Aptamer dynamic range compression and detection techniques

Abstract

Aptamer detection techniques with dynamic range compression are described that allow for removal of a portion of a richer aptamer in aptamer-based assays. In embodiments, the high-abundance oligonucleotides may tend to re-anneal each other under certain hybridization conditions when in the double-stranded form relative to the low-abundance oligonucleotides. These re-annealed fragments may be digested or may not be used for amplification. In embodiments, complementary regions of different lengths may be used to differentially capture high-abundance oligonucleotides relative to low-abundance oligonucleotides. The low abundance oligonucleotides can be captured with longer complementary regions that can provide more robust hybridization at annealing temperatures relative to shorter complementary regions.

Description

Cross-references to related applications

[0001] This application claims priority and benefit to U.S. Provisional Application No. 63 / 535,9712, filed August 31, 2023, the disclosure of which is incorporated herein by reference in its entirety. Reference for electronic sequence listing

[0002] This application contains a sequence list, which has been electronically submitted in .XML format and is incorporated herein by reference in its entirety. The .XML copy created on August 21, 2024, is named “ILUM_0138PCT.xml” and has a size of 27,678 bytes. The sequence list contained in this .XML file is part of this specification and is incorporated herein by reference in its entirety. Background Technology

[0003] The disclosed technology generally relates to aptamer detection and / or identification techniques for dynamic range compression in conjunction with aptamer-based assays. Specifically, the disclosed technology relates to nucleic acid sequencing for direct or indirect aptamer detection in conjunction with aptamer-based assays.

[0004] The topics discussed in this section should not be considered prior art simply because they are mentioned here. Similarly, problems mentioned in this section or related to the topics provided as background art should not be assumed to have been previously recognized in the prior art. The topics in this section merely represent different methods, which themselves may correspond to specific implementations of the technology protected by the claims.

[0005] Protein expression patterns help define a cell's identity and state. RNA transcripts are often used as a substitute for protein expression, but the relationship between protein abundance and mRNA is not one-to-one. Differences exist due to post-transcriptional, translational, and protein degradation regulation. Therefore, direct nucleic acid sequencing of RNA transcripts may not accurately estimate protein expression.

[0006] Aptamers are nucleic acids that bind to molecular targets, such as proteins, with high affinity and specificity. Advances in aptamer selection and design include the evolution of exponentially enriched ligand systems (SELEX). In SELEX, high-affinity nucleic acids for different analytes of interest can be isolated from combinatorial libraries, allowing for high-throughput characterization of aptamer-target binding and multiplex assays of analytes in complex biological samples. After aptamer binds to the analyte target, the binding event can be detected to characterize the presence and concentration of various analytes in the biological sample. However, identifying the useful detection range for multiplex aptamer-based assays is challenging because the concentrations of proteins or other analytes can vary considerably within and / or between different biological samples. Summary of the Invention

[0007] In one embodiment, this disclosure provides a method for aptamer detection. The method includes contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of analyte-aptamer complexes, wherein different aptamers among these plurality of aptamers have specific affinity for corresponding different analytes among these analytes, and detecting the analytes by detecting the aptamers in these analyte-aptamer complexes. Detection of the aptamer includes generating a double-stranded oligonucleotide from the aptamer, each double-stranded oligonucleotide comprising a single aptamer and a complementary strand; denaturing the double-stranded oligonucleotide under denaturing conditions to generate a denatured strand comprising a single aptamer and a complementary strand; contacting the denatured strand with primers under re-annealing conditions, such that some of the denatured strands in the denatured strand re-anneal each other, and some of the denatured strands in the denatured strand anneal with the primers; extending the primers from the annealed to denatured strand using a polymerase to generate an amplicon; and detecting the aptamer using the amplicon.

[0008] In one embodiment, this disclosure provides a method for aptamer detection. The method includes contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of analyte-aptamer complexes, wherein different aptamers among these plurality of aptamers have specific affinity for corresponding different analytes among these analytes, and detecting the analytes by detecting the aptamers in these analyte-aptamer complexes. Detection of the aptamer includes generating a double-stranded oligonucleotide from the aptamer, each single double-stranded oligonucleotide comprising a single aptamer and a complementary strand; denaturing the double-stranded oligonucleotide under denaturing conditions to generate a denatured strand comprising a single aptamer and a complementary strand; contacting the denatured strand with a nuclease under re-annealing conditions such that some of the denatured strands re-anneal each other and some of the denatured strands no longer anneal; allowing the nuclease to digest the re-annealed strand; extending the primer from the annealed to denatured strand using a polymerase to generate an amplicon; and detecting the aptamer using the amplicon.

[0009] In one embodiment, this disclosure provides a method for aptamer detection. The method includes contacting an analyte of a sample with a plurality of aptamers under conditions allowing for the formation of analyte-aptamer complexes, wherein different aptamers among these plurality of aptamers have specific affinities for corresponding different analytes among these analytes, and detecting the analytes by detecting the aptamers in these analyte-aptamer complexes. Detecting the aptamer includes contacting the aptamer with one or more trap beads, wherein the one or more trap beads comprise a plurality of single-chain trap molecules, each individual trap molecule comprising a complementary region complementary to a portion of an individual aptamer, wherein there is a diversity in the length of the complementary region among the plurality of single-chain trap molecules, and wherein the contact is performed under conditions allowing at least some of the aptamers to hybridize with the plurality of single-chain trap molecules. Detection also includes separating the one or more beads from the hybridized aptamers; and detecting the hybridized aptamers. Attached Figure Description

[0010] These and other features, aspects, and advantages of the disclosed embodiments will become better understood when the following detailed description is read with reference to the accompanying drawings, in which the same characters denote the same parts throughout the drawings, wherein:

[0011] Figure 1 This is a schematic diagram of the example dynamic range within the sample according to the implementation plan;

[0012] Figure 2 An example workflow for dynamic range compression based on the implementation scheme is shown;

[0013] Figure 3 An example workflow for dynamic range compression based on aptamer abundance using different probe mixtures is shown according to the implementation scheme;

[0014] Figure 4 This is a schematic diagram illustrating the separation of the capture probe and the reporting probe according to the implementation plan;

[0015] Figure 5 This is a schematic diagram of a three-molecule complex used in conjunction with dynamic range compression technology according to the implementation plan;

[0016] Figure 6 An example arrangement of the non-hybridized region according to the implementation scheme is shown;

[0017] Figure 7 An example report probe direct amplification technique according to an implementation scheme is shown;

[0018] Figure 8 Example sequencing from direct amplification technology according to the implementation scheme is shown;

[0019] Figure 9 An example report probe step-out amplification technique according to the implementation scheme is shown;

[0020] Figure 10 Example sequencing from stepwise amplification technology according to the implementation scheme is shown;

[0021] Figure 11 An example report probe ligation amplification technique according to the implementation scheme is shown;

[0022] Figure 12 Example sequencing from ligation amplification technology according to the implementation scheme is shown;

[0023] Figure 13 An example of a clamp connection technique according to an implementation scheme is shown;

[0024] Figure 14 An example extended connectivity technology according to an implementation scheme is shown;

[0025] Figure 15 An example extended connectivity technology according to an implementation scheme is shown;

[0026] Figure 16 An example split report probe technique according to an implementation scheme is shown;

[0027] Figure 17 An example of a split report probe technique using a clamp according to an implementation scheme is shown;

[0028] Figure 18 An example exonuclease digestion in conjunction with split reporter probe technology according to the implementation scheme is shown;

[0029] Figure 19 An example exonuclease digestion combined with circularized cleavage reporter probe technology is shown according to the implementation scheme;

[0030] Figure 20 An example virtual report technique using a mixture of expandable and non-expandable regions according to an implementation scheme is shown;

[0031] Figure 21 An example virtual reporter technique using the complete restriction enzyme site is illustrated according to the implementation scheme;

[0032] Figure 22 An example exonuclease digestion technique according to the implementation scheme is shown;

[0033] Figure 23 An example of a bead-based selection technique according to an implementation scheme is shown;

[0034] Figure 24 An example dynamic range compression workflow using primer competition is shown according to the implementation scheme;

[0035] Figure 25 An example dynamic range compression workflow using nuclease digestion according to the implementation scheme is shown;

[0036] Figure 26 An example dynamic range compression splitting workflow using nuclease digestion according to the implementation scheme is shown;

[0037] Figure 27 An example of a dynamic range compression trapping bead and a corresponding variable-length complementary region according to an implementation scheme is shown;

[0038] Figure 28 The embodiment illustrates the temperature-based binding of the aptamer to capture beads according to the implementation scheme;

[0039] Figure 29Multiple trapping beads with aptamers using complementary regions of different lengths for trapping, according to an embodiment, are shown;

[0040] Figure 30 An example streamlined workflow using index augmentation according to the implementation scheme is shown;

[0041] Figure 31 It is a comparison from Figure 30 A graph showing the sequencing read counts from the streamlined workflow versus the sequencing read counts from the ligation preparation workflow;

[0042] Figure 32 An example workflow with reduced washing steps is shown according to the implementation plan;

[0043] Figure 33 The sequence read counts under different washing conditions are shown;

[0044] Figure 34 This demonstrates the use of virtual biotin with different aptamers to compress sequencing read counts;

[0045] Figure 35 Examples of undesired, nonspecific binding between aptamer-binding regions are shown;

[0046] Figure 36 This demonstrates the contribution of different aptamer-binding regions to nonspecific binding; and

[0047] Figure 37 It is a block diagram of a sequencing device configured to acquire sequencing data according to the implementation plan. Detailed Implementation

[0048] The following discussion is presented to enable any person skilled in the art to implement and use the disclosed technology, and is provided in the context of a particular application and its requirements. Various modifications to the specific embodiments disclosed will be apparent to those skilled in the art, and the general principles defined herein can be applied to other specific embodiments and applications without departing from the spirit and scope of the disclosed technology. Therefore, the disclosed technology is not intended to be limited to the specific embodiments shown, but is to be accorded the broadest scope consistent with the principles and features disclosed herein.

[0049] Aptamers are short, single-stranded nucleic acid molecules (ssDNA or ssRNA) that can bind with high affinity to their specific target molecules. Therefore, aptamers can be used in multi-omics applications, such as high-throughput proteomic characterization of samples. However, combining aptamers for high-abundance proteins with those for low-abundance proteins in a single set is challenging for high-throughput protein assessment in complex samples. For example, the concentrations of proteins in human serum / plasma can differ by many orders of magnitude, such as the 10-log range. Some aptamer detection platforms can compress the dynamic range of the detected proteins. However, even after compression, the dynamic range may still remain relatively large. Figure 1 An example 5-log dynamic range within the aptamer detection results of the sample is shown, and three different aptamers with positive binding results are illustrated along the wide dynamic range. To address the complexity of the dynamic range, sample pretreatment or targeted panels can be used to measure proteins within a specific range. These methods add additional complexity and the chance of losing low concentrations of protein.

[0050] This document discloses a technique for compressing the dynamic range of aptamers with positive binding results (e.g., binding to target molecules in a sample), and said technique can occur before or in conjunction with an aptamer detection step. The technique preserves aptamer binding for low-abundance proteins evaluated alongside high-abundance proteins. Furthermore, because low-abundance proteins may correspond to biomarkers that can be used for diagnostic purposes, the disclosed technique prevents noise or false negative results in aptamer-based assays caused by ambiguous results from high-abundance proteins. Additionally, reducing the dynamic range can also reduce the amount of total sequencing data required to detect aptamers in an assay by reducing the number of reads wasted on high-abundance aptamer sequences. In some embodiments, the disclosed technique can provide a streamlined workflow with reduced equipment burden by reducing multiple steps (e.g., a single hybridization reaction or a reduction in the number of washing steps). The disclosed technique may include sample preparation steps and / or sample preparation that allow for improved aptamer abundance measurements.

[0051] Figure 2 An example workflow for dynamic range compression is shown, where the dynamic range of a single aptamer 14a can be compressed by removing some of the aptamers 14a prior to the detection step. The workflow shown illustrates dynamic range compression for a single aptamer type of aptamer 14a. It should be understood that the workflow shown can be extended in parallel to all aptamers in a multiplex aptamer-based assay. Furthermore, the assay eluent may include multiple aptamers 14a, depending on the concentration of the target molecule of aptamer 14a in the sample being evaluated. Aptamer 14a is a single-stranded nucleic acid having a fixed or substantially fixed nucleic acid sequence. Therefore, copies of a single aptamer 14a or multiple single aptamers can all share a conserved sequence. It is commonly referred to as aptamer 14 (see [link to documentation]). Figure 3Different aptamers can have different nucleic acid sequences relative to each other, which promotes different target specificities for the corresponding different aptamers 14.

[0052] Using the conserved sequence of aptamer 14a, a probe set 20 can be designed, comprising a first probe 22 that hybridizes to a first region 23 of aptamer 14a (e.g., via a complementary sequence) and a second probe 24 that hybridizes to a second region 25 of aptamer 14a. The first probe 22 is a mixture of at least two different types of probes, both capable of hybridizing to the first region 23. As shown, the mixture includes an affinity-labeled probe 28 containing an affinity tag 30 and a dummy probe 32 lacking the affinity tag 30. In embodiments, the affinity-labeled probe 28 and the dummy probe 32 are identical except for the presence or absence of the affinity tag 30. The ratio of the affinity-labeled probe 28 to the dummy probe 32 can be adjusted based on the abundance of the target of aptamer 14a, as generally discussed herein.

[0053] The workflow includes contacting aptamer 14a with probe set 20 (e.g., with first probe 22 and second probe 24). Because both the affinity-labeled probe 28 and the dummy probe 32 of the first probe 22 have the same binding affinity and specificity to the first region 23 of aptamer 14a, contact between the first probe and aptamer 14a results in binding of both affinity-labeled probe 28 and dummy probe 32. If affinity-labeled probe 28 is present in small amounts in the mixture of first probes 22 (e.g., less than 10% by way of example), the majority of aptamer 14a will bind to dummy probe 32. Furthermore, all second probes 24 can be identical to each other. Thus, two different types of tripolecular complexes are formed with respect to aptamer 14a. Type 33 comprises second probe 24 and dummy probe 32. Type 34 comprises second probe 24 and affinity-labeled probe 28. Again, because the first probe 22 is provided as a mixture, the relative ratio of the tripolecular complexes of type 33 and type 34 depends on the ratio of affinity-labeled probe 28 to dummy probe 32 in the first probe 22. The ratio of affinity-labeled probe 28 to virtual probe 32 can be selected for each aptamer in assay based on its relative abundance relative to other aptamers to compress the dynamic range of downstream detection (e.g., via NGS).

[0054] The workflow also includes a step of separating the trimolecular complex of type 33 from the trimolecular complex of type 34 via a capture entity. For example, only the trimolecular complex of type 34 may be captured using a capture entity (shown herein as capture beads 36 coupled to affinity tag binding agent 38). However, other arrangements are also considered, including column-based, flow cell-based, or substrate-based separation using a capture entity bound to affinity tag 30. Unbound type 33 may be washed or separated, leaving only the trimolecular complex of type 34 and its component molecules, aptamer 14a, affinity-tagged probe 28, and second probe 24. Additionally, unbound or uncaptured probes of probe set 20 are also removed. The workflow also includes detecting (e.g., via sequencing) the second probe 24 or oligonucleotides amplified or otherwise derived from the second probe 24 as an alternative measure of aptamer 14a as discussed herein.

[0055] Figure 3 An example workflow comparing the dynamic range compression of high-abundance aptamer 14a and low-abundance aptamer 14b is shown. For example, high-abundance aptamer 14a may have specific binding affinity for known abundant proteins such as albumin, α-2-macroglobulin, apolipoprotein A1, complement C4, IgG, IgM, apolipoprotein A2, α-1-antitrypsin, plasminogen, or collagen. Low-abundance aptamer 14b may have specific binding affinity for biomarkers, transiently expressed proteins, proteins expressed only in specific cell types, etc. It should be understood that these are examples, and the identity of the protein target depends on the composition of the aptamers in the aptamer-based assay. Furthermore, it should be understood that in some embodiments, high-abundance and low-abundance aptamers may be based on their abundance relative to each other or on the abundance of other aptamers in the aptamer-based assay, rather than absolute abundance or concentration.

[0056] In the example shown, it can be expected, for example, that high-abundance aptamer 14a will be present in a higher concentration in the aptamer-based assay eluent relative to low-abundance aptamer 14b, based on empirical studies or retrospective analyses. Therefore, to compress the dynamic range of downstream detection steps, different mixtures of the first probes in probe sets 20a, 20b can be used based on predicted abundance. For high-abundance aptamer 14a, a relatively larger amount of aptamer-bound dummy complex can be removed via binding to dummy probe 32a. Therefore, dummy probe 32a can be present in the first probe 22a at a higher percentage. To convert less aptamer 14b via dummy binding prior to the detection step, dummy probe 32b can be present in the first probe 22b at a relatively lower percentage. In one embodiment, the percentage of dummy probe 32b can be 0%. That is, for some aptamers, probe 22 may include only labeled probe 28 and not dummy probe 32. Therefore, the ratio of dummy probe 32 to affinity labeled probe 28 can be adjusted and can be different for different aptamers 14. In the implementation scheme, during high-throughput assays, each individual aptamer 14 can be associated with a different ratio of virtual probe 32 and affinity-labeled probe 28.

[0057] In an embodiment, the ratio of dummy probe 32 to affinity-labeled probe 28 in the mixture of first probes 22 can be greater than 100,000:1, greater than 10,000:1, greater than 1,000:1, greater than 100:1, greater than 20:1, greater than 10:1, greater than 5:1, greater than 2:1, about 1:1, less than 1:2, or less than 1:5. In an embodiment, the mixture of first probes 22 includes only dummy probe 32 or affinity-labeled probe 28, and excludes other probe types. In an embodiment, dummy probe 32 constitutes at least 25%, at least 50%, at least 75%, or at least 90% of the mixture of first probes 22. In an embodiment, the mixture of first probes 22 includes only dummy probe 32 or affinity-labeled probe 28, and excludes other probe types. In an embodiment, first probe 22 includes only affinity-labeled probe 28, and excludes any dummy probe 32. For example, for very low abundance proteins, it may not be desirable to lose any aptamers 14 through removal.

[0058] In embodiments, during high-throughput assays, each individual aptamer 14 may be associated with a different ratio of virtual probe 32 and affinity-labeled probe 28, such that each individual aptamer 14 has a unique ratio relative to other aptamers 14 used together in a panel or assay. In embodiments, certain groups of aptamers 14 all associated with approximate abundance ranges may have ratios of virtual probe 32 and affinity-labeled probe 28 relative to each other. In embodiments, for high-throughput assays, for groups of at least 1000 different aptamers 14, there are at least 3 different ratios of virtual probe 32 to affinity-labeled probe 28. In embodiments, for the aptamer 14 being assayed, there are at least 5, 10, 50, 100, or more different ratios of virtual probe 32 to affinity-labeled probe 28.

[0059] The workflow includes the step of contacting aptamers 14a, 14b with probe sets 20a, 20b (e.g., with first probes 22a, 22b and second probes 24a, 24b). It should be understood that the first probes 22a, 22b have binding capacity and specificity for different first regions 23a, 23b, and therefore have different nucleic acid sequences. Similarly, the second probes 24a, 24b have binding capacity and specificity for different second regions 25a, 25b, and therefore have different nucleic acid sequences. Contact with probe sets 20a, 20b results in the formation of triploidal complexes of first type 33a, 33b and second type 34a, 34b. Therefore, in the example shown, due to the different ratios of the dummy probe 32 to the affinity-labeled probe 28 in the first probes 22a, 22b relative to each other, triploidal complexes of first type 33a, 33b and triploidal complexes of second type 34a, 34b are formed between the different aptamers 14a, 14b. Because aptamer 14a is more abundant, a larger percentage of type 1 33a can be formed, and it is subsequently removed in the capture step using affinity tag 30 and capture entities (e.g., capture beads 36 and affinity tag binder 38). Affinity tag 30 can be the same tag for all affinity-tagged probes 28, thus allowing all type 2 34 tripolean complexes to be captured in the same manner.

[0060] It should be understood that, in the implementation, for high-abundance aptamer 14a, even if most of the complex formation is type I 33a, resulting in the removal of at least 50%, at least 75%, or at least 90%, high-abundance aptamer 14a can still be present in greater quantities at detection, simply because the total initial concentration is higher relative to low-abundance aptamer 14b. That is, 1% high-abundance aptamer 14a can be greater than 100% low-abundance aptamer 14b. However, the disclosed techniques can compress the dynamic range by one, two, or more logarithms based on ratio adjustments or other techniques discussed herein.

[0061] The disclosed technique includes a workflow in which a three-molecule complex is formed, and an affinity-labeled probe 28 for capturing aptamer 14 is separated from the second probe 24 to be detected. Figure 4 The benefits of separating the report probe or detection probe (e.g., second probe 24b) from the capture probe (e.g., affinity-labeled probe 28b) are shown. In one example, aptamer 14b is not detected in a particular sample based on the sample composition. Therefore, aptamer 14b is not present in this workflow. In such an example, during the capture of other trimolecular complexes from aptamer 14a, for example via affinity-labeled probe 28, the capture bead 36 can pull down affinity-labeled probe 28b. However, the absence of a bridging gap and aptamer 14b binding to second probe 24b means that second probe 24b is not to be detected. If the detectable portion is on affinity-labeled probe 28b, the example shown will produce a false positive.

[0062] Figure 5 This is a schematic diagram of a three-molecule complex, which can be either type 33 or type 34, depending on the type of the first probe 22 it binds to (e.g., affinity-labeled probe 28 or dummy probe 32), as generally discussed herein. The first probe 22 hybridizes to the first region 23 of aptamer 14 via a first complementary region 60 (e.g., a first aptamer-binding region). The second probe 24 hybridizes to the second region 25 of aptamer 14 via a second complementary region 62 (e.g., a second aptamer-binding region). The first complementary region 60 and the second complementary region 62 are unique for each individual aptamer 14. It should be understood that the relative arrangement of the first probe 22 and the second probe 24 on aptamer 14 can be interchanged, such that the first probe 22 can be the 5' or 3' of the second probe 24. The first region 23 and the second region 25 can be spaced apart from each other on aptamer 14, for example, by at least 1-2 nucleotides. In embodiments, the first region 23 and the second region 25 are spaced apart from each other by 1-30 nucleotides. Providing a gap can offer benefits such as normalizing the melting temperature between probe sets of different aptamers 14 or reducing nonspecific complementarity.

[0063] The first region 23 and the second region 25 can be continuous or adjacent to each other, for example, having zero nucleotide spacing. A continuous arrangement of the first probe 22 and the second probe 24 can facilitate a workflow in which the first probe 22 and the second probe 24 are connected to each other after aptamer binding (e.g., directly connected at their respective ends). In embodiments, the first probe 22 and / or the second probe 24 may include matched protruding ends or may be blunt ends, depending on the desired ligation scheme. Ligation of the first probe 22 and the second probe 24 can provide the advantage of reducing melting temperature variations between different probe sets used in the workflow and can also avoid the need for Tm-enhancing probes. Furthermore, ligation can facilitate more stringent washing for greater background removal and / or reduced washing cycles for a streamlined workflow. In embodiments, a ligation-based approach can also contribute to dynamic range compression. For example, the first probe 22 and / or the second probe 24 can be provided as a mixture with a dummy probe. In one embodiment, the second probe 24 may be provided as a mixture comprising both a ligable form and a non-ligable form, the ligable form comprising a 5' phosphate for ligation, and the non-ligable form having the same sequence and aptamer binding ability as the ligable form but without the available 5' phosphate. The ratio of the non-ligable to the ligable form may be adjusted based on aptamer abundance. A probe mixture providing high abundance aptamers has fewer ligable forms in the mixture compared to lower abundance aptamers. Upon ligation to the available ligable form, the melting temperature and binding of the ligation product will be higher. Therefore, more stringent washing will result in retention of the ligation product and loss of the non-phosphorylated but bound non-ligable form. In one embodiment, the ligated probe may be protected and separated from the unligated reporter probe 24 using a 5' affinity reagent (such as biotin binding to streptavidin on beads), and the free probe may be digested using an exonuclease, such as... Figure 19 As discussed in the paper, the probes to be connected are protected from digestion by exonucleases.

[0064] The second probe also includes a non-hybridized region 64 extending away from the second complementary region 62 and not hybridizing with aptamer 14. Therefore, the sequence of the non-hybridized region 64 can be selected to avoid being substantially complementary to the sequence of aptamer 14. The non-hybridized region 64 can be used as a substitute for aptamer 14 for detection. Therefore, the non-hybridized region 64 can include a barcode or identification sequence 68 specific to individual aptamer 14. Thus, different aptamers 14 are associated with correspondingly different identification sequences 68, each distinct from the others and uniquely identified. In an embodiment, the uniquely identified sequence is uniquely identified during sequencing, taking into account barcode errors (e.g., 1-2 nucleotide sequence errors). Furthermore, the identification sequence 68 can be designed such that it differs from the aptamer sequence. In an embodiment, the length of the identification sequence can be 10-50 nucleotides.

[0065] For ease of detection, the non-hybridization region 64 may include a first primer region 70 and a second primer region 72 located flanking the identification sequence 68, such that amplification of the non-hybridization region 64 using primers 74, 76 to generate an amplification product 80 as generally discussed herein will amplify the identification sequence 68 to allow detection of aptamer 14. In an embodiment, amplification is part of preparing a sequencing library for sequencing.

[0066] Because the non-hybrid region 64 is single-stranded, the first primer region 70 can represent a primer binding site that is inversely complementary to the first primer 74, while the second primer region 72 can correspond to the sequence of the second primer 76 that binds to the amplified strand generated by the first primer 74.

[0067] Figures 6-15 Different embodiments of amplification techniques, ligation techniques, and / or sequencing techniques, as well as corresponding arrangements of the non-hybridized region 64, are illustrated. These embodiments can be used to make the generated amplified product 80 conform to the input for sequencing library preparation, or, in some embodiments, conform to a sequencing library that can be sequenced to generate sequence data of the amplified product. Therefore, the disclosed embodiments can provide the advantage of incorporating one or more sequencing library preparation steps into the detection of aptamer 14. Furthermore, the disclosed embodiments can allow the omission or combination of certain sequencing library preparation steps, thereby improving detection efficiency. In some embodiments, the disclosed embodiments also relate to sequencing techniques that allow the generation of sequence data from sequence reads of the amplified product 80.

[0068] Figure 6 The non-hybridization region 64 includes regions that can be used with Illumina. ® Schematic diagrams of different arrangements of universal or conserved sequences used in sequencing reactions. It should be understood that these are merely examples, and any of the disclosed arrangements can be used in conjunction with the disclosed techniques. The non-hybridization region 64 may include minimal sequences located only flanking the identification sequence 70, 72 to introduce the necessary sequences for Illumina during amplification. ® Examples of adaptor sequences for primers 1 and 2 in sequencing preparations A14 and B15, such as sequences or their complementary sequences. In other embodiments, universal capture primer sequences and / or sample index sequences may be incorporated into oligonucleotides generated by reporter probe 24, such as via amplification and / or ligation and extension. Certain arrangements including the index may incorporate custom or bridging primers during sequencing to accommodate different indexes. Other embodiments may include, for example, a custom option using a sequencing library with a single read from surface P5, or a custom option adding dark sequencing via a synthesis cycle, where common sequences are present in the adaptor region.

[0069] The linker sequences A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below:

[0070] A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1)

[0071] B15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2)

[0072] ME':5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3)

[0073] A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4)

[0074] B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5)

[0075] ME: AGATGTGTATAAGAGACAG (SEQ ID NO: 6)

[0076] Primer regions or primer-binding regions may include those with universal Illumina properties. ® Capture the region of the primer sequence or with universal Illumina ® Captures regions for primer-specific hybridization. Universal Illumina ® Capture primers include, for example, P5 5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 7) or P7 5'-CAAGCAGAAGACGGCATACGA-3' (SEQ ID NO: 8) or fragments thereof. (Compared to universal Illumina...) ® Regions that capture primer-specific hybridization may include, for example, Illumina ® The inverse complement sequence of the capture primers P5 (“anti-P5”: 5'-TCGGTGGTCGCCGTATCATT-3' (SEQ ID NO: 9) or P7 (“anti-P7”: 5'-TCGTATGCCGTCTTCTGCTTG-3' (SEQ ID NO: 10)) or fragments thereof.

[0077] Conserved primer regions may additionally or alternatively include those with Illumina. ® The sequence region of the sequencing primers or their fragments, or related to Illumina.® The region specifically hybridized to sequencing primers or their fragments. (Illumina) ® Sequencing primers include, for example, SBS3 (5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' (SEQ ID NO: 11)) or SBS8 (5'-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3' (SEQ ID NO: 12)). (Compared to Illumina...) ® The regions of sequencing primers or their fragments that specifically hybridize can include, for example, Illumina. ® The sequencing primers are SBS3 (“anti-SBS3”: 5'-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3' (SEQ ID NO: 13)) or SBS8 (“anti-SBS8”: 5'-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3' (SEQ ID NO: 14)) or inverse complement sequences of fragments thereof. Incorporation of the sequencing primer sequences into the reporter probe can be direct or via subsequent amplification, ligation, or other sequencing library preparation steps.

[0078] In implementations, the disclosed amplification product 80 may include amplification products that are different from each other based on different identification sequences 68 but have conserved or universal primer regions 70, 72. In this way, a single primer set can be used to amplify a reporter probe 24 having a variable identification sequence 68. This document provides a library preparation kit comprising primers 74, 76 capable of generating amplification products 80 from the reporter probe 24 to generate a sequencing library. The sequences of primers 74, 76 are based on sequencing of a first primer-binding region 70 and a second primer-binding region 72. However, it should be understood that these arrangements are merely illustrative, and the primer regions 70, 72 used for primer binding may be selected for compatibility with other library preparations.

[0079] In the implementation plan, sequencing can be performed using Illumina. ® NGS primers. The following primers are shown as examples.

[0080] Read 1 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3' (SEQ ID NO: 15)

[0081] Read 2 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 16)

[0082] Double-ended read segment 1 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 17)

[0083] Two-end read segment 2 5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (SEQ ID NO: 18)

[0084] Index 1 reads segment 5' CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (SEQ ID NO:19)

[0085] Index 2 read 5' AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (SEQ IDNO: 20)

[0086] It should be understood that index read primers can be designed to include a specific index sequence associated with a particular sample in an aptamer-based assay. Therefore, index primers can have a nucleotide region shown as i5 or i7, the sequence of which differs between different samples in a multiplex assay. Other samples in the run can be prepared using primers that include their corresponding indices. Thus, some sequence reads can be obtained using universal primers, while others are obtained using primers or mixtures of primers that are index-specific to one or more samples in a multiplex reaction.

[0087] In one implementation, a unique molecular identifier (UMI) can be incorporated into the reporter probe 24, for example, via a linker. The UMI is a short sequence used to uniquely label each molecule in the sample library to provide error correction and reduce sequencing bias.

[0088] Figure 7 The method for use via primers 74 and 76 (see...) is shown Figure 5 An example arrangement of the reporter probe 24 for direct amplification. In Option 1, the reporter probe 24 includes both a second complementary region 62 and a non-hybridization region 64 that bind to the aptamer. The non-hybridization region 64 includes a first primer region 70 having ME and A14 sequences and a second primer region 72 having a complementary sequence having the B15 sequence, to generate a primer that can bind to Illumina. ® The amplification products are used together with sequencing primers. Therefore, their inclusion allows for standard Illumina sequencing. ®Sequencing or NGS technology. The first primer region 70 and the second primer region 72 are located flanking the identification sequence 68. In option 2, the second primer region 72 includes the ME' sequence. In option 3, the ME and ME' sequences are excluded. Options 1, 2, and 3 provide different length options for the reporter probe 24 and for the amplified product. In some implementations, a smaller reporter probe 24 may have lower manufacturing and purification costs, as in option 3. However, the exclusion of the ME and ME' sequences may involve non-standard sequencing techniques, such as those related to... Figure 8 The subject of discussion.

[0089] based on Figure 7 The report probe amplification product 80 example sequencing technology in Figure 8 As shown in the diagram. The reporter probe 24 is directly amplified using appropriate primers 75 and 76, such that the amplification product 80 includes the desired adaptor sequence, including those compatible with Illumina. ® NGS-compatible P5, P7, i5, and i7. Therefore, the prepared sequencing library (e.g., amplification product 80 in the example shown) is longer than reporter probe 24. Furthermore, amplification product 80 may eliminate or exclude the second complementary region 62. In some embodiments, amplification product 80, as provided herein, may be single-indexed or dual-indexed. Each individual sample undergoing aptamer-based assays may be uniquely associated with one or more specific indices that are not used for other samples in multiplex reactions. Sequencing reactions based on amplification product 80 from Option 1 can use standard sequencing primers and read 1 primers to generate sequence data to produce sequence reads including the identification sequence 68 and index information. In some cases, additional index information can be obtained from the complementary strand index reads using i5 or other index primers. Similarly, sequence data from amplification product 80 from Option 2 can generate identification sequence reads and a first index read. In Option 2, a second index read may also be performed. Index reads are generally shorter period reads. In the illustrated embodiments (e.g., Figure 8 , Figure 10 , Figure 12 The i5 and R1 primers are A14-ME and A14'-ME', respectively. The i7 read primer is ME-B15.

[0090] As in option 3, the lack of an ME sequence may involve non-standard sequencing. In the example shown, by way of illustration, p5 primers can be used to obtain indexing information and identify the sequence from a single sequence read. However, some cycles are run as dark cycles (e.g., only chemical reactions without image capture and / or analysis). Therefore, certain sequencing implementations may be used in conjunction with specific operating instructions for the sequencing apparatus, such as those regarding... Figure 37 The subject of discussion.

[0091] Figure 9 Examples of stepwise PCR in which multiple amplifications and primers can be used to add adaptors or other sequences are shown. Option 1 shows a first round of amplification with the addition of the 3' adaptor, while the 5' adaptor is completed via a second round of PCR. Option 2 shows the opposite orientation. Option 3 shows a two-step PCR of both the 5' and 3' adaptor sequences. Reporter probe 24 includes certain sequences covered by primer regions 70 and 72 along with the adaptor sequence. Stepwise PCR can be performed in indexed PCR or in separate reactions. Figure 10 This diagram illustrates a sequencing workflow for sequencing a library prepared from amplification product 80 derived from stepwise PCR. Sequencing reactions based on amplification products 80 from Options 1 and 2 can utilize standard sequencing primers and read 1 primers to generate sequence data to produce a sequence read including the identification sequence 68. Additional indexing information can be obtained from the complementary strand index read using i5 or other index primers. A second index read can also be performed to obtain second indexing information. In Option 3, indexes can be obtained from the first and second index reads, and custom primers can be used to generate a sequence read including the identification sequence 68. The custom primer sequence read may include a dark cycle to skip non-standard regions of the amplification product 80.

[0092] Figure 11 An example of PCR ligation is shown in which a double-stranded end adaptor is attached to a complementary template at the 3' end of probe 24. In the disclosed examples, the length of reporter probe 24 can be adjusted based on the desired downstream detection mode and the efficiency of reporter synthesis. For example, a shorter reporter probe 24 may generally be cheaper and purer. However, a shorter reporter probe 24 may also include fewer complete adaptors for sequencing requiring non-standard sequencing methods (e.g., single reads with dark cycles). Option 1 shows a relatively short reporter probe 24 including a first primer region 70 but not a second primer region 72. Instead, reporter probe 24 has a short 3-nucleotide tail 84 to which a partially double-stranded adaptor 86 can be attached. Option 2 shows a similar arrangement but with a longer first primer region 70. The resulting amplification product can then be incorporated with additional sequences (e.g., index, p5, p7) via direct or stepwise amplification techniques. Figure 7 and Figure 9 As discussed in [the document]. However, as [the document discusses]... Figure 12 As shown, sequencing from the relatively short amplification product 80 of Option 1 may involve custom sequencing primers or standard primers (i5, i7), but incorporates three dark cycles to accommodate the tail 84. Option 2 shows an alternative arrangement in which standard sequencing primers can be used to generate sequence data using read 1 primers to produce a sequence read including the identification sequence 68. Additional indexing information can be obtained from one or both of the i5 or i7 primers or other combinations of index primers.

[0093] An adaptor for sequencing or other assays can be added in subsequent ligation and / or PCR steps. Relatively long reporters may include full adaptors, but may be more expensive, have lower purity, and / or be less feasible to synthesize due to lower yields if too long. Therefore, in some embodiments, an adaptor is incorporated via a direct or indirect ligation step into a relatively short reporter probe 24 that can be used to modify aptamer binding but does not include the adaptor sequence (e.g., index sequence, primer-binding sequence, functional sequence). The disclosed adaptor ligation techniques can be used in conjunction with dynamic range compression workflows, such as those using virtual probes or reporters, as provided herein. Furthermore, in some embodiments, the disclosed adaptor ligation techniques, as discussed herein, can be PCR-free workflows that avoid thermal cycling. In these embodiments, PCR-free workflows offer the advantages of reduced potential amplicon contamination and elimination of the need for separate regions for pre- and post-PCR work.

[0094] Figure 13 An example PCR-free workflow using a splint ligation technique to add one or more adaptors via ligation and extension is shown. While the captured reporter probe 24 has a free 3' end, its 5' end includes a binding region 62. In other examples, this region 62 is not retained in the amplification product using primers that do not cover region 62. However, in the example shown, the reporter probe 24 has a complete cleavage site 90, such as a uracil cleavage site. Here, the reporter probe 24 is captured as part of a three-molecule complex. Three-molecule complexes can be generated as generally discussed herein, and the uncaptured reporter probe 24 can associate with different types of three-molecule complexes that are not captured due to the absence of an affinity tag to facilitate binding to the capture bead 36.

[0095] Once captured, the uncaptured components are removed, and the non-hybridized region 64 can be cleaved to expose the 5' end. Cleavage is mediated by uracil-DNA glycosylase cleaving the U base. After cleavage, 5' adaptor 94 ligation can be facilitated by a 5' clip 97 that forms a partial double-stranded linker region during hybridization, and 3' adaptor 96 ligation can be facilitated by a 3' clip 98 that forms a partial double-stranded linker region at the 3' end. The dashed arrows shown represent polymerase extensions starting at B15', which use template i7 to copy the index to add the index complementary sequence to the reporter via extension. This extension can include a complete copy of p7' without complete ligation by extending from the B15' end, or p7' can be added to allow extension-ligation. The polymerase can be non-strand-displaced and lack 5-3' exonuclease activity. In the embodiment, an Illumina extension-ligation mixture is used. After ligation and denaturation at clips 97 and 98, the remaining oligonucleotides can be amplified for detection as generally discussed herein.

[0096] Figure 14 An example connection-extension workflow is illustrated by adding one or more connectors via connection and extension. This workflow involves forming a three-molecule complex as generally discussed herein, the process including the binding of a capture probe 28 to a corresponding region of aptamer 14 via a first complementary region 60 and a reporter probe 24 via a second complementary region 62. The reporter probe 24 includes a non-hybridization region 64 that does not hybridize with aptamer 14 and has an identification sequence 68 that uniquely identifies aptamer 14. The workflow also includes using a capture entity (such as an affinity tag binder that binds to an affinity tag 30 present on the capture probe 28) to a three-molecule complex containing a dummy molecule (see [link to documentation]). Figure 1 The steps of separating the aptamer 14 and / or the free reporter probe 24.

[0097] Once captured, reporter probe 24 and aptamer 14 can be eluted from the capture entity and capture probe 28. In this workflow, reporter probe 24 carries a first region 100 corresponding to a portion of the 5' adaptor sequence and a second region 102 corresponding to a portion of the 3' adaptor sequence. The complete 5' and 3' adaptor sequences may represent their respective terminal adaptor sequences, which, when present, allow oligonucleotides to be used as part of a sequencing library for NGS sequencing, in an embodiment where the NGS sequencing can be used as part of aptamer detection for sequencing of identification sequence 68. In the illustrated workflow, reporter probe 24 does not carry the complete 5' and 3' adaptor sequences, but only a portion of these sequences and is relatively short. For example, in one example, the total reporter probe length may be approximately 70 nucleotides. In an embodiment, reporter probe 24 may be between 50 and 80 nucleotides. As shown, the complete 5' and 3' sequences are incorporated into the ends via extension ligation.

[0098] As shown in the figure, oligonucleotide 110 carrying the first region complementary sequence 111 and oligonucleotide 120 carrying the second region complementary sequence 122 hybridize with reporter probe 24. Oligonucleotide 110 includes an adaptor region 124 that does not hybridize with reporter probe 24 (e.g., not complementary to complementary region 62). Oligonucleotide 112 includes an adaptor region 130 that does not hybridize with reporter probe 24 and affinity tag 30. This hybridization can occur after the aptamer is eluted from the aptamer bead. Oligonucleotide 112 can be extended in the 3' direction and linked to oligonucleotide 110 using identification sequence 68 as a template. Additionally, reporter probe 24 can be extended in the 3' direction using adaptor region 130 as a template. Therefore, the extended reporter probe 24 and the extended linked oligonucleotides 110 and 112 form a partially double-stranded structure that does not hybridize with complementary region 62. In this way, with Figure 10The workflow in the middle can be reversed, and complementary regions 62 can be eliminated from downstream products without a cutting step.

[0099] Using hybridized oligonucleotide 136 as a template, the retained extended-linked oligonucleotide 132 can undergo further extension after a washing step (e.g., hot washing, NaOH, or other denaturing agent). Oligonucleotide 136 hybridizes with adaptor region 124 via complementary region 140. Oligonucleotide 136 also includes a 5' adaptor region 142. In an embodiment, the extended hybridized oligonucleotide 136 can be extended and linked to a hybridized p7' oligomer (not shown), which can hybridize with the retained extended-linked oligonucleotide 132. This workflow may include using the 5' adaptor region 142 as a template for 3' extension of the retained extended-linked oligonucleotide 132 and using the extended-linked oligonucleotide 132 as a template for 3' extension of the hybridized oligonucleotide 136.

[0100] Oligonucleotides 110 and 112 used in extension or extension ligation can be universal oligonucleotides that hybridize with any captured (e.g., aptamer-bound) reporter probe 24 via a universal region carried on reporter probe 24. Oligonucleotide 136 hybridizes with universal adaptor region 124. Therefore, the extension ligation oligonucleotide reagent can be used for aptamer detection across the entire group.

[0101] An optional second capture step can separate extended oligonucleotide 136 from extended oligonucleotide 132. Both oligonucleotides 132 and 136 include complete 5' and 3' adaptors or their complementary sequences for NGS sequencing. While the starting reporter probe 24 is relatively short (e.g., about 70 nucleotides in one example), the products generated by the extension ligation workflow are longer. In embodiments, oligonucleotides 132 and 136 may be at least 25%, at least 50%, or at least 100% longer than the starting reporter probe 24. In embodiments, the illustrated workflow can be performed with or without subsequent amplification steps.

[0102] Figure 15 Another example of a cut-free extension connection technique is shown. For example... Figure 14 In this process, the workflow includes forming a three-molecule complex in which a capture probe 28 binds to a corresponding region of aptamer 14 via a first complementary region 60 and a reporter probe 24 via a second complementary region 62. The reporter probe 24 includes a non-hybridization region 64 that does not hybridize with aptamer 14 and has an identification sequence 68 that uniquely identifies aptamer 14. The workflow also includes using a capture entity (such as an affinity tag binder that binds to an affinity tag 30 present on the capture probe 28) to bind the three-molecule complex to a three-molecule complex containing a dummy molecule (see [link to documentation]). Figure 1 The steps of separating the aptamer 14 and / or the free reporter probe 24.

[0103] Once captured, reporter probe 24 and aptamer 14 can be eluted from the capturing entity and capture probe 28. Multiple oligonucleotides hybridize to form a complex to allow for the extension ligation of the complete adaptor sequence. Reporter probe 24 includes a first region 100 corresponding to a portion of the 5' adaptor sequence and a second region 102 corresponding to a portion of the 3' adaptor sequence. As shown, oligonucleotide 150 carrying the complementary sequence 112 of the first region and oligonucleotide 152 carrying the complementary sequence 153 of the second region both hybridize with reporter probe 24. Additionally, oligonucleotide 150 includes an adaptor region 155 that does not hybridize with reporter probe 24 (e.g., not complementary to complementary region 62) and carries an internal affinity tag 30. Oligonucleotide 152 includes an adaptor region 156 that does not hybridize with reporter probe 24 and serves as an extension template. Oligonucleotide 158 hybridizes with adaptor region 155, and oligonucleotide 160 hybridizes with oligonucleotide 150 via region 162. Oligonucleotide 158 acts as a cleft for connecting oligonucleotides 150 and 160. In the complex, oligonucleotides 152, 150, and 160 can be linked by extension to form oligonucleotide 166.

[0104] Oligonucleotide 166 can be captured via affinity tag 30 and used as a template for extending hybridization oligonucleotide 158. Multiple extension, for example, using T4 polynucleotide kinase allows for the addition of complete 5' and 3' adaptors. (See also: [link to related information]) Figure 11 The extended ligation discussed allows the use of a shorter reporter probe 24 to generate a longer product, for example, at least 25%, at least 50%, or at least 100% longer than the starting reporter probe 24. Additionally, the oligonucleotide used in the extension can be a universal oligonucleotide that hybridizes to any captured (e.g., aptamer-bound) reporter probe 24 via a universal region carried on the reporter probe 24 and can be used across the entire group for aptamer detection of different aptamers and their associated different identification sequences 68. In embodiments, the illustrated workflow can be performed with or without subsequent amplification steps and with or without additional capture steps. In embodiments, the extension can begin at A14 without initial phosphate blocking.

[0105] Figure 16An example workflow for using a split reporter probe that forms a three-molecule complex with aptamer 14 is shown. In contrast to a workflow where the entire identification sequence 68 is set on a single probe 24, the example shown includes a first reporter probe 170 and a second reporter probe 172, and the identification sequence 68 splits between these probes. Using the shorter reporter probe is more economical, and the subsequent ligation yields a longer product with library cleanup benefits. Having a split identification sequence distributed between the two probes allows for the assessment of successful hybridization of the two probes. This is an advantage because in other techniques, the second probe is not part of the readout, and erroneous hybridization is not apparent in the result readout.

[0106] The first reporter probe 170 carries a first identification sequence 176, and the second reporter probe 172 carries a second identification sequence 178. Similarly, aptamer-binding regions are also split between the probes. The first reporter probe 170 carries a first aptamer-binding region 182 and a first primer site 183 located between the first aptamer-binding region 182 and the first identification sequence 176. The second reporter probe 172 carries a second aptamer-binding region 184 and a second primer site 185 located between the second aptamer-binding region 185 and the second identification sequence 178. The primer sites are shown as truncated or partial adaptor sequences (A14' and B15). It should be understood that additional adaptor sequences may also be included in the split probes or introduced by amplification and / or ligation, as generally discussed herein.

[0107] The binding of the first reporter probe 170 and the second reporter probe 172 to aptamer 14 produces a three-molecule complex, and one of the first reporter probe 170 or the second reporter probe 172 may carry an affinity tag 30, as exemplarily shown on the first reporter probe 170. Identification sequences and primer sites are carried on the non-hybridized portions of the reporter probes 170 and 172. For certain aptamers 14, dynamic range compression of the splitting probe can be achieved by using a mixture including dummy probes without the affinity tag 30 (e.g., dummy first probe 170 or dummy second probe 172). As discussed herein, the selected ratio of dummy probes to affinity-tagged probes can be adjusted based on aptamer abundance.

[0108] The identification sequence 68 can be assembled by, for example, using a single-stranded linker (e.g., a cyclization ligase) to ligate the ends of the first reporter probe 170 and the second reporter probe 172. The 5' phosphate and adjacent 3' OH groups of probes 170 and 172 are linked together, making the first identification sequence 176 and the second identification sequence 178 contiguous. Affinity tag 30 can be used to separate the linked strands. Any dummy reporter probe 170 and unlinked second reporter probe 172 will not be retained. While unlinked reporter probe 170 will also be captured, an amplification step using the first primer site 183 and the second primer site 185 ensures that only the linked pairs will produce amplification products. To eliminate false positives from nonspecific or unwanted bindings, this technique may require identifying matching pairs of sequences 176 and 178. That is, both identification sequences 176 and 178 can identify aptamer 14, and this technique may require positive sequence matching of the two identification sequences 176 and 178 before validating the detection of aptamer 14, as assessed using sequencing data obtained from a sequencing device.

[0109] Figure 17 yes Figure 16 An implementation of the technology includes providing a single-stranded splint oligonucleotide 190 to improve the ligation efficiency of reporter probes 170, 172. The splint oligonucleotide 190 hybridizes with at least a portion of a first identification sequence 176 and a second identification sequence 178 to generate a double-stranded region. When also bound to aptamer 14, reporter probes 170, 172 are also partially double-stranded along aptamer-binding regions 182, 184.

[0110] Figure 18 yes Figure 16 and / or Figure 17 The implementation scheme of the technology. In particular, the use of splint oligonucleotide 190 can facilitate the ligation of reporter probes 170 and 172 even without aptamer binding. Exonuclease digestion of free reporter probes 170 and 172 can improve the background generated by the ligation of reporter probes 170 and 172 in the absence of aptamer binding. Exonucleases RecJF and Exo I are shown by way of example. Providing a mixture of 5' to 3' and 3' to 5' exonucleases can promote adequate digestion to eliminate or significantly reduce amplification products generated by aptamer-free ligation. Figure 19 The report probes 170 and 172, which bind to the aptamer, are shown to be in a fully circularized form for protection against [the virus / other threats]. Figure 15 The workflow of the effects of exonuclease digestion is shown. In particular, exonuclease digestion targets reporter probes 170, 172 that are not bound to aptamer 14 but are already connected to each other, for example in the presence of splint oligonucleotide 190.

[0111] In some implementations, methods such as those described herein (e.g., as shown in the image) may be used without a capture step. Figures 16-19 The report probes discussed in the text and the resulting ligation, extension or amplification products.

[0112] Figure 20 An example of virtual report probe technology is shown. Figure 20 In this method, a three-molecule complex 200 is captured using a capture probe 28 via the interaction of a bead 36 with an affinity tag 30. This three-molecule structure includes an associated reporter probe 24 comprising an aptamer-binding region 62 and an active or amplifiable nonhybridized region 64, wherein primer regions 70, 72 are flanking the identification sequence 68. Alternatively, instead of (or in addition to) using a capture probe 28 mixed with a dummy probe 32, the reporter probe 24 may also comprise a mixture of an active probe 202 and a dummy probe 210. Thus, other three-molecule structures associated with an inactive dummy reporter 210 can be formed. These inactive dummy reporters 210 include an aptamer-binding region 62 to facilitate binding to an aptamer 14. However, the non-amplifiable nonhybridized region 64 of these inactive dummy reporters 210 is non-amplifiable. Examples of arrangements of the inactive dummy reporter 210 may include the absence of one or both of the primer regions 70, 72 or the identification sequence 68. In another example, the non-amplifiable non-hybridization region 64 may include an extension blocking region, such as a debasement extension blocking region, a spacer region, or uracil. In another variant example, non-phosphorylated probes may be added to adjust the dynamic range by providing a mixture of forms containing 5' phosphate and forms with the same sequence and aptamer binding ability but without available 5' phosphate. The ratio of these forms can be adjusted based on aptamer abundance.

[0113] The mixing or relative ratio of active reporter 202 to inactive dummy reporter 210 can be discussed as generally with respect to capture probe mixtures.

[0114] Figure 21 Reporter probes (e.g., probe 24) with a mixture of complete restriction endonuclease (RE) sites located in the non-hybridization region 64 are shown. For example, for low-abundance aptamer 14, group 222 of probe 24 may be entirely identical, for example, having no RE sites within the non-hybridization region 64, but having nucleotide "nucleic acid" regions that do not correspond to RE sites. For medium-abundance aptamer 14, group 224 of probe 24 may be a mixture of 50% probes having RE sites within the non-hybridization region 64 and 50% probes having no RE sites but having nucleotide nucleic acid nucleic acid regions that do not correspond to RE sites. For high-abundance aptamer 14, group 226 of probe 24 may be a mixture of 75% probes having RE sites within the non-hybridization region 64 and 25% probes having no RE sites but having nucleotide nucleic acid nucleic acid regions that do not correspond to RE sites. It should be understood that these percentages are only examples.

[0115] The presence of RE sites facilitates cleavage using appropriate REs. RE sites are conserved across all aptamers 14, allowing cleavage of the non-hybridized region 64 to be performed with only a single RE treatment. The cleavage site can be specific for ss DNA cleavage. In such embodiments, cleavage can occur after capture with capture probe 28 and before amplification. In other embodiments, cleavage can occur after amplification using double-stranded REs. In such cases, the RE site is preserved during amplification. Therefore, the cleaved probe 24 cannot be used for downstream sequencing, and dynamic range compression is thus achieved by not performing sequencing after amplification. In embodiments, the invalid region may differ from the RE site by only a single base substitution to minimize amplification bias between dummy (with RE site) and active (invalid site, without RE site) probes.

[0116] Figure 22 Alternative examples are shown that can be used in conjunction with single-probe and / or dual-probe workflows to remove capture and / or washing steps. That is, instead of using the three-molecule complex of both capture probe 28 and reporter probe 24, the illustrated embodiments can be performed using only reporter probe 24, as generally discussed. Free reporter probe 24 can be removed or digested with an exonuclease. The bound reporter probe, as part of the double-stranded complex having aptamer 14, is protected. However, in some embodiments, the disclosed exonuclease digestion can be performed in conjunction with other disclosed embodiments, such as dual-probe workflows using dummy capture probe 32 and / or dummy reporter probe 24 as generally discussed herein. The illustrated embodiments show 3' to 5' exonuclease digestion of the free reporter, wherein the 3' end of reporter probe 24 is involved in aptamer binding and is therefore protected from 3' to 5' exonuclease digestion. The disclosed embodiments can be additionally or alternatively used in conjunction with exonucleases having 5' to 3' exonuclease activity. In such an implementation, reporter probe 24 can be designed so that its 5' end is hybridized to aptamer 14, thus protecting the 5' end from digestion relative to unhybridized reporter probe 24. In some implementations, exonuclease digestion may allow for a workflow with fewer washes and / or increased sensitivity.

[0117] Figure 23One embodiment of bead-based capture is illustrated, which uses group-specific capture sequences and corresponding sets of different capture beads to compress the dynamic range of the input library 250 of the captured reporter probe 24 or the amplified or ligation-extension oligonucleotide product generated by the capture reporter probe 24. In one embodiment, the input library 250 represents a population of oligonucleotides 252 having certain universal or common sequences shared among the input libraries 250 (e.g., adaptor sequences 254, 256), certain identification sequences 68 unique only to some members of the input library 250 that bind to a specific aptamer 14, and group-specific capture sequences (e.g., group capture sequences 260, 262, 264) that differ between different groups. Different groups are shown by way of example as high-abundance group 270, medium-abundance group 272, and low-abundance group 274, but more or fewer groups are also considered. The estimated abundance of aptamer 14 determined by a specific aptamer-based assay can be used to group aptamers 14 based on their relative abundance. Once grouped, reporter probe 24, designed to bind to aptamer 14 within each group (e.g., groups 270, 272, 274), can include a corresponding common group capture sequence related to the abundance of that group. Any product generated using reporter probe 24 includes the appropriate group capture sequence. Furthermore, in some embodiments, if oligonucleotide 252 is a product generated using reporter probe 24, oligonucleotide 252 may exclude aptamer-binding regions (e.g., second complementary region 62, see below). Figure 5 The aptamer binding region may be present in the reporter probe 24 but not amplified or included in the input library 250.

[0118] Oligonucleotides 252 of the relatively high abundance group 270 may all include the same group capture sequence 260 associated with the high abundance group 270. It should be understood that, in the case that oligonucleotide 252 is double-stranded, oligonucleotides 252 of the relatively high abundance group 260 may all include the same group capture sequence 260 or the reverse complementary sequence of group capture sequence 270. Similarly, if oligonucleotide 252 is double-stranded, then oligonucleotides 252 of all three groups may all include universal adaptor sequences 256, 258 or their reverse complementary sequences. As shown, a mixture of different identification sequences 68 may be present within each group, such that group 270 includes different identification sequences 68a, 68b, 68c corresponding to the different aptamers 14a, 14b, 14c designated as high abundance. Similarly, group 272 includes different identification sequences 68d, 68e, 68f corresponding to the different aptamers 14d, 14e, 14f designated as medium abundance. The low abundance group 274 may also include a mixture of different identification sequences 68. In an embodiment, a specific identification sequence 68 is assigned to only one group, such that identification sequence 68a is present only in the high abundance group 270 and is associated only with the group capture sequence 260.

[0119] After aptamer-based assays are performed and an input library 250 is generated by a reporter probe 24 binding to aptamer 14, as generally discussed herein, the input library 250 is contacted with different beads 280 of a bead pool 290 if a component of the sample exhibits a positive binding event. The bead pool 290 may include different bead sets 300, 302, 304, each having a corresponding complementary region 310, 312, 314 complementary to bead-capturing sequences 260, 262, 264. Therefore, oligonucleotide 252 comprising the high-abundance set 270 of bead-capturing sequence 260 is captured by hybridization with the single-stranded complementary region 310 present only in the first bead set 300. Oligonucleotides 252 of the intermediate abundance group 272, including bead-capturing sequence 262, are captured by complementary regions 312 present only in the second bead group 304, and oligonucleotides 252 of the low abundance group 274, including bead-capturing sequence 264, are captured by complementary regions 314 present only in the second bead group 302. As noted, in the case where the oligonucleotide is double-stranded, only one strand may include the associated bead-capturing sequence. Therefore, capture can occur after the oligonucleotide 252 has been denatured to allow binding to the single-stranded complementary region. Once bound, the bead 280 including the captured oligonucleotide 252 can be detected as described herein. In embodiments, the beads 280 may be designed such that each bead 280 generally captures the same amount of oligonucleotide, such that each bead group captures approximately the same amount. However, in some embodiments, the amount of capture per bead 280 of a particular bead group or the number of beads per group can be adjusted to further regulate the concentration of the captured oligonucleotide 252 associated with the particular aptamer 14.

[0120] Different group capture sequences can be incorporated into each reporter probe 24 to allow bead-based capture via hybridization with complementary regions immobilized on beads 280. Conversely, if a single common bead capture sequence is used for the entire input library 250, the high-abundance group 270 will tend to be captured in a larger proportion on the available beads 280 based on the oligonucleotides 252 of the relatively large proportion of the high-abundance group 270 within the library 250. By using separate bead sets 280, dynamic range compression between low and high abundance can be achieved. Although three separate abundance groups with corresponding bead groups are shown, it should be understood that more or fewer groups are considered. Additionally, the number of different aptamers 14 and associated identification sequences 68 assigned to each individual group capture sequence can be selected as one, two, three, ten, 100, 500, or more. In embodiments, the number of identification sequences 68 assigned to each group can be different. For example, the high-abundance group 270 may include fewer different identification sequences relative to the medium-abundance group 272 or the low-abundance group 274. Additionally, the illustrated implementation can be used alone or in combination with other dynamic range compression techniques (e.g., virtual probes) that can be used to adjust the relative abundance of oligonucleotide 252 in the input library 250, as discussed herein. Furthermore, while this workflow is discussed in the context of beads, the capture technique can be used with surfaces such as flow cells or other substrates.

[0121] Figures 24 to 27 An example of dynamic range compression utilizing differential re-annealing of high-abundance aptamers relative to low-abundance aptamers when used as part of a double-stranded fragment is shown. In the illustrated embodiment, the aptamer or reporter probe is provided as part of a double-stranded oligonucleotide 328 or a double-stranded fragment having a sequence of interest 329. The double-stranded oligonucleotide 328 may include oligonucleotide 330 having a high-abundance sequence (e.g., sequence of interest 329) and oligonucleotide 332 having a low-abundance sequence. That is, the double-stranded oligonucleotide 328 may represent a pool of double-stranded oligonucleotides 328 with different sequences of interest 329, which may reflect the capture of the aptamer by the analyte present in the sample. Some high-abundance sequences of interest 329 are present at a higher count compared to low-abundance sequences of interest 329. In an embodiment, the high-abundance sequences of interest 329 are present at a ratio of at least 10:1 to the lower-abundance sequences of interest 329.

[0122] According to the techniques used to generate double-stranded oligonucleotide 328 from aptamer 14, relative abundance can directly or indirectly reflect the abundance of an analyte in a test sample as listed herein. For example, double-stranded oligonucleotide 328 can be generated by primer extension from a primer complementary to a portion of aptamer 14. Double-stranded oligonucleotide 328 can additionally or alternatively be generated by primer extension from a primer complementary to a portion of reporter probe 24, which then binds to aptamer 14. Thus, in an embodiment, sequence of interest 329 may include at least a portion of the sequence of aptamer 14 or at least a portion of identification sequence 64 to allow analyte detection. In an embodiment, double-stranded oligonucleotide 328 is generated as part of a library preparation workflow (see [link to documentation]). Figure 30 ).

[0123] In one embodiment, the double-stranded oligonucleotide 328 may include universal adaptors 334 and 336 located flanking the sequence of interest 329 and its complementary sequence. Therefore, for a pool of double-stranded oligonucleotides 328 having correspondingly different sequences of interest 329, all adaptors 334 and 336 can have the same sequence. In this way, amplification can be performed using universal primers, and primers 338 can be a set of primers having the same sequence (e.g., the same forward sequence and the same reverse sequence) that amplifies pools of double-stranded oligonucleotides 328 with different sequences of interest 329. In other embodiments, custom primers are provided for each sequence of interest 329.

[0124] To achieve dynamic range compression, double-stranded oligonucleotide 328 is amplified using primer 338. Instead of providing an excess of primer 338, the primer concentration is diluted or throttled to below the standard amplification reaction conditions. In this way, the concentration of primer 338 is insufficient to prevent amplicons from re-annealing in subsequent cycles, and high-abundance sequences are more likely to outperform primer 338 during annealing than low-abundance sequences, thus making amplification less likely. Primer 338 can be supplemented at a low concentration for continuous cycling. In embodiments, the amplification reaction can be split with different primer concentrations to avoid exponential accumulation of bias. Furthermore, the number of cycles can be adjusted to maintain dynamic range compression.

[0125] The workflow involves a denaturation step performed at a temperature sufficiently high to isolate the strands of double-stranded oligonucleotide 328 (e.g., 94°C–98°C for 1–3 minutes). Because primer concentrations are limited, high-abundance oligonucleotide 330 is more readily re-annealed, while low primer concentrations may be sufficient to amplify low-abundance oligonucleotide 332. As shown, once the temperature drops from the denaturation temperature to the annealing temperature (e.g., from the denaturation temperature to approximately 5°C below the primer melting temperature (Tm) or to 45°C–60°C), many isolated strands 330a and 330b are re-annealed to facilitate primer binding to the template. Extension from the annealed primers can be performed at temperatures suitable for polymerase (e.g., 65°C–75°C). While the annealing temperature is chosen to allow primer annealing, the energy for re-annealing the isolated strands may be more favorable. Therefore, given limited primer availability, high-abundance strands 330a and 330b will tend to be re-annealed. However, lower abundance chains 332a and 332b may be occupied by primer binding and therefore may not be able to be reannealed. In an embodiment, at least 50%, at least 60%, at least 80%, or at least 90% of the high abundance chains 330a and 330b will be reannealed. In an embodiment, at least 50%, at least 60%, at least 80%, or at least 90% of the low abundance chains 332a and 332b will bind to primer 338.

[0126] After one or more amplification cycles, the products include re-annealed oligonucleotide 340 and amplicons 341. Re-annealed oligonucleotide 340 from high-abundance oligonucleotide 330 represents a barrier to exponential growth. That is, these re-annealed oligonucleotides 340 cannot be used for primer binding and amplification, and are therefore used to maintain the high-abundance sequence of oligonucleotide 330 at a lower amplification rate in successive amplification cycles. Although some growth occurs and some amplicons 341 are generated from the high-abundance oligonucleotide 330, the growth rate is less than the standard exponential growth curve of PCR. Conversely, the lower-abundance oligonucleotide 332 has a higher amplification rate and no or minimal re-annealing. Therefore, the products are more biased towards amplicons 341, and the growth rate more closely resembles the standard exponential growth curve of PCR. Over time, and depending on primer concentration and the number of cycles, the exponential growth rate of the lower-abundance oligonucleotide 332 relative to the slower growth rate of the high-abundance oligonucleotide 330 will lead to a compression of the dynamic range between the two groups. The detection or characterization of products 340 and 341 can be performed as generally discussed herein and in relation to the associated analytes.

[0127] In the embodiments, the primer concentration is less than 1 μM or less than 0.1 μM, and the template oligonucleotide is present as a set in an amount of at least 0.1 ng. However, it should be understood that other ratios have been considered to achieve a limited or non-excess primer concentration relative to the high-abundance oligonucleotide 330, while maintaining a sufficient primer concentration to amplify the lower-abundance oligonucleotide 332. In the embodiments, the primer concentration is selected to be equal to or greater than the reference or experimental average concentration of the lower-abundance oligonucleotide 332, while being less than the reference or experimental average concentration of the higher-abundance oligonucleotide 330. In the embodiments, the primer concentration is selected such that the primers exceed the lower-abundance oligonucleotide 332 of a reference sample having a predetermined composition and confirmed amplification.

[0128] Figure 25 A dynamic range compression workflow for incorporating double-stranded nucleases is illustrated. In the illustrated workflow, differential re-annealing of high-abundance oligonucleotides is used to provide targets for double-stranded nuclease removal of the re-annealed strands. After the denaturation step and recovery to the annealing temperature, for example in the presence of primer 338, the reaction equilibrium favors the double-stranded fragments of high-abundance oligonucleotide 330, where strands 330a and 330b are re-annealed, leaving only some single-stranded strands 330a and 330b. Conversely, for the lower-abundance oligonucleotide 332, the reaction equilibrium favors the isolated strands 332 and 332b. The isolated strands 330a, 330b, 332a, and 332b are protected from double-stranded nuclease digestion and are therefore available for primer extension in the presence of polymerase and at the extension temperature to generate amplicon 343. Because high-abundance oligonucleotide 330 is more likely to form double-stranded fragments for digestion, it undergoes nuclease-mediated removal at a higher rate. Therefore, protecting the lower abundance oligonucleotide 332 from digestion relative to the higher digestion rate of the high abundance oligonucleotide 330 will result in a compression of the dynamic range between the two groups. The detection or characterization of product 343 can be performed as generally discussed herein and is related to the associated analytes.

[0129] In the implementation plan, the nuclease is a thermostable, double-stranded nuclease.

[0130] Figure 26An alternative workflow is shown in which a sample containing double-stranded oligonucleotide 328 is split into two or more portions. Dynamic range compression is performed in one portion of the workflow shown at the top, while another portion shown at the bottom is processed without dynamic range compression. Detection can also be performed between portions. Because product 344 from dynamic range compression can be compressed or enriched for lower abundance oligonucleotide 332, detection using product 344 can cover sequences of interest 329 associated with lower abundance oligonucleotide 332. In embodiments, these sequences 329 can be known or previously characterized. Product 346 of the bottom portion of the workflow is not compressed. Therefore, detection of sequences of interest 329 can be applied to or limited to those associated with high abundance oligonucleotide 330. Detection or characterization of products 344, 346 can be performed as generally discussed herein and in relation to associated analytes.

[0131] Dynamic range compression in the top section can be as follows: Figures 24 to 25 As discussed, this occurs. For example, as shown in the figure, after the first amplification step, a double-stranded nuclease digests the dsDNA at a high annealing temperature. Sequences with high abundance have a favorable balance for dsDNA and are therefore digested more than low-abundance sequences. Additional amplification or low-temperature annealing is then performed to generate the compressed product 344.

[0132] Figures 27 to 29 A bead-based dynamic range compression technique is illustrated, in which capture beads 400 (e.g., magnetic beads) are coupled to capture molecules 402 with varying capture intensities based on the capture domain length. In this manner, single-stranded aptamers 14 and / or reporter probes 24 can be captured for characterization as part of a detection workflow. Capture molecules with longer capture domains (e.g., involving more nucleotides) exhibit greater binding strength to their target molecules. Figure 27 The capturing bead 400 and various aptamers 14 are shown, each having a name for a complementary region 404 for capture by the capturing domain of the capturing molecule 402. The complementary region 404 is complementary to the terminal region of the capturing molecule 402.

[0133] Different lengths of complementary region 404 result in different hybridization or annealing intensities. For example, longer complementary regions 404a generally bind with greater intensity than shorter complementary regions 404b, although this also varies with specific sequences. The less likely binding of shorter complementary regions 404b but more robust binding of longer complementary regions 404a at reaction temperatures leads to compression of the dynamic range between different aptamers 14. Therefore, dynamic range compression can be achieved by varying the length of complementary region 404 and the corresponding complementary portion of the trapping molecule 402 (and thus, duplex stability). Complementary regions 404 with lengths ranging from 6 to 16 nucleotides (nt) correspond to predicted duplex free energy values ​​of approximately -10 kcal / mol to -30 kcal / mol, respectively. Figure 28 The temperature-dependent shift of the combination of different complementary regions 404 is shown, wherein the longer complementary region 404a is more stable at higher temperatures than the shorter complementary region 404a.

[0134] Figure 29 Multiple trap beads 400 carrying different trapping molecules 402 are shown, which have correspondingly different binding specificities for different aptamers 14a, 14b and their different complementary regions 404a, 404b. However, it should be understood that the reaction can be carried out using pools of beads 400 that are specific to the corresponding different aptamers 14.

[0135] The use of the capture beads 400 allows for the separation of molecules of interest for detection, such as aptamers 14 or reporter probes 24, as well as downstream processing in the detection workflow.

[0136] Figure 30 An example streamlined workflow using direct index amplification according to an implementation scheme is shown. In this example workflow, the amplification reaction (e.g., stepwise amplification or direct amplification) can be used to eliminate a separate ligation preparation workflow step. On the left side of this workflow, the captured reporter probe 24 can undergo an amplification reaction and then be fed into sequence library preparation, where a bifurcated adaptor is ligated to the end of the amplified reporter probe. However, amplification incorporating the sequencing adaptor sequence can be used to produce the same final product, but without the intermediate ligation step. Therefore, a direct amplification workflow without a ligation step or without adaptor ligation can save library preparation time. Figure 31 It is a comparison from Figure 30 The graph shows the sequencing read counts from the streamlined workflow and the sequencing read counts from the ligation preparation workflow, and shows similar sequence read counts, indicating similar efficiency in library preparation.

[0137] Figure 32An example workflow with a washing step according to an embodiment is shown. In the first step of this workflow, aptamer 14 is contacted with capture probe 28 and reporter probe 24. The reaction may include a mixture of dummy probes and non-dummy probes of capture probe 28 as disclosed herein. For example, a hybridization reaction that allows the aptamer to hybridize with the reporter probe may be overnight hybridization (by way of example). However, other time ranges (e.g., 30 minutes, 1 hour, 2 hours, 5 hours) are also considered. If aptamer 14 is present in the sample as part of an aptamer-based assay, an aptamer complex comprising aptamer 14, capture probe 28, and reporter probe 24 is formed. The probe and aptamer complex are separated from unbound elements in the reaction mixture via affinity tag capture (as shown in bead capture). The capture beads comprise an affinity tag binder such that the capture beads can capture at least one capture probe 28 with an affinity tag. As discussed herein, the beads may also capture empty probes or uncomplexed probes that have not hybridized with any aptamer. However, unrecombined capture probe 28 (not recombined with reporter probe 24 by aptamer) will not produce any amplification products in downstream steps.

[0138] Once captured onto the beads, a washing step is performed to separate the beads from unbound elements, including reporter probe 24 that has not complexed with any aptamer and virtual complexes, which may include reporter probe 24 complexed with a virtual probe without an affinity tag. Following separation, the sample undergoes a sequence library preparation step, shown as ligation into a PCR reaction. However, other preparation workflows are also considered, such as direct amplification, stepwise PCR, or other amplification and / or ligation preparations as discussed herein. The end product of this workflow includes oligonucleotide fragments, which can then be sequenced as part of a sequencing reaction to generate sequence data.

[0139] In one implementation, the workflow may consist of a single washing step following bead capture and preceding the amplification and / or ligation steps. In other implementations, two, three, or more washing steps are considered. Figure 33 Sequencing read counts under different washing conditions during the bead capture step are shown, and 3, 6, and 12 washes are compared. Reducing the number of washes from 12 to 6 improves reproducibility and reduces assay time and consumable usage. Further reducing the washes from 6 to 3 further increases the signal, but also increases the background in the absence of any input (0 input fM).

[0140] Figure 34This diagram illustrates the compression of sequencing read counts using virtual biotin with different aptamers. The inset on the left shows the experimental setup for aptamer and probe complex formation. For a single aptamer, two different types of complexes can be formed: a first complex including an affinity tag and a second complex without an affinity tag. For a given aptamer, the ratio of these types of complexes depends on the ratio of virtual probes to capture probes. Figure 34 It shows that via in Figure 30 The workflow uses virtual probes to remove a portion of the aptamer population (if not removed, sequence reads will be generated) to reduce the sequence read count. Figure 34 This shows that the segment count is reduced by two orders of magnitude (100x), which is compressed to 1% in a set of 96 aptamers.

[0141] Figure 35 Examples of undesired, nonspecific binding between aptamer-binding regions are shown. Figure 35 The figure above shows the desired complex structure after the hybridization reaction, in which the complex includes aptamer 14, reporter probe 24 and capture probe 28. Figure 35 The figure below illustrates the unwanted structure formation, where reporter probe 24 complexes directly with capture probe 28 via the aptamer-binding region of reporter probe 24 and / or the aptamer-binding region of capture probe 28. Here, a complex is formed without any aptamer bridges. Pulling down the unwanted reporter probe 24 during bead capture and subsequent amplification and sequencing introduces background due to nonspecific binding. Figure 36 The contributions of different aptamer-binding regions to nonspecific binding are shown. Interactions between nonspecific aptamer-binding regions appear to be the main contributing factor to the background. Nonspecific binding can be low-level base pairing between aptamer sequences.

[0142] Figure 37This is a schematic diagram of a sequencing apparatus 500 that can be used in conjunction with the disclosed embodiments to obtain sequencing data of identification sequences and / or index sequences as generally discussed herein. The sequencing apparatus 500 can be implemented according to any sequencing technology, such as those incorporated into the sequencing-by-synthesis methods described in U.S. Patent Publications 2007 / 0166705, 2006 / 0188901, 2006 / 0240439, 2006 / 0281109, 2005 / 0100900, U.S. Patents 7,057,026, WO 05 / 065814, WO 06 / 064199, and WO 07 / 010,251, the disclosures of which are incorporated herein by reference in their entirety. Alternatively, sequencing-by-ligation technology can be used in the sequencing apparatus 500. Such techniques utilize DNA ligases to incorporate and recognize the incorporation of oligonucleotides, as described in U.S. Patent Nos. 6,969,488, 6,172,218, and 6,306,597, the full disclosures of which are incorporated herein by reference. Some embodiments may utilize nanopore sequencing, whereby the target nucleic acid strand or nucleotides excised from the target nucleic acid pass through a nanopore. As the target nucleic acid or nucleotide passes through the nanopore, each type of base can be identified by measuring fluctuations in the conductivity of the pore (U.S. Patent Nos. 7,001,792; Soni & Meller, Clin. Chem. 53, 1996-2001 (2007); Healy, Nanomed. 2,459-481 (2007); and Cockroft et al., J. Am. Chem. Soc. 130, 818-820 (2008), the full disclosures of which are incorporated herein by reference). Other implementations include detecting protons released during nucleotide incorporation into the extension product. For example, sequencing based on the detection of released protons can utilize electrical detectors and related technologies commercially available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies) or the sequencing methods and systems described in US 2009 / 0026082A1, US 2009 / 0127589 A1, US 2010 / 0137143 A1, or US 2010 / 0282617 A1, each of which is incorporated herein by reference in its entirety. Specific implementations may utilize methods involving real-time monitoring of DNA polymerase activity.Nucleotide incorporation can be detected by fluorescence resonance energy transfer (FRET) interaction between a polymerase carrying a fluorophore and a γ-phosphate-labeled nucleotide, or by utilizing a zero-mode waveguide, as described, for example, in the following literature: Levene et al., Science 299, 682-686 (2003); Lundquist et al., Opt. Lett. 33, 1026-1028 (2008); Korlach et al., Proc. Natl. Acad. Sci. USA 105, 1176-1181 (2008), the contents of which are incorporated herein by reference in their entirety. Other suitable alternative techniques include, for example, fluorescence in situ sequencing (FISSEQ) and massively parallel signature sequencing (MPSS). In a particular embodiment, the sequencing device 500 may be a HiSeq, MiSeq, or HiScanSQ from Illumina (La Jolla, CA). In other embodiments, the sequencing device 500 may be configured to operate using a CMOS sensor having nanotrap fabricated on photodiodes, such that DNA deposition is aligned one-to-one with each photodiode.

[0143] The sequencing device 500 can be a “single-channel” detection device, where for any given image, only two of the four nucleotides are labeled and are detectable. For example, thymine can have a permanent fluorescent label, while adenine uses the same fluorescent label in a separable form. Guanine can be permanently dark, and cytosine can be initially dark but can be labeled with added tags during cycling. Thus, each cycle can involve an initial image and a second image, where dye is cleaved from any adenine and added to any cytosine, such that only thymine and adenine are detectable in the initial image, but only thymine and cytosine are detectable in the second image. Any base that is dark in both images is guanine, and any base that is detectable in both images is thymine. A base that is detectable in the first image but not in the second image is adenine, and a base that is not detectable in the first image but detectable in the second image is cytosine. By combining information from the initial and second images, it is possible to distinguish all four bases using a single channel.

[0144] In the depicted embodiment, the sequencing device 500 includes a separate sample processing device 502 and an associated computer 504. However, as described above, these can be implemented as a single device. Furthermore, the associated computer 504 can be located locally on the sample processing device 502, networked with it, or otherwise communicate with it. In the depicted embodiment, a biological sample can be loaded onto a sample substrate 510 (e.g., a flow cell or slide) in the sample processing device 502 and imaged to generate sequence data. For example, a reagent interacting with the biological sample fluoresces at a specific wavelength in response to an excitation beam generated by the imager 512, and thus returns radiation for imaging. For example, the fluorescent component can be generated from a fluorescently labeled nucleic acid that hybridizes with a complementary molecule of the component or with a fluorescently labeled nucleotide incorporated into an oligonucleotide using a polymerase. As those skilled in the art will understand, the wavelength of the dye that excites the sample and the wavelength of its fluorescence will depend on the absorption and emission spectra of the particular dye. Such returned radiation can be propagated back by guiding optics. This reverse beam can generally be directed to the detection optics of the imager 512.

[0145] The imager detection optics can be based on any suitable technology and can be, for example, a charge-coupled device (CCD) sensor that generates pixelated image data based on photons affecting the position within the device. However, it should be understood that any of a variety of other detectors can also be used, including but not limited to detector arrays configured for time-delay integration (TDI) operation, complementary metal-oxide-semiconductor (CMOS) detectors, avalanche photodiode (APD) detectors, Geiger-mode photon counters, or any other suitable detector. TDI-mode detection can be coupled to line scans, as described in U.S. Patent No. 7,329,860, which is incorporated herein by reference. Other available detectors are described, for example, in the references previously provided herein in the context of various nucleic acid sequencing methods.

[0146] The imager 512 can be controlled by a processor, for example, via a processor 514, and the sample receiving device 502 may also include I / O controls 516, an internal bus 518, non-volatile memory 520, RAM 522, and any other memory structures that enable the memory to store executable instructions, and may be similar to those described above. Figure 31Other suitable hardware components described herein. Furthermore, the associated computer 504 may also include a processor 524, I / O controls 526, a communication circuitry 527, and a memory architecture including RAM 528 and non-volatile memory 530, such that the memory architecture can store executable instructions 532. The hardware components may be linked by an internal bus, which may also be linked to a display 534. In embodiments where the sequencing apparatus 500 is implemented as a single device, certain redundant hardware elements may be eliminated.

[0147] Processors 514 and 524 can be programmed to allocate individual sequencing reads to a sample based on one or more associated index sequences according to the techniques provided herein. In a particular embodiment, based on image data acquired by imager 512, sequencing device 500 can be configured to generate sequencing data including base calls for each base of the sequencing read. Furthermore, based on the image data, even for tandemly executed sequencing reads, individual reads can be linked to the same location via the image data, and thus to the same template strand. In this way, indexed sequencing reads can be associated with sequencing reads of the insert sequence prior to allocation to the original sample. Processors 514 and 524 can also be programmed to perform downstream analysis of sequences corresponding to inserts for a particular sample after the sequencing reads have been allocated to the sample.

[0148] In some implementations, I / O controls 516, 526 can be configured to receive user input that automatically selects sequencing parameters based on reporter probe 24 and associated sequence library preparation techniques. For example, when custom primers or dark cycling are incorporated into a sequencing run, the sequencing device can select from pre-programmed operating instructions and / or receive user input to operate the sequencing device according to desired sequence parameters. In some implementations, user input may be the selection of a sequence library preparation kit or reading a barcode or identifier of the sequence library preparation kit.

[0149] In embodiments of the disclosed technology, aptamer detection can be based on the presence of a uniquely identified identification sequence 68 for a single aptamer in the sequencing data generated by the sequencing device 500. Therefore, in embodiments, the sequencing device 500 can perform sequence read analysis to identify one or more identification sequences 68 for a group of aptamers. Based on the identified aptamers, a notification or report of positive aptamer identification can be generated. In embodiments, the notification is provided on a display 534 or transmitted to a remote device or cloud server via a communication circuit system 527.

[0150] As used herein, an aptamer can refer to a non-naturally occurring nucleic acid that has a specific binding affinity for a target molecule. Binding of an aptamer to a target molecule can lead to catalytic alteration of the target molecule, thereby reacting with the target molecule in a manner that modifies or alters its functional activity, covalently attaching to the target molecule (as in suicide inhibitors), and promoting reactions between the target molecule and another molecule. In one embodiment, the target molecule is a three-dimensional chemical structure other than a polynucleotide that binds to the aptamer via a mechanism primarily independent of Watson / Crick base pairing or triple helix binding. In another embodiment, the aptamer is not a nucleic acid with a known physiological function that can be bound by the target molecule.

[0151] Aptamers are nucleic acids identified from candidate mixtures of nucleic acids. The specific binding affinity of an aptamer to its target can be defined as a significantly higher affinity between the aptamer and its target compared to its affinity for other non-target components in the mixture or sample. Different aptamers may have the same or different numbers of nucleotides. Aptamers can be DNA or RNA and can be single-stranded, double-stranded, or contain double-stranded regions. The aptamers discussed herein can be used in any diagnostic, imaging, high-throughput screening, or target validation technology, procedure, or assay that utilizes aptamers, oligonucleotides, antibodies, and ligands (but are not limited to these).

[0152] Aptamers as disclosed herein can be used in aptamer-based assays, such as those disclosed in U.S. Patent Nos. 7,855,054 and 7,964,356 and U.S. Publications US / 2011 / 0136099 and US / 2012 / 0115752. In one example, a set of aptamers for different target molecules are provided attached to a solid support. Attachment of the aptamer to the solid support is achieved by contacting a first solid support with one or more aptamers and associating a releasable first tag included on the aptamer directly or indirectly with a suitable first trapping agent attached to or part of the first solid support. A test sample is then prepared and contacted with immobilized aptamers that have a specific affinity for their respective target molecules, which may or may not be present in the sample. If the test sample contains a target molecule, an aptamer-target affinity complex will form in the mixture with the test sample. In addition to the aptamer-target affinity complex, uncomplexed aptamers will also attach to the first solid support. The aptamer-target affinity complex that has associated with the probe on the solid support and the unassociated aptamers are then partitioned from the remainder of the mixture, thereby removing the free target and all other unassociated substances from the test sample (sample matrix); that is, the components of the mixture do not associate with the first solid support. This partitioning step is referred to herein as Catch-1 partitioning (see definition below). After partitioning, the aptamer-target affinity complex, along with any unassociated aptamers, is released from the first solid support using a method suitable for the specific releasable first tag employed.

[0153] In one embodiment, the aptamer-target affinity complex bound to a solid carrier is treated with a reagent that introduces a second tag into the target molecule component of the aptamer-target affinity complex. In one embodiment, the target is a protein or peptide, and it is biotinylated by treating the target with NHS-PEO4-biotin. The second tag introducing the target molecule may be the same as or different from the aptamer capture tag. If the second tag is the same as the first tag or the aptamer capture tag, free capture sites on the first solid carrier may be blocked prior to the start of this labeling step. In this exemplary embodiment, the first solid carrier is washed with free biotin prior to the start of target labeling. Labeling methods, particularly for labeling targets such as peptides and proteins, are described in U.S. Patent No. 7,855,054.

[0154] Distribution is accomplished by releasing the unreconstituted aptamer and aptamer-target affinity complex from a first solid support. In one embodiment, the first releasable tag is a photolytically cleavable portion, which is cleaved by irradiation with a UV lamp under conditions where ≥90% cleavage of the first releasable tag is achieved. In other embodiments, release is achieved by a method suitable for a selected releasable portion of the first releasable tag. The aptamer-target affinity complex can be eluted and collected for further assays, or it can be contacted with another solid support for the remaining steps of the assay.

[0155] In one embodiment, a second partitioning (referred to herein as Catch-2 partitioning, see definition below) is performed to remove the free aptamer. As described above, in one embodiment, a second tag for Catch-2 partitioning may be added to the target while the aptamer-target affinity complex remains in contact with the solid support for Catch-0 capture. In other embodiments, the second tag may be added to the target at another point in the assay prior to the start of Catch-2 partitioning. The mixture is brought into contact with a solid support having a capture element (second) attached to its surface, which is capable of binding to the target capture tag (second tag), preferably with high affinity and specificity. In one embodiment, the solid support is a magnetic bead (such as DynaBeads MyOne streptavidin C1) contained within the well of a microtiter plate, and the capture element (second capture element) is streptavidin. Magnetic beads provide a convenient method for separating partitioned components in a mixture. The aptamer-target affinity complex contained in the mixture is thus bound to the solid support through the binding interaction of the target (second) capture tag and the second capture element on the second solid support. The aptamer-target affinity complex is then dispensed from the remainder of the mixture, for example by washing the carrier with a buffer solution, including a buffer containing an organic solvent (including but not limited to glycerol).

[0156] The aptamers are then selectively eluted from the aptamer-target complex using a buffer containing a ionizing salt selected from, but not limited to, sodium perchlorate, lithium chloride, sodium chloride, and magnesium chloride. Aptamers retained on the Catch-2 beads by means of aptamer / aptamer interactions are not eluted by this treatment.

[0157] In another embodiment, the aptamers released from the Catch-2 allocation are detected and optionally quantified by detection methods as discussed herein, such as via next-generation sequencing technologies. For example, via amplification and / or sequencing of probes that bind to the eluted aptamers. In some embodiments, the detection includes providing a detection result that provides a relative and / or estimated absolute concentration of the detected aptamer. The detection result may include a positive or negative detection result for a specific aptamer ID or a specific target of the aptamer, or a notification or output of a relative or estimated concentration.

[0158] In some embodiments of this disclosure, the probes in the disclosed probe set 20 may include one or more conserved regions, such as conserved primer regions, for example, a first conserved primer region and a second conserved primer region. The conserved regions are conserved among at least some of the other probes in the probe set 20, such that the conserved regions have the same or similar nucleotide sequences compared to each other. For example, for a given second probe 24, all probes 24 may have the same first conserved primer region and second conserved primer region. In this way, primers based on the first and second conserved primer regions can be used to amplify any captured probe 24.

[0159] One or more probes as discussed herein may include an identification sequence, which may include one or more nucleotide sequences that can be used to identify one or more specific aptamers. The identification sequence may be an artificial sequence. The identification sequence may contain at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides. In some embodiments, the identification sequence contains at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides. In some embodiments, at least a portion of the identification sequence in the probe is distinct.

[0160] One or more probes, as discussed herein, may include affinity tags. Affinity tags can be used for a variety of applications, such as the large-scale isolation of target nucleic acids hybridized to hybridization tags. As used herein, the term “affinity tag” and its grammatical equivalents may refer to components of a multicomponent complex, wherein the components of the multicomponent complex specifically interact with or bind to each other. For example, an affinity tag may include biotin or poly-His, which may bind to streptavidin or nickel, respectively. Other examples of multicomponent affinity tag complexes are listed, for example, in U.S. Patent Application Publication No. 2012 / 0208705, U.S. Patent Application Publication No. 2012 / 0208724, and International Patent Application Publication No. WO 2012 / 061832, each of which is incorporated herein by reference in its entirety.

[0161] The disclosed embodiments provide different primers and probes. The probes and / or primers of the disclosed embodiments are designed to be complementary to the target sequence (the target sequence of the sample or other probe sequences) so that the target sequence and the probe of the present invention hybridize. As outlined below, this complementarity need not be perfect; any number of base pair mismatches may exist, which would interfere with hybridization between the target sequence and the single-stranded nucleic acid of the present invention. However, if the number of mutations is so large that hybridization cannot occur even under the least stringent hybridization conditions, then the sequence is not a complementary target sequence. Therefore, the term "substantially complementary" herein means that the probe is sufficiently complementary to the target sequence to hybridize under normal reaction conditions.

[0162] Various hybridization conditions can be used in this invention, including high, medium, and low stringent conditions. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be approximately 5°C–10°C lower than the thermal desorption temperature (Tm) of the specific sequence at a given ionic strength and pH. Tm is the temperature at which 50% of the probe complementary to the target hybridizes with the target sequence at equilibrium (at a given ionic strength, pH, and nucleic acid concentration) (at Tm, 50% of the probe is occupied at equilibrium due to the excess presence of the target sequence). Stringent conditions are those where the salt concentration is less than approximately 1.0 M sodium ions, typically from approximately 0.01 M to 1.0 M sodium ion concentration (or other salts), the pH is 7.0 to 8.3, and the temperature is at least approximately 30°C for short probes (e.g., 10 to 50 nucleotides) and at least approximately 60°C for long probes (e.g., greater than 50 nucleotides).

[0163] In some implementations, the probe contact step can be performed under stringent conditions that allow the formation of a hybridization complex solely in the presence of the target. This stringency can be controlled by varying step parameters that are thermodynamic variables, including but not limited to temperature, formamide concentration, salt concentration, ionizing salt concentration, pH, organic solvent concentration, etc. The size of the primer nucleic acids can vary, and as those skilled in the art will understand, the length generally ranges from 5 to 500 nucleotides. Primers can be between 10 and 100, 15 and 50, and 10 and 35, depending on the application and amplification technique.

[0164] The disclosed techniques relate to dynamic range compression in one or more applications, such as for analyzing elution buffers in aptamer-based assays. Dynamic range compression may include one or more amplification steps that may be part of sequencing library preparation, which may ligate an oligonucleotide adaptor to a reporter probe for downstream sequencing. The adaptor may be attached to a target polynucleotide in any other suitable manner. In some embodiments, the adaptor is introduced in a multi-step process, such as a two-step process, involving ligating a portion of the adaptor to a target polynucleotide having a universal primer sequence. The second step includes extension using primers, such as by PCR amplification, that include a 3' end having a sequence complementary to the attached universal primer sequence and a 5' end containing another sequence of the adaptor. By way of example, such extension can be performed as described in U.S. Patent No. 8,053,192, which is incorporated herein by reference in its entirety. Additional extensions may be performed to provide additional sequences ligated to the 5' end of a previously extended polynucleotide.

[0165] In some implementations, an adaptor can be ligated to a reporter probe. Any suitable adaptor can be attached to a target polynucleotide (such as a reporter probe) via any suitable process (such as those discussed herein). The adaptor may include a library-specific index tag sequence (e.g., i5, i7). The index tag sequence can be attached to the target polynucleotide from each library before the sample is fixed for sequencing. The index tag itself is not formed as part of the target polynucleotide, but rather becomes part of the amplification template. The index tag may be a synthetic nucleotide sequence added to the target as part of the template preparation step. Thus, a library-specific index tag is a nucleic acid sequence tag attached to each target molecule in a particular library, the presence of which indicates or is used to identify the library from which these target molecules were isolated. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the length of the index tag sequence may be 1 to 10 nucleotides, or 4 to 6 nucleotides. Tetranucleotide index tags provide the possibility of reusing 256 samples on the same array, while hexabase index tags enable the processing of 4,096 samples on the same array. Connectors can contain more than one index label, thereby increasing the possibility of multiplication.

[0166] In addition to the index tag sequence, the adaptor may include any other suitable sequence. For example, the adaptor may include a universal extension primer sequence, which is typically located at the 5' or 3' end of the adaptor and the resulting polynucleotide used for sequencing. The universal extension primer sequence can hybridize with a complementary primer bound to the solid substrate surface. The complementary primer includes a free 3' end from which a polymerase or other suitable enzyme can add nucleotides to extend the sequence using the hybridized library polynucleotide as a template, such that the reverse strand of the library polynucleotide is coupled to the solid surface. Such extension can be part of a sequencing run or cluster amplification.

[0167] In some embodiments, the adaptor includes one or more universal sequencing primer sequences. The universal sequencing primer sequence can bind to sequencing primers to allow sequencing of an index-tag sequence, a target sequence, or both. In some embodiments, the disclosed reporter probe (e.g., reporter probe 24) may include a “sequencing adaptor” or “sequencing adaptor site,” that is, a region containing one or more sites that can hybridize with primers. In some embodiments, the sequence may include at least a first primer site for amplification, sequencing, etc.

[0168] Following incorporation of the adaptor, the published reporter probe can be sequenced. In one example, sequencing can be performed using Illumina's sequencing-by-synthesis and sequencing chemistry based on reversible terminators. Illumina's sequencing technology relies on attaching fragmented genomic DNA to an optically transparent surface on which the oligonucleotide anchor is bound. The template DNA is end-repaired to generate 5'-phosphorylated flush ends, and a single A base is added to the 3' end of the flush-phosphorylated DNA fragment using the polymerase activity of the Klenow fragment. This addition prepares DNA fragments for ligation to oligonucleotide aptamers, which have a single T base overhang at their 3' end to increase ligation efficiency. The adaptor oligonucleotide is complementary to the flow-through pool anchor. Under limiting dilution conditions, the adaptor-modified single-stranded template DNA is added to the flow-through pool and immobilized by hybridization with the anchor. The attached DNA fragment is extended and bridged amplified to produce ultra-high-density sequencing flow-through pools with hundreds of millions of clusters, each containing approximately 1,000 copies of the same template. In one implementation, randomly fragmented genomic DNA is amplified by PCR prior to cluster amplification. Alternatively, an amplified-free genomic library is prepared, and cluster amplification is used only to enrich the randomly fragmented genomic DNA. The template is sequenced using a robust four-color DNA sequencing-by-synthesis technique employing a reversible terminator with removable fluorescent dyes. High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Specially developed data analysis pipeline software is used to compare the sequences with truth tables or aptamer identities with identified sequences based on storage correlations.

[0169] This written description uses examples to enable any person skilled in the art to practice the disclosed embodiments, including making and using any device or system and performing any incorporated methods. The scope of patentability is defined by the claims and may include other examples that would occur to a person skilled in the art. Such other examples are intended to fall within the scope of the claims if they have structural elements that are indistinguishable from the literal language of the claims, or if they include equivalent structural elements that are not substantially different from the literal language of the claims.

Claims

1. A method for aptamer detection, the method comprising: Under conditions that allow the formation of analyte-aptamer complexes, the analytes in the sample are contacted with a variety of aptamers, wherein different aptamers have specific affinity for their respective different analytes in the analyte; as well as The analyte is detected by detecting the aptamer in the analyte-aptamer complex, wherein detecting the aptamer includes: From the aptamer, a double-stranded oligonucleotide is generated, wherein a single double-stranded oligonucleotide comprises a single aptamer and a complementary strand; The double-stranded oligonucleotide is denatured under denaturing conditions to generate a denatured strand containing the individual aptamer and the complementary strand; The denatured strands are brought into contact with the primers under re-annealing conditions, such that some of the denatured strands are re-annealed to each other, and some of the denatured strands are annealed to the primers. The primers, annealed to the denatured strand, are extended using polymerase to generate an amplicon; and The aptamer was detected using the amplicon.

2. The method of claim 1, wherein the primer is provided at a concentration less than that of a single aptamer having high abundance.

3. The method of claim 1, wherein the primer is provided at a concentration greater than that of a single aptamer having low abundance.

4. The method of claim 1, wherein detecting the aptamer further comprises using a re-annealed modified chain.

5. The method of claim 1, wherein some of the double-stranded oligonucleotides contain sequences of interest that are different from each other, wherein the first sequence of interest contains a high-abundance sequence and the second sequence of interest contains a low-abundance sequence.

6. The method of claim 5, wherein the first sequence of interest comprises a first aptamer sequence, and the second sequence of interest comprises a second aptamer sequence.

7. The method of claim 6, wherein the first aptamer sequence is present in the double-stranded oligonucleotide at a ratio of at least 10:1 relative to the second sequence of interest.

8. The method of claim 7, wherein at least a portion of the denatured strand of the first aptamer sequence is re-annealed with the complementary strand and does not bind to the primer.

9. The method of claim 8, wherein at least 90% of the denatured strand of the second aptamer sequence binds to the primer.

10. A method for aptamer detection, the method comprising: Under conditions that allow the formation of analyte-aptamer complexes, the analytes in the sample are contacted with a variety of aptamers, wherein different aptamers have specific affinity for their respective different analytes in the analyte; as well as The analyte is detected by detecting the aptamer in the analyte-aptamer complex, wherein detecting the aptamer includes: From the aptamer, a double-stranded oligonucleotide is generated, wherein a single double-stranded oligonucleotide comprises a single aptamer and a complementary strand; The double-stranded oligonucleotide is denatured under denaturing conditions to generate a denatured strand containing the individual aptamer and the complementary strand; The denatured strands are brought into contact with a nuclease under re-annealing conditions, so that some denatured strands are re-annealed to each other and some denatured strands are no longer annealed. The strand is allowed to be digested and then annealed by the nuclease; Primers are extended from the annealed to the denatured strand using polymerase to generate an amplicon; and The aptamer was detected using the amplicon.

11. The method of claim 10, wherein the nuclease is a double-stranded nuclease that does not digest the denatured strand having an annealing primer.

12. The method of claim 10, wherein some of the double-stranded oligonucleotides contain sequences of interest that are different from each other, wherein the first sequence of interest contains a high-abundance sequence and the second sequence of interest contains a low-abundance sequence.

13. The method of claim 12, wherein the first sequence of interest comprises a first aptamer sequence, and the second sequence of interest comprises a second aptamer sequence.

14. The method of claim 13, wherein the first aptamer sequence is present in the double-stranded oligonucleotide at a ratio of at least 10:1 relative to the second sequence of interest.

15. The method of claim 14, wherein at least 90% of the denatured strand of the second aptamer sequence is bound to the primer.

16. The method of claim 10, wherein detecting the analyte comprises retaining a portion of the double-stranded oligonucleotide and preventing the double-stranded oligonucleotide from contacting the nuclease.

17. A bead-based aptamer detection method, the method comprising: Under conditions that allow the formation of analyte-aptamer complexes, the analytes in the sample are contacted with a variety of aptamers, wherein different aptamers have specific affinity for their respective different analytes in the analyte; as well as The analyte is detected by detecting the aptamer in the analyte-aptamer complex, wherein detecting the aptamer includes: The aptamer is brought into contact with one or more trapping beads, wherein the one or more trapping beads comprise: Multiple single-chain trapping molecules, each individual trapping molecule containing a complementary region complementary to a portion of an individual aptamer, wherein there is a diversity in the length of the complementary region among the multiple single-chain trapping molecules, wherein the contact is carried out under conditions that allow at least some of the aptamers to hybridize with the multiple single-chain trapping molecules; Separate the one or more beads from the hybrid aptamers; and The aptamers of the hybridization were detected.

18. The method of claim 17, wherein the length of the complementary region is between 6 and 16 nucleotides.

19. The method of claim 17, wherein each individual capturing molecule is associated with a complementary region of a specific length.

20. The method of claim 17, wherein the shortest complementary region is associated with a high-abundance aptamer.

21. The method of claim 17, wherein the longest complementary region is associated with a low-abundance aptamer.

22. The method of claim 17, wherein the one or more beads comprise magnetic beads.

23. The method of claim 17, wherein the one or more beads comprise multiple beads having correspondingly different capture molecules that are specific to correspondingly different aptamers and having complementary regions of correspondingly different lengths.

Images