairpin defense peptide is as shown in SEQ ID No.1, specifically as follows: YCRRVCGRKRCFTYCRGK. The derivative of the beta-hairpin defensive peptide is defensive peptide Jz-M3, and the amino acid sequence of the defensive peptide Jz-M3 is as shown in SEQ ID No.2, specifically as follows: RWCRRFCRNGRCVRYCWR. The invention further discloses application of the beta-hairpin defense peptide and / or the derivative of the beta-hairpin defense peptide in preparation of bacteriostatic and bactericidal drugs or products. The beta-hairpin defensive peptide Jz-Def and the derivative defensive peptide Jz-M3 of the beta-hairpin defensive peptide Jz-Def and the derivative defensive peptide Jz-M3 of the beta-hairpin defensive peptide Jz-Def can kill clinical drug-resistant bacteria gram-positive pathogenic bacteria, gram-negative pathogenic bacteria and fungi at The bacillus amyloliquefaciens has strong antibacterial and bactericidal properties on providencia chinensis and other pathogenic bacteria in aquaculture and enterococcus faecalis, salmonella enterica and other putrefying bacteria in food, has very strong broad-spectrum antibacterial properties, has very strong high-temperature stability in antibacterial and bactericidal properties, has low hemolytic activity, and can be used for preparing the bacillus amyloliquefaciens. The composition has no obvious inhibiting and killing effect on phytobacterium and saccharomyces cerevisiae, and is high in safety.

Description

Technical Field

[0001] This invention relates to the field of bioactive peptide technology, and in particular to a spider antibacterial bioactive polypeptide β-hairpin defense peptide and its derivatives and applications. Background Technology

[0002] Anti-MBCrobial resistance (AMR) has been declared a major public health threat to humanity by the World Health Organization (WHO) (https: / / www.who.int / news-room / fact-sheets / detail / antiMBCrobial-resistance). AMR poses a global health threat, challenging the efficacy of traditional antimicrobial agents and necessitating innovative approaches to combat infectious diseases. Host defense peptides (HDPs), important effector molecules in the innate immune system that have evolved over billions of years, possess broad-spectrum antimicrobial activity and are widely known as anti-MBCrobial peptides (AMPs). AMPs are considered to have the potential to replace traditional antibiotics, and they can act synergistically with each other or with traditional antibiotics. Recent studies have increasingly revealed that AMPs also possess various biological functions, including immunomodulation, anti-inflammation, anti-tumor activity, and wound healing promotion, making them even more attractive for translational applications.

[0003] Many β-sheet defensive peptides, such as defensins, are held together by one or more intramolecular disulfide bonds, providing a very stable and rigid structure. This structure endows them with stronger resistance to protease degradation and a longer in vivo half-life, meaning they can maintain their activity for longer in complex physiological environments.

[0004] Spiders, as invertebrates, possess a complex immune defense system, primarily consisting of cellular and humoral immune responses. Cellular immunity includes the phagocytosis, encapsulation, and nodulation of microorganisms by hemocytes, while humoral immunity involves the secretion of host defense peptides, serine protease cascades, and the production of reactive oxygen species and reactive nitrogen species intermediates. In 2000, a host defense peptide containing 18 amino acids, two disulfide bonds, and exhibiting a clearly defined β-hairpin structure was isolated from the hemocytes of the Brazilian wolf spider *Acanthoscurria gomesiana*, named Gomesin. This peptide possesses broad-spectrum antibacterial, antifungal, and antitumor activities.

[0005] CN105777885A discloses a defensive peptide from the Xinjiang burrowing wolf spider *Lycosa singoriensis* and its application. The peptide, or a pharmaceutical composition containing the Xinjiang burrowing wolf spider *L. singoriensis* defensive peptide, is used to prepare an antibacterial drug. The defensive peptide is an active polypeptide toxin isolated from the spider venom of *L. singoriensis*, containing 21 amino acid residues, with a molecular weight of 2418.647 Da, an isoelectric point of 10.48, and an amino acid sequence of: Val Trp Leu Ser Ala Leu Lys Phe Ile Gly Lys His Leu AlaLys His Gln Leu Ser Lys Leu. However, the hemolytic activity of this defensive peptide is still relatively high.

[0006] Therefore, it is necessary to obtain or prepare defensive peptides with strong antibacterial activity and low hemolytic activity. Summary of the Invention

[0007] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a safe β-hairpin defense peptide with high antibacterial activity and low hemolytic activity, as well as derivatives obtained by modifying the β-hairpin defense peptide. Accordingly, new applications of the β-hairpin defense peptide and its derivatives are proposed.

[0008] One of the technical solutions adopted by this invention to solve its technical problem is:

[0009] A β-hairpin defense peptide, Jz-Def, has 18 amino acid residues, and its amino acid sequence is shown in SEQ ID No. 1, specifically: YCRRVCGRKRCFTYCRGK.

[0010] The β-hairpin defense peptide was isolated and purified from the hemocytes of the spider *Gymnodon dactylus*. The β-hairpin defense peptide Jz-Def consists of a signal peptide with the amino acid sequences MNRTRVFACLFLAVLILIHESDA, a mature peptide with the amino acid sequences YCRRVCGRKRCFTYCRGK, an amidation signal peptide with the amino acid sequence GKR, and a spacer peptide with the amino acid sequence SVDESNVGDFSDLEKRAFDDSNIPSLVEERELDDEDAIFT. Its mature peptide has 7 different amino acids from the mature peptide amino acid sequence of Gomesin reported in the prior art.

[0011] The β-hairpin defense peptide is encoded by the following nucleotides, wherein the nucleotide sequences encoding the signal peptide, mature peptide, amidation signal, and spacer peptide are ATGAACCGAACTCGTGTATTTGCTTGCCTGTTTTTAGCTGTGCTGATTCTTATTCACGAGAGCGATGCC, TATTGCCGTAGGGTCTGTGGTCGGAAGCGCTGCTTCACTTACTGTAGAGGAAAA, GGAAAAAGG, AGTGTGGATGAGAGCAACGTTGGTGATTTTTCGGACCTAGAGAAAAGAGCTTTCGATGACTCCAATATCCCATCATTAGTAGAAGAGAGGGAGTTGGATGATGAAGATGCCATTTTCACT, and the stop codon is TAA.

[0012] Another technical solution adopted by the present invention to solve its technical problem is:

[0013] A derivative of a β-hairpin defense peptide, namely defense peptide Jz-M3, has 18 amino acid residues, and its amino acid sequence is shown in SEQ ID No. 2, specifically: RWCRRFCRNGRCVRYCWR.

[0014] A derivative of a β-hairpin defense peptide having any of the following amino acid sequences: 1) an amino acid sequence obtained by substituting, deleting and / or adding 1 to 5 amino acids of the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 2, and having the same or similar function as SEQ ID No. 1 or SEQ ID No. 2;

[0015] 2) An amino acid sequence obtained by cyclizing SEQ ID No. 1 or SEQ ID No. 2 or by modifying the N, C ends and / or side chains of SEQ ID No. 1 or SEQ ID No. 2.

[0016] Another technical solution adopted by the present invention to solve its technical problem is:

[0017] This invention relates to the application of a β-hairpin defense peptide and / or a derivative of the β-hairpin defense peptide in the preparation of antibacterial and bactericidal drugs or products.

[0018] The antibacterial spectrum of the bacteriostatic and bactericidal drugs includes Gram-negative bacteria, Gram-positive bacteria, and fungi.

[0019] The Gram-positive bacteria include at least one of the following: Staphylococcus aureus, Staphylococcus epidermidis, Methicillin-resistant Staphylococcus aureus, Streptococcus agalactiae, Facklamia hominis, and Enterococcus faecalis.

[0020] The Gram-negative bacteria include at least one of the following: Escherichia coli, Klebsiella pneumoniae, Klebsiella variicola, Salmonella enterica, Acinetobacter baumnnii, Providencia, Aeromonas hydrophila, Vibrio parahaemolyticus, Vibrio vulnificus, Proteus mirabilis, and Kluyvera ascorbate.

[0021] The fungi include at least one of the following: Candida albicans ATCC2002, Candida parapsilosis, and Candida glabrata.

[0022] An antibacterial and bactericidal agent, the active ingredient of which is the β-hairpin defense peptide Jz-Def with the amino acid sequence as shown in SEQ ID No. 1 and / or the derivative Jz-M3 of the β-hairpin defense peptide with the amino acid sequence as shown in SEQ ID No. 2.

[0023] The concentration of the β-hairpin defense peptide Jz-Def is ≥0.25 μM, preferably ≥128 μM; the concentration of the β-hairpin defense peptide Jz-M3 is ≥0.125 μM, preferably ≥4 μM.

[0024] The antibacterial and bactericidal agent also includes one or more antibacterial and bactericidal active ingredients from proteins, peptides, plant extracts, and cytokines.

[0025] The antibacterial and bactericidal agent is a medicine or a product with a disinfection or medical device registration number.

[0026] The antibacterial and bactericidal agent also includes excipients required for preparing the defensive peptide into a drug or skin care product. These excipients may be one or more of fillers, wetting agents, binders, disintegrants, lubricants, and surfactants. The fillers include one or more of starch, powdered sugar, dextrin lactose, compressible starch, microcrystalline cellulose, calcium sulfate, dicalcium phosphate, and mannitol. The wetting agents and binders include distilled water, ethanol, starch paste, sodium carboxymethyl cellulose, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, hydroxypropyl methyl cellulose, gelatin solution, sucrose solution, and aqueous or alcoholic solutions of polyvinylpyrrolidone (pVp). The disintegrants include one or more of dry starch, sodium methyl starch, low-substituted hydroxypropyl cellulose, croscarmellose, and croscarmellose sodium. The lubricants include one or more of magnesium stearate, micronized silica gel, talc, hydrogenated vegetable oil, polyethylene glycols, and magnesium lauryl sulfate. The surfactants include sodium dodecyl sulfate.

[0027] The present invention does not impose any special limitations on the preparation of the antibacterial and bactericidal agent. It can be prepared according to conventional methods in the field, based on the type of active ingredient and the selection of excipients.

[0028] The application of the above-mentioned β-hairpin defense peptide and / or derivatives of the β-hairpin defense peptide in the preparation of feed and additives for animal husbandry.

[0029] The application of the above-mentioned β-hairpin defense peptide and / or derivatives of β-hairpin defense peptide in the preparation of food preservatives and antiseptics.

[0030] The beneficial effects of the β-hairpin defense peptide of this invention:

[0031] The β-hairpin defense peptide Jz-Def of this invention can kill Gram-positive pathogens such as Staphylococcus aureus, Gram-negative pathogens such as Acinetobacter baumannii and Aeromonas hydrophila, and fungi such as Candida albicans at low concentrations. It also has strong antibacterial and bactericidal properties against aquatic animal pathogens such as Zygophyllum rivularis and Providencia spp., as well as food isolates such as Enterococcus faecalis and Salmonella enterica. It has extremely strong broad-spectrum antibacterial properties, but has no significant inhibitory or bactericidal effect on Lactobacillus and Saccharomyces cerevisiae. Furthermore, the defense peptide has low hemolytic activity at different concentrations, high safety, and extremely strong high-temperature stability.

[0032] The β-hairpin defense peptide derivative Jz-M3 of this invention can kill Gram-positive pathogens such as Staphylococcus aureus, Gram-negative pathogens such as Acinetobacter baumannii and Aeromonas hydrophila, and fungi such as Candida albicans at low concentrations. It also has strong antibacterial and bactericidal properties against aquatic animal pathogens such as Zoococcus fluvialis, Aeromonas hydrophila and Providencia fragilis, as well as food-isolated bacteria such as Enterococcus faecalis and Salmonella enterica. It has extremely strong broad-spectrum antibacterial properties, but has no significant inhibitory or bactericidal effect on Lactobacillus and Saccharomyces cerevisiae. Furthermore, the defense peptide has low hemolytic activity at different concentrations, high safety, and extremely strong high-temperature stability.

[0033] The preparation method of the β-hairpin defense peptide Jz-Def and its derivative Jz-M3 of this invention adopts the mature FMOC solid-phase synthesis method and is purified by HPLC reverse-phase column chromatography. The process is mature and stable, simple to operate, easy to use and industrial production, and conducive to obtaining defense peptides with stable quality.

[0034] The β-hairpin defense peptides Jz-Def and Jz-M3 provided by this invention can directly kill pathogens. They have strong antibacterial and bactericidal properties against clinical pathogens, aquatic pathogens, and food pathogens. They are highly effective, fast-acting, have low hemolytic activity, high safety, and high temperature stability. They can be used in the preparation of antibacterial and bactericidal products, such as antibacterial infection drugs or drugs for treating torticollis in aquatic animals, and agents for preventing the spread of bacteria in food. They have great application prospects in the preparation of antibacterial and bactericidal agents, animal feed and additives, and food preservatives. Attached Figure Description

[0035] Figure 1 —This is a hemolytic activity analysis diagram of the β-hairpin defense peptide Jz-Def and its derivative Jz-M3 of the present invention;

[0036] Figure 2 —This is a high-temperature stability analysis diagram of the antibacterial activity of the β-hairpin defense peptide Jz-Def and its derivative Jz-M3 of the present invention.

[0037] Among them: A: Escherichia coli (CCTCC AB 2018675); B: Staphylococcus aureus (CMCC26003).

[0038] Figure 3 —This is a staining analysis diagram of MRSA treated with the β-hairpin defense peptide Jz-Def of the present invention after SYTO9 / PI double staining.

[0039] Figure 4 —Scanning electron micrographs of MRSA after treatment with PBS (negative control) or β-hairpin defense peptide Jz-Def;

[0040] Figure 5—This is a graph showing the effect of SYTO9 single staining on the mature biofilm of MRSA ATCC 43300, as detected in this invention.

[0041] Figure 6 —This is a graph showing the effect of crystal violet staining on the mature biofilm of MRSA ATCC 43300, as analyzed in this invention. Detailed Implementation

[0042] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0043] the term

[0044] In this invention, the term "mature peptide" refers to an active polypeptide formed through cleavage and modification during protein synthesis, possessing specific biological functions. Mature peptides can participate in regulating physiological processes such as cell growth, differentiation, and apoptosis, and can also act as signaling molecules such as hormones and neurotransmitters to transmit information.

[0045] Example 1

[0046] This embodiment describes a derivative of a β-hairpin defense peptide, Jz-Def, which has 18 amino acid residues and its amino acid sequence is shown in SEQ ID No. 1, specifically: YCRRVCGRKRCFTYCRGK.

[0047] The β-hairpin defense peptide was isolated and purified from the hemocytes of the spider *Gymnodon dactylus*. The β-hairpin defense peptide Jz-Def consists of a signal peptide with the amino acid sequences MNRTRVFACLFLAVLILIHESDA, a mature peptide with the amino acid sequences YCRRVCGRKRCFTYCRGK, an amidation signal peptide with the amino acid sequence GKR, and a spacer peptide with the amino acid sequence SVDESNVGDFSDLEKRAFDDSNIPSLVEERELDDEDAIFT. Its mature peptide has 7 different amino acids from the mature peptide amino acid sequence of Gomesin reported in the prior art.

[0048] The β-hairpin defense peptide is encoded by the following nucleotides, wherein the nucleotide sequences encoding the signal peptide, mature peptide, amidation signal, and spacer peptide are ATGAACCGAACTCGTGTATTTGCTTGCCTGTTTTTAGCTGTGCTGATTCTTATTCACGAGAGCGATGCC, TATTGCCGTAGGGTCTGTGGTCGGAAGCGCTGCTTCACTTACTGTAGAGGAAAA, GGAAAAAGG, AGTGTGGATGAGAGCAACGTTGGTGATTTTTCGGACCTAGAGAAAAGAGCTTTCGATGACTCCAATATCCCATCATTAGTAGAAGAGAGGGAGTTGGATGATGAAGATGCCATTTTCACT, and the stop codon is TAA.

[0049] Example 2

[0050] The derivative of the β-hairpin defense peptide in this embodiment is Jz-M3, which has 18 amino acid residues and its amino acid sequence is shown in SEQ ID No.2, specifically: RWCRRFCRNGRCVRYCWR.

[0051] The amino acid sequence of the β-hairpin defense peptide derivative was mainly obtained by designing the derivative based on the following principles:

[0052] 1) An amino acid sequence having the same or similar function as SEQ ID No. 1, obtained by substituting, deleting and / or adding 1 to 5 amino acids of the amino acid sequence shown in SEQ ID No. 1;

[0053] 2) An amino acid sequence obtained by cyclizing SEQ ID No. 1 or by modifying the N, C ends and / or side chains of SEQ ID No. 1.

[0054] This embodiment describes a method for preparing the β-hairpin defense peptide derivative Jz-M3, which involves solid-phase synthesis of the β-hairpin defense peptides Jz-Def and Jz-M3, followed by purification using high-performance liquid chromatography (HPLC). The specific steps include:

[0055] S1. Amino acid sequence design: Based on the characteristics of the isolated and purified mature peptide Jz-Def from *Ardisia japonica*—"Jz-Def has good antibacterial activity, especially against Gram-positive bacteria, while reducing hemolytic activity and cytotoxicity. Furthermore, Jz-Def enhances antibacterial activity and reduces hemolytic or cytotoxic activity by increasing tryptophan residues, amidating C-terminal R residues, and reducing charge. Multiple residue changes can enhance the antibacterial activity of the defensive peptide.", the applicant modified the mature peptide Jz-Def and designed the amino acid sequence of the defensive peptide derivative as shown in SEQ ID No. 2.

[0056] S2. Based on the amino acid sequence designed in S1, the crude polypeptide was synthesized using a solid-phase synthesis method.

[0057] The peptide was synthesized using the FMOC solid-phase synthesis method. The resin was soaked in N,N-dimethylformamide (DMF) for 2 hours to fully expand the pores and facilitate subsequent reactions. Deprotection was performed twice, once for 7 minutes and once for 8 minutes, using an activation solution (5% marl / DMF) to dissolve 6-chlorobenzotriazole-1,1,3,3-tetramethylurea hexafluorophosphate (HCTU) and 1-hydroxybenzotriazole (HOBt), and to activate the amino acids for 15 minutes. After activation, the column was washed 8 times with DMF, and the cap of the peptide synthesis tube was also cleaned. The activated system was then added to the peptide synthesis column and coupled in a rotary varaer for 1 hour. After each coupling cycle, the resin was washed 8 times with DMF to remove unreacted substances. Repeat the deprotection and coupling steps until the target sequence is obtained. After peptide deprotection, wash 8 times with anhydrous methanol, add lysis buffer (150 μL anisole, 150 μL anisole sulfide, 5.7 ml TFA), and lyse in a rotary cytometer for 2.5 h. Remove the resin, collect the filtrate containing the peptide, add 20 times the volume of ice-cold diethyl ether to the filtrate, centrifuge at 2500 rpm, 5 °C for 10 minutes, discard the diethyl ether solvent, blow off any residual diethyl ether, and vacuum dry the precipitate for 24 hours. Dissolve the solid residue in deionized water, freeze-dry to obtain a white flocculent solid, and store at -20 °C.

[0058] S3. The crude polypeptide was purified by HPLC reverse-phase column chromatography to obtain the defense peptide product, and the purity of the defense peptide was identified.

[0059] The specific method is as follows:

[0060] 0.1 mg of the crude peptide prepared in step S2 was dissolved in 1 mL of ultrapure water containing 0.1% trifluoroacetic acid. The solution was filtered through a 0.22 µm filter membrane. Mobile phase A was 0.1% trifluoroacetic acid-acetonitrile, and mobile phase B was 0.1% trifluoroacetic acid-water. The sample loading volume was 200 µL. A C18 column (AQ-C18, Welch) was used, and a binary mobile phase gradient elution system was employed for gradient elution. That is, the content of mobile phase A in the eluent increased linearly from 0% to 95% within 30 min. The flow rate was 1 mL / min, the detection wavelength was 215 nm, and the determination was carried out at 25 °C until the purity of the peptide was not less than 95%. Further refolding was performed to form disulfide bonds. HPLC reversed-phase column chromatography was performed again to obtain the purified defensive peptide product Jz-M3.

[0061] Example 3

[0062] 3.1 Detection of antibacterial activity of β-hairpin defense peptide Jz-Def and its derivative Jz-M3 against clinical pathogens

[0063] The minimum bactericidal concentration was determined using a modified broth microdilution method, as follows:

[0064] Bacteria were cultured in MHB medium at 37°C, and fungi were cultured in SDB medium at 37°C to obtain bacterial suspensions that had reached the mid-growth stage. These suspensions were then diluted to 1×10⁻⁶ with fresh MHB medium. 6 CFU / mL, diluted with SDB medium to 5 × 10⁻⁶. 3 CFU / mL. Add 50 μl of diluted bacterial suspension to each well of a sterile 96-well plate, and mix with 50 μl of a 2-fold serially diluted solution of β-hairpin defense peptide Jz-Def or its derivative Jz-M3. Incubate at 37°C for 1 hour. Then, transfer the liquid from the wells to a nutrient broth plate and incubate overnight at 37°C.

[0065] The culture medium for Lactobacillus plantarum was MRS medium, at 37°C, for 24 hours; the culture medium for Saccharomyces cerevisiae was YPD medium, at 28°C, for 48 hours.

[0066] MBC is defined as the minimum concentration at which no visible bacterial / fungal growth is observed. Bacterial suspensions treated with MHB or SDB medium serve as negative controls. Three independent experiments are performed in triplicate. Take 10 μl of sample from the minimum concentration and the next two concentrations, dilute 10-fold, and drop 10 μl of each sample onto a plate. Incubate overnight at 37°C. The minimum concentration at which no growth is observed is the minimum bactericidal concentration (MCB).

[0067] The antibacterial activities of the β-hairpin defense peptide Jz-Def and its derivative Jz-M3 in Examples 1 and 2 are shown in Table 1.

[0068] Table 1. Minimum bactericidal concentrations of β-hairpin defense peptides Jz-Def and Jz-M3

[0069]

[0070]

[0071] Note: Candida albicans, Candida glabrata, and Candida parapsilosis are all important pathogens causing hospital-acquired infections, especially in immunocompromised patients. All three types of Candida can cause vaginitis, but Candida albicans is the "common and typical" pathogen, while Candida glabrata and Candida parapsilosis are important causes of "complex, recurrent, and refractory" cases.

[0072] As shown in Table 1, the MBC values ​​of β-hairpin defense peptide Jz-Def ranged from 0.25 to 128 µM for different tested pathogens. Specifically, the MBC values ​​of β-hairpin defense peptide Jz-Def against Staphylococcus aureus, Candida albicans, methicillin-resistant Staphylococcus aureus, Escherichia coli, Acinetobacter baumannii, and Klebsiella pneumoniae were 0.25 μM, 2 μM, 4 μM, 8 μM, 8 μM, and 128 μM, respectively. However, at a concentration of 128 μM, β-hairpin defense peptide Jz-Def showed no significant inhibitory or bactericidal effect against Lactobacillus and Saccharomyces cerevisiae.

[0073] The MBC value of the β-hairpin defense peptide derivative Jz-M3 ranges from 0.125 to 8 µM. The MBC values ​​of β-hairpin defense peptide Jz-M3 against Staphylococcus aureus, Candida albicans, Methicillin-resistant Staphylococcus aureus, Escherichia coli, Acinetobacter baumannii, Klebsiella pneumoniae, and Candida parapsilosis are 0.125 μM, 1 μM, 2 μM, 4 μM, 2 μM, 2 μM, and 8 μM, respectively, demonstrating high antibacterial activity. However, at a concentration of 128 μM, the β-hairpin defense peptide derivative Jz-M3 showed no significant inhibitory effect on Lactobacillus and Saccharomyces cerevisiae.

[0074] Comparison of the MBC values ​​of the two defensive peptides Jz-Def and Jz-M3 shows that, except against Candida albicans (C. albicans ATCC 2002) and Candida parapsilosis, the antibacterial activity of the defensive peptide Jz-M3 is significantly stronger than that of the defensive peptide Jz-Def. Furthermore, neither of the two defensive peptides, Jz-Def nor Jz-M3, has a significant inhibitory effect on Lactobacillus or Saccharomyces cerevisiae.

[0075] In Example 1, the minimum bactericidal concentration (MPC) of the β-hairpin defense peptide Jz-Def against *Escherichia coli* (CCTCC AB2018675) and *Staphylococcus aureus* was significantly superior to that of the prior art antimicrobial peptide lycosin-II (CN201610221698.9, Central South University, "An Antimicrobial Peptide of *L. singoriensis* from Xinjiang and Its Application," and its antimicrobial activity against *Acinetobacter baumannii* was comparable to that of lycosin-II. Furthermore, the antimicrobial activity of Jz-Def against *Klebsiella pneumoniae* was slightly weaker than that of lycosin-II. This indicates that the β-hairpin defense peptide Jz-Def possesses stronger antimicrobial and bactericidal properties than common antimicrobial peptides.

[0076] The β-hairpin defense peptide Jz-M3 in Example 2 exhibits significantly superior antibacterial activity against Escherichia coli (CCTCC AB 2018675), Staphylococcus aureus, Acinetobacter baumannii, and Klebsiella pneumoniae compared to lycosin-II (CN201610221698.9__Central South University__An antimicrobial peptide of Xinjiang burrowing wolf spider L. singoriensis and its application__Invention authorization) in the prior art. Therefore, it can be concluded that the β-hairpin defense peptide Jz-M3 prepared in this invention has strong antibacterial and bactericidal properties, far exceeding the antibacterial properties of conventional antimicrobial peptides in the prior art.

[0077] 3.2 Detection of antibacterial activity of β-hairpin defense peptide Jz-Def and its derivative Jz-M3 against aquatic pathogens

[0078] The minimum bactericidal concentration was determined using a modified broth microdilution method, as follows:

[0079] Bacteria were cultured in MHB medium at 37°C to obtain a bacterial suspension that had reached the mid-growth stage, and then diluted with fresh MHB medium to a concentration of 1×10⁻⁶. 6 CFU / mL. Add 50 μl of diluted bacterial suspension to each well of a sterile 96-well plate, and mix with 50 μl of a 2-fold serially diluted solution of β-hairpin defense peptide Jz-Def or its derivative Jz-M3. Incubate at 37°C for 1 hour. Then, transfer the liquid from the wells to a nutrient broth plate and incubate overnight at 37°C.

[0080] The minimum bactericidal concentration (MBC) is defined as the minimum concentration at which no visible bacterial growth occurs. Bacterial suspensions treated with MHB or SDB medium serve as negative controls. Three independent experiments are performed in triplicate. Take 10 μl of sample from the minimum concentration and the next two concentrations, dilute 10-fold, and drop 10 μl of each sample onto a plate. Incubate overnight at 37°C. The minimum concentration at which no bacterial growth occurs is the minimum bactericidal concentration (MBC). The minimum bactericidal concentrations for different aquatic pathogens are shown in Table 3.

[0081] Table 2. Minimum bactericidal concentrations of β-hairpin defense peptides Jz-Def and Jz-M3 against aquatic pathogens.

[0082]

[0083] Note: Riverine cocci and West China providednium are pathogenic bacteria isolated from frogs suffering from torticollis.

[0084] As shown in Table 2, the MBC values ​​of β-hairpin defense peptide Jz-Def ranged from 1 to 16 µM for different tested aquatic pathogens. Specifically, the MBC values ​​of β-hairpin defense peptide Jz-Def against Aeromonas hydrophila, Vibrio parahaemolyticus, Vibrio vulnificus, Providensis huaxiensis, and Vagococcus fluvialis were 1 μM, 4 μM, 4 μM, 8 μM, and 16 μM, respectively.

[0085] The MBC value of the derivative of β-hairpin defense peptide Jz-M3 ranges from 0.5 to 8 µM. The MBC values ​​of β-hairpin defense peptide Jz-M3 against Aeromonas hydrophila, Vibrio parahaemolyticus, Vibrio vulnificus, Providensis huaxiensis, and V. fluvialis are 0.5 μM, 2 μM, 4 μM, 4 μM, and 8 μM, respectively, indicating high antibacterial activity.

[0086] Comparison of the MBC values ​​of the two defensive peptides Jz-Def and Jz-M3 shows that, except against Vibrio vulnificus, the antibacterial activity of the defensive peptide Jz-M3 is significantly stronger than that of the defensive peptide Jz-Def.

[0087] 3.3 Detection of antibacterial activity of β-hairpin defense peptide Jz-Def and its derivative Jz-M3 against food isolates

[0088] Bacteria were cultured in MHB medium at 37°C to obtain a bacterial suspension that had reached the mid-growth stage, and then diluted with fresh MHB medium to a concentration of 1×10⁻⁶. 6 CFU / mL. Add 50 μl of diluted bacterial suspension to each well of a sterile 96-well plate, and mix with 50 μl of a 2-fold serially diluted solution of β-hairpin defense peptide Jz-Def or its derivative Jz-M3. Incubate at 37°C for 1 hour. Then, spread the liquid from the wells onto nutrient broth agar plates and incubate overnight at 37°C. The minimum bactericidal concentrations for different food isolates are shown in Table 3.

[0089] Table 3. Minimum bactericidal concentrations of β-hairpin defense peptides Jz-Def and Jz-M3 against food-isolated bacteria.

[0090]

[0091] As shown in Table 3, the MBC values ​​of β-hairpin defense peptide Jz-Def ranged from 1 to 16 µM for different isolates from the tested foods. Specifically, the MBC values ​​of β-hairpin defense peptide Jz-Def against Enterococcus faecalis, Klebsiella variicola, K ascorbate, Klebsiella pneumoniae, Salmonella enterica, and Bacillus cereus were 1 μM, 1 μM, 2 μM, 2 μM, 4 μM, and 16 μM, respectively.

[0092] The MBC value of the derivative of β-hairpin defense peptide Jz-M3 ranges from 0.5 to 8 µM. The MBC values ​​of β-hairpin defense peptide Jz-M3 against Enterococcus faecalis, Klebsiella variicola, K ascorbate, Klebsiella pneumoniae, Salmonella enterica, and Bacillus cereus are 0.5 μM, 1 μM, 1 μM, 1 μM, 1 μM, and 8 μM, respectively, indicating high antibacterial activity.

[0093] Comparison of the MBC values ​​of the two defensive peptides Jz-Def and Jz-M3 shows that, except against Klebsiella variicola, the antibacterial activity of the defensive peptide Jz-M3 is significantly stronger than that of the defensive peptide Jz-Def.

[0094] In summary, β-hairpin defense peptides Jz-Def and Jz-M3 not only have strong antibacterial and bactericidal properties against common clinical pathogens, but also have extremely strong antibacterial and bactericidal properties against aquatic pathogens and food isolates. Furthermore, existing technologies utilize antimicrobial peptides derived from spiders, such as the antimicrobial peptide lycosin-II.

[0095] 3.4 Hemolytic activity of β-hairpin defense peptide Jz-Def and its derivative Jz-M3

[0096] The hemolytic activity of the defensive peptides Jz-Def and Jz-M3 was determined through the following steps:

[0097] Collect 1 mL of fresh anticoagulated human blood, centrifuge at 1000 g for 5 min to remove plasma and leukocytes, and collect red blood cells. Wash the red blood cells three times with physiological saline (0.9% NaCl) to prepare a 6% red blood cell suspension. Dissolve the test peptide in physiological saline to prepare different concentration gradients. Then, mix 100 μL of red blood cell solution with an equal volume of peptide solution and add it to a 96-well plate, incubate at 37°C for 1 h. Transfer the supernatant to a new 96-well plate and measure the absorbance at 540 nm. Use physiological saline-treated red blood cells as a negative control and 1% Triton X-100-treated red blood cells as a positive control.

[0098] Hemolysis % = (X sample - X negative) / (X positive - X negative) × 100%.

[0099] X: Absorbance at 540 nm.

[0100] Hemolysis results as follows Figure 1 As shown. The hemolysis rates of the defensive peptides Jz-Def and Jz-M3 of this invention are both below 10% at 320 µM, while the hemolysis rate of bee venom exceeds 80% at a concentration of 5 µM. Jz-Def and Jz-M3 exhibit low hemolytic toxicity, far lower than the hemolytic reaction of the defensive peptide lycosin-II (20% hemolysis rate at 50 µM). Therefore, it can be concluded that the defensive peptides Jz-Def and Jz-M3 have low hemolytic activity, and human erythrocytes are extremely less sensitive to the defensive peptides Jz-Def and Jz-M3 compared to pathogenic cells.

[0101] High-temperature stability of the antibacterial activity of 3,5β-hairpin defense peptide Jz-Def and its derivative Jz-M3

[0102] To evaluate whether the defensive peptides Jz-Def and Jz-M3 retained their antibacterial activity after high-temperature treatment, the Jz-M3 peptide solution was treated at 37°C, 60°C, 80°C, 100°C, and 121°C for 20 minutes. Immediately after treatment, the peptides were cooled in an ice bath to prevent further denaturation. Subsequently, the high-temperature treated defensive peptides were diluted to 2×MBC in MHB medium, added to 96-well plates, and incubated at 37°C with an equal volume of 1×10⁻⁶ Escherichia coli (CCTCC AB 2018675) and Staphylococcus aureus (CMCC26003) bacterial suspensions. 6 Incubate with CFU / ml for 18 hours. OD600 nm is measured using a microplate reader, with an unheated defensive peptide solution as a 100% activity control and untreated bacteria as a negative control.

[0103] The high-temperature stability of the antibacterial activity of the defensive peptides Jz-Def and Jz-M3 is as follows: Figure 2As shown in -A and 2-B, the antibacterial activity of the defensive peptides Jz-Def and Jz-M3 against Escherichia coli and Staphylococcus aureus remained unchanged after treatment at 121℃ for 20 minutes, demonstrating that the β-hairpin defensive peptides Jz-Def and Jz-M3 can maintain stable antibacterial activity after high-temperature treatment.

[0104] 3.6 Effects of β-hairpin defense peptide Jz-Def on MRSA cell membrane

[0105] The effects of Jz-Def on bacterial membranes were examined using SYTO9 / PI double staining and scanning electron microscopy. Figure 1 As shown in the fluorescence microscope, bacteria with intact membranes are stained green by SYTO9, while bacteria with damaged membranes are stained red by PI. SYTO9 is a green fluorescent dye that can penetrate the cell membrane to enter living cells, bind to DNA, and be retained by bacteria with intact cell membranes, emitting green fluorescence. PI, on the other hand, is a red fluorescent dye that cannot pass through intact cell membranes. If bacteria lose their membrane integrity, PI will penetrate the leaked cell membrane, staining the nuclear DNA within the cell red with its fluorescence.

[0106] It should be noted that this experiment used a relatively high concentration of bacteria (1×10⁻⁶). 8 (CFU / mL) to obtain a better field of view. The concentration used for MIC measurement is 1×10⁻⁶. 5 CFU / mL, therefore, as Figure 3 As shown, bacteria still emitted green fluorescence under 4×MIC Jz-Def. With increasing Jz-Def concentration, more cells showed red fluorescence, while green fluorescence relatively decreased. This indicates that bacterial cell walls and cell membranes are disrupted with increasing Jz-Def concentration. The control group, treated with PBS solution, showed only green fluorescence in the field of view, with no red fluorescence, indicating no damage to MRSA ATCC 43300.

[0107] To investigate the effects of Jz-Def treatment on the cell membrane morphology and integrity of MRSA ATCC 43300 cells, scanning electron microscopy (SEM) analysis was performed. The SEM images are shown below. Figure 4 As shown, after treatment with the defense peptide Jz-Def for 30 minutes, the bacterial surface became noticeably rough, with wrinkles and cracks appearing.

[0108] 3.8 Effects of β-hairpin defense peptide Jz-Def on the mature biomembrane of MRSAATCC 43300

[0109] The effects of Jz-Def on mature MRSA ATCC 43300 biofilms were detected using SYTO9 single staining and crystal violet staining. Figure 5As shown: Under a fluorescence microscope, all cells were stained green by SYTO9, and the green fluorescence in the field of view gradually decreased as the concentration of the treated peptide increased, indicating that the number of cells in the MRSA biofilm gradually decreased with the increase of the antimicrobial peptide concentration.

[0110] Crystal violet is a basic dye that binds to negatively charged components of bacterial cell walls, giving bacteria a purple hue. The deeper the color, the higher the corresponding OD (October Spectrum). 575 A higher value indicates a thicker biofilm and a greater number of bacteria, and vice versa. To investigate the effect of the defense peptide Jz-Def treatment on the mature biofilm of MRSA, a crystal violet staining experiment was performed. Figure 6 The OD shown 575 The value gradually decreased with increasing concentration of the defense peptide Jz-Def treatment, meaning that the biofilm thickness and cell number in the MRSA biofilm decreased with increasing drug treatment concentration.

[0111] The results of SYTO9 single staining and crystal violet staining analysis were consistent, indicating that the β-hairpin defense peptide Jz-Def can disperse mature MRSA biofilms.

[0112] As can be seen from the above, the β-hairpin defense peptide Jz-Def mainly exerts its antibacterial and bactericidal effects on pathogens by acting on the cell membrane. In summary, the defense peptides Jz-Def and Jz-M3 of this invention possess excellent antibacterial properties, and these properties are minimally affected by temperature changes, exhibiting good high-temperature stability. Furthermore, the defense peptides Jz-Def and Jz-M3 exhibit low hemolytic activity and high safety. Therefore, the applicant proposes the application of the aforementioned defense peptides Jz-Def and Jz-M3 in the preparation of antibacterial and bactericidal agents, feed and additives in animal husbandry, and food preservatives.

[0113] The antibacterial spectrum of bacteriostatic agents includes Gram-negative bacteria, Gram-positive bacteria, and fungi.

[0114] The Gram-positive bacteria include at least one of the following: Staphylococcus aureus, methicillin-resistant Staphylococcus aureus, Streptococcus agalactiae, human fekrimella, and Enterococcus faecalis.

[0115] The Gram-negative bacteria include at least one of the following: Escherichia coli, Klebsiella pneumoniae, Klebsiella variicola, Salmonella enterica, Acinetobacter baumannii, Providencia, Aeromonas hydrophila, Vibrio parahaemolyticus, Vibrio vulnificus, Proteus mirabilis, and K. ascorbate.

[0116] The fungi include at least one of the following: Candida albicans (C. albicans ATCC2002), Candida parapsilosis, and Candida glabrata.

[0117] It should be noted that the derivatives of the β-hairpin defense peptide of the present invention, obtained through design or modification, may also have any of the following amino acid sequences:

[0118] 1) An amino acid sequence obtained by substituting, deleting and / or adding 1 to 5 amino acids to SEQ ID No. 1 or SEQ ID No. 2, and having the same or similar function as SEQ ID No. 1 or SEQ ID No. 2;

[0119] 2) An amino acid sequence obtained by cyclizing SEQ ID No. 1 or SEQ ID No. 2 or by modifying the N, C ends and / or side chains of SEQ ID No. 1 or SEQ ID No. 2.

[0120] Example 4

[0121] An antibacterial and bactericidal agent, the active ingredient of which is the defensive peptide Jz-M3, and the concentration of the defensive peptide Jz-M3 is greater than or equal to 8 μM.

[0122] Example 5

[0123] An antibacterial and bactericidal agent, the active ingredient of which is the defensive peptide Jz-Def, and the concentration of the defensive peptide Jz-Def is greater than or equal to 128 μM.

[0124] Example 6

[0125] An antibacterial and bactericidal agent, the active ingredients of which are defensive peptides Jz-Def and Jz-M3 in a weight ratio of 1:1, wherein the concentration of defensive peptide Jz-Def is greater than or equal to 16 μM and the concentration of defensive peptide Jz-M3 is greater than or equal to 8 μM, thereby giving the antibacterial and bactericidal agent of this embodiment extremely high antibacterial and bactericidal performance.

[0126] Example 7

[0127] An antibacterial and bactericidal agent, the active ingredients of which are defensive peptides Jz-Def and Jz-M3 in a weight ratio of 1:2, wherein the concentration of defensive peptide Jz-Def is greater than or equal to 8 μM and the concentration of defensive peptide Jz-M3 is greater than or equal to 8 μM, thereby giving the antibacterial and bactericidal agent of this embodiment high antibacterial and bactericidal performance.

[0128] Example 8

[0129] An antibacterial and bactericidal agent, the active ingredients of which include defensive peptides Jz-Def, Jz-M3 and Lophatherum gracile extract in a weight ratio of 1:2:1, wherein the concentration of defensive peptide Jz-Def is greater than or equal to 16 μM and the concentration of defensive peptide Jz-M3 is greater than or equal to 4 μM, thereby giving the antibacterial and bactericidal agent of this embodiment high antibacterial and bactericidal performance.

[0130] The antibacterial and bactericidal agent is a medicine or skin care product.

[0131] In this embodiment, the Lophatherum gracile extract can be replaced by one or more antibacterial and bactericidal active ingredients from proteins, peptides, plant extracts, and cytokines. For example, the lycosin-II defense peptide (see CN105777885A, a defense peptide of Lycosa singoriensis in Xinjiang and its application) can be used. The plant extract can be an antibacterial and bactericidal active ingredient disclosed in the prior art, such as Eucommia ulmoides extract, and it can have a synergistic antibacterial and bactericidal effect with the defense peptides Jz-Def and Jz-M3.

[0132] It should be noted that:

[0133] The antibacterial and bactericidal agents of the present invention, such as those described in Examples 5-8, further include excipients required for preparing the defensive peptides into pharmaceuticals or skincare products. These excipients may be one or more of fillers, wetting agents, binders, disintegrants, lubricants, and surfactants. The fillers include one or more of starch, powdered sugar, dextrin lactose, compressible starch, microcrystalline cellulose, calcium sulfate, dicalcium phosphate, and mannitol. The wetting agents and binders include distilled water, ethanol, starch paste, sodium carboxymethyl cellulose, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, hydroxypropyl methyl cellulose, gelatin solution, sucrose solution, and aqueous or alcoholic solutions of polyvinylpyrrolidone (pVp). The disintegrants include one or more of dry starch, sodium methyl starch, low-substituted hydroxypropyl cellulose, croscarmellose, and croscarmellose sodium. The lubricants include one or more of magnesium stearate, micronized silica gel, talc, hydrogenated vegetable oil, polyethylene glycols, and magnesium lauryl sulfate. The surfactants include sodium dodecyl sulfate.

[0134] The present invention does not impose any special limitations on the preparation of the antibacterial and bactericidal agent. It can be prepared according to conventional methods in the field, based on the type of active ingredient and the selection of excipients.

[0135] The antibacterial and bactericidal agent of the present invention can also be modified by adjusting the weight ratio of the defensive peptides Jz-Def and Jz-M3, and by adding other antibacterial and bactericidal active ingredients, depending on the type and quantity of pathogens to be inhibited and killed, thereby improving the antibacterial performance of the antibacterial and bactericidal agent. The present invention will not list them all. The changes in the above technical features can be understood and implemented by those skilled in the art through the text description, so no further drawings are provided.

Claims

1. A β-hairpin defense peptide, characterized in that, The defensive peptide is Jz-Def, which has 18 amino acid residues, and its amino acid sequence is shown in SEQ ID No. 1, specifically: YCRRVCGRKRCFTYCRGK.

2. A derivative of a β-hairpin defense peptide, characterized in that, The derivative is a defensive peptide Jz-M3, which has 18 amino acid residues, and its amino acid sequence is shown in SEQ ID No. 2, specifically: RWCRRFCRNGRCVRYCWR.

3. A derivative of a β-hairpin defense peptide, characterized in that, The derivative of the β-hairpin defense peptide has any of the following amino acid sequences: 1) An amino acid sequence that has the same or similar function as SEQ ID No. 1 or SEQ ID No. 2, obtained by substituting, deleting and / or adding 1 to 5 amino acids of the amino acid sequence shown in SEQ ID No. 1 or SEQ ID No. 2; 2) An amino acid sequence obtained by cyclizing SEQ ID No. 1 or SEQ ID No. 2 or by modifying the N, C ends and / or side chains of SEQ ID No. 1 or SEQ ID No.

2.

4. The use of a β-hairpin defense peptide as described in claim 1 and / or a derivative of the β-hairpin defense peptide as described in claim 2 or 3 in the preparation of antibacterial and bactericidal drugs or products.

5. The application as described in claim 4, characterized in that, The antibacterial spectrum of the antibacterial and bactericidal drugs includes Gram-negative bacteria, Gram-positive bacteria, and fungi; The Gram-positive bacteria include at least one of the following: Staphylococcus aureus (Staphylococcus aureus) Staphylococcus aureus Staphylococcus epidermidis ( Staphylococcus epidermidis Methicillin-resistant Staphylococcus aureus Staphylococcus aureus ), agalactococcus ( Streptococcus agalactiae ), human fecal blue bacteria ( Facklamia hominis ) and Enterococcus faecalis ( Enterococcus faecalis ); The Gram-negative bacteria include at least one of the following: Escherichia coli (Escherichia coli) Escherichia coli ), Klebsiella pneumoniae ( Klebsiella Pneumoniae ), Klebsiella variegata ( Klebsiella variicola ), intestinal Salmonella ( Salmonella enterica Acinetobacter baumannii ( Acinetobacter baumnnii ), Providencia ( Providencia Aeromonas hydrophila ( ) Aeromonas hydrophila Vibrio parahaemolyticus ( Vibrio parahaemolyticus Vibrio vulnificus ( Vibrio vulnificus ), Proteus mirabilis ( Proteus mirabilis ) and ascorbic acid ruviril ( Kluyvera ascorbate ); The fungus includes at least one of the following: Candida albicans ( Candida albicans ), Candida parapsilosis ( Candida parapsilosis ), Candida glabrata ( Candida glabrata ).

6. A bacteriostatic and bactericidal agent, characterized in that, The active ingredient of the antibacterial and bactericidal agent is the β-hairpin defense peptide as described in claim 1 and / or a derivative of the β-hairpin defense peptide as described in any one of claims 2 and 3.

7. The antibacterial and bactericidal agent as described in claim 6, characterized in that, The concentration of the β-hairpin defense peptide Jz-Def is ≥0.25 μM; the concentration of the β-hairpin defense peptide Jz-M3 is ≥0.125 μM.

8. The antibacterial and bactericidal agent as described in claim 6, characterized in that, The antibacterial and bactericidal agent further includes one or more antibacterial and bactericidal active ingredients selected from proteins, peptides, plant extracts, and cytokines. The antibacterial and bactericidal agent is a pharmaceutical product or a product with a disinfection or medical device registration number. The antibacterial and bactericidal agent also includes excipients required for preparing the defensive peptide into a pharmaceutical product or skin care product. The excipients are one or more selected from fillers, wetting agents, binders, disintegrants, lubricants, and surfactants.

9. The use of a β-hairpin defense peptide as described in claim 1 and / or a derivative of the β-hairpin defense peptide as described in claim 2 or 3 in animal husbandry as feed and additive.

10. The use of a β-hairpin defense peptide as described in claim 1 and / or a derivative of the β-hairpin defense peptide as described in claim 2 or 3 in food preservatives and antiseptics.

Images