Method for preventing and treating cnaphalocrocis medinalis through HEA and application

Abstract

The invention discloses a method for preventing and treating rice leaf folders through HEA and application, and belongs to the field of agricultural biological prevention and treatment. The method comprises the following steps: preparing a 0.4-0.8 mg / mL liquid medicine from HEA, and uniformly spraying the liquid medicine on rice leaves until the liquid medicine is hung and does not drop; after the rice leaf roller larvae eat the rice leaf roller larvae, HEA induces in-vivo Calreticin gene expression of the rice leaf roller larvae and regulates and controls extracellular Ca concentration, and the physiological homeostasis of the rice leaf roller larvae is destroyed after the rice leaf roller larvae act for 84 hours or above. According to the invention, an insecticidal mechanism of HEA through a'gene-calcium homeostasis' way is defined for the first time, and a standardized method capable of being operated in a field is established. The method is high in insecticidal efficiency, environment-friendly and free of drug resistance risks, and a new technology is provided for green prevention and control of the rice leaf folders.

Description

Technical Field

[0001] This invention belongs to the field of agricultural biological control technology, and relates to a method for controlling agricultural pests using bioactive substances, particularly a method for achieving efficient and green insecticidal control by regulating the expression of specific pest genes through N6-(2-hydroxyethyl)adenosine (HEA) and its application in controlling rice leaf roller. Background Technology

[0002] As my country's most important food crop, the safe production of rice is of great significance to national food security. The rice leaf roller (Cnaphalocrocis medinalis) is one of the major lepidopteran pests that damage rice. Its larvae feed on the leaf mesophyll by rolling up the leaves, severely disrupting the plant's photosynthesis and often leading to a significant reduction in rice yield.

[0003] Currently, the control of rice leaf folder still heavily relies on chemical insecticides, such as abamectin and chlorantraniliprole. Although these agents can effectively control the insect population in the short term, long-term, single-use application has led to severe resistance in the rice leaf folder population, resulting in a continuous decline in control effectiveness. At the same time, the widespread use of chemical pesticides has also brought a series of problems, including pesticide residues, environmental pollution, killing of natural enemies, and disruption of ecological balance, which contradict the requirements of current green agriculture and sustainable development.

[0004] In the process of realizing this invention, the inventors discovered that at least one of the following technical problems exists in the prior art: a) Existing mainstream control methods that rely on chemical agents are prone to leading to pesticide resistance in pests and pose risks of environmental pollution and pesticide residues; b) Although the natural product HEA has been found to have insecticidal potential, its specific target and molecular mechanism are unclear, and there is a lack of efficient application methods based on a clear mechanism. c) A standardized control technology system that links the insecticidal activity of HEA to its regulation of specific gene expression and physiological homeostasis in pests has not yet been established. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide a method for achieving efficient and green control of rice leaf folder by regulating the expression of the Calreticulin gene and the extracellular Ca²⁺ concentration through HEA, thereby solving the problems of drug resistance and environmental pollution caused by existing chemical control methods.

[0006] Through long-term exploration and experimentation, and continuous reform and innovation, the inventor has provided a technical solution to solve the above-mentioned technical problems: a method for controlling rice leaf rollers using HEA, comprising the following steps: 1) Dissolve HEA in a solvent containing a co-solvent to prepare a HEA treatment solution with a concentration of 0.4-0.8 mg / mL; 2) Spray the prepared HEA solution in step 1) evenly onto the rice leaves until the solution clings to the leaf surface but does not drip. 3) The larvae continuously feed on the leaves covered with HEA solution. HEA enters the insect body, induces the expression of the Calreticulin gene in the insect body and regulates the extracellular Ca²⁺ concentration, which lasts for more than 84 hours, thereby achieving the control effect.

[0007] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a novel, highly efficient, and environmentally friendly strategy for controlling rice leaf folder based on a clearly defined molecular and physiological regulatory mechanism. Compared to traditional biological control methods that rely on broad-spectrum chemical insecticides or have unclear mechanisms of action, this approach, demonstrated through laboratory simulation experiments, shows that spraying leaves with a 0.4-0.8 mg / mL HEA treatment solution, after achieving the simulated field application standard of "leaves covered with liquid without dripping," allows the larvae to ingest the solution and specifically induces the expression of the Calreticulin gene (the relative expression level can reach over 5.26 after 84 hours), accompanied by a regular change in extracellular Ca²⁺ concentration (peaking at 72 hours and then decreasing). This synergistic effect ultimately disrupts the pest's physiological homeostasis, achieving a mortality rate of over 82.3% for 4th instar larvae under laboratory conditions. Its beneficial effects are prominently reflected in the following aspects: 1) Novel and clear mechanism: A clear action pathway of "HEA-gene expression-calcium homeostasis imbalance-insecticide" has been established, providing a new target for biological control, and there is no risk of cross-resistance with existing chemical agents; 2) High efficiency and specificity: Highly efficient insecticidal effect is achieved by regulating key physiological processes of pests, and the safety of non-target organisms is expected to be higher; 3) Environmentally friendly: HEA is a naturally derived metabolite that is easily degraded, and theoretically there is no problem of chemical pesticide residues; 4) Clear application potential: The determined concentration range, application method and key time point of action (84 hours) provide direct laboratory data support and core parameter basis for the subsequent development of standardized and replicable field biological pesticide products.

[0008] Based on the above technical solution, the present invention can be further improved as follows: Further: In step 1), the solvent is water containing 1% DMSO.

[0009] Compared with the existing technology, the beneficial effects of adopting the above-mentioned further technical solution are as follows: Using water containing 1% DMSO as a solvent ensures effective dissolution and stability of HEA while avoiding the toxic interference of the co-solvent itself on the larvae, thus ensuring the accuracy of subsequent biological effect observations and the reliability of experimental results.

[0010] Based on the above technical solution, the present invention can be further improved as follows: Furthermore: In step 2), the spraying period is during the 1st to 4th instar larval stage of the rice leaf roller.

[0011] Compared with the existing technology, the beneficial effects of adopting the above-mentioned further technical solution are as follows: By precisely limiting the application period to the 1st to 4th instar larval stage, the active feeding behavior of larvae and their more sensitive physiological regulatory system to HEA during this stage can be fully utilized to achieve efficient control before the pest causes serious leaf rolling damage, significantly improving the timeliness and cost of control.

[0012] Further: In step 2), the spraying method is conventional agricultural spraying.

[0013] Based on the above technical solution, the present invention can be further improved as follows: Furthermore, through the aforementioned method, the relative expression level of the Calreticulin gene in the larvae of the rice leaf roller population that fed on the pesticide reached over 5.26 after 84 hours of treatment.

[0014] Compared with the existing technology, the beneficial effects of adopting the above-mentioned further technical solution are as follows: Using a quantifiable biomarker, such as gene expression levels above 5.26, as a clear criterion for the effectiveness of the technology provides a key indicator for the accurate prediction of control effects, the monitoring of pesticide quality, and the standardization of field application protocols.

[0015] Based on the above technical solution, the present invention can be further improved as follows: Furthermore, the extracellular Ca²⁺ concentration of rice leaf roller larvae that ingested the drug solution induced by the method reached its peak after 72 hours of treatment, and then decreased.

[0016] Compared with the existing technology, the beneficial effects of adopting the above-mentioned further technical solution are as follows: This dynamic change model reveals the unique mechanism by which HEA disrupts the calcium homeostasis of pests, providing key physiological time-series indicators for identifying the optimal action window (72-84 hours) of the pesticide and assessing its field control efficacy.

[0017] This invention also provides the application of HEA in the preparation of a field-use biopesticide for controlling rice leaf folder. The biopesticide uses HEA as the active ingredient and is applied to rice leaves by spraying, so that the pesticide is evenly coated on the leaf surface without dripping. After the rice leaf folder larvae feed on it, HEA disrupts the physiological homeostasis of the insect by regulating the expression of the Calreticulin gene and the extracellular Ca²⁺ concentration, thereby killing the insect.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention transforms HEA, a laboratory-identified active substance, into a field-grade biopesticide product with clearly defined application standards (non-drip sap on leaves) and a clear mechanism of action (regulation of genes and calcium homeostasis), achieving a direct connection from mechanism of action to product application. This application provides a clear product prototype and development path for developing next-generation green pesticides with novel targets and high environmental compatibility, potentially fundamentally avoiding the resistance and residue problems of traditional chemical pesticides. Furthermore, the effective concentration of HEA is 0.6 mg / mL.

[0019] Compared with the existing technology, the beneficial effects of adopting the above-mentioned further technical solution are as follows: The optimal concentration of HEA was determined to be 0.6 mg / mL. This concentration can effectively induce Calreticulin gene expression and Ca²⁺ concentration changes without causing toxic residues in the leaves due to excessive concentration, thus balancing insecticidal efficacy and environmental safety.

[0020] Furthermore, its control effect on rice leaf roller reached a significant level after 84 hours of continuous action.

[0021] The present invention also provides a HEA solution for controlling rice leaf roller, which is prepared by dissolving HEA at a concentration of 0.4~0.8 mg / mL in water containing 1% DMSO, and is used to apply to rice leaves according to the method described in any one of claims 1 to 6.

[0022] Compared with the prior art, the beneficial effects of the present invention are as follows: The HEA solution provided by this invention defines a concentration window of 0.4–0.8 mg / mL that balances high efficiency and safety. Combined with a standardized solvent system containing 1% DMSO, it forms a standardized formulation with clearly defined components, simple preparation, and direct field application. This solution directly materializes the laboratory-verified mechanism of action (regulation of genes and calcium homeostasis) into an operable product, providing a core material basis for developing novel green pesticides with unique mechanisms of action, good environmental compatibility, and low resistance rates. Attached Figure Description

[0023] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 This is a bar chart showing the relative expression levels of the Calreticulin gene in different tissues (hemolymph, fat body, head, midgut, and epidermis) of the rice leaf folder, as described in this embodiment of the invention. The results provide a basis for elucidating the target tissues of HEA.

[0025] Figure 2 This is a line graph showing the relative expression levels of the Calreticulin gene at different developmental stages of the rice leaf roller (including larval instars and pupal stage) in an embodiment of the present invention. This result provides theoretical support for selecting the 4th instar larva as the optimal control period.

[0026] Figure 3 In this embodiment of the invention, line graphs showing the relative expression levels of the Calreticulin gene in rice leaf roller larvae at different time points (48h, 60h, 72h, 84h) in the HEA-treated group and the control group visually demonstrate the key time effect of HEA in significantly inducing gene expression after 84 hours.

[0027] Figure 4 In this embodiment of the invention, a line graph showing the changes in extracellular Ca²⁺ content of rice leaf roller larvae at different time points in the HEA-treated group and the control group clearly demonstrates the regular dynamic change of the HEA-induced Ca²⁺ concentration, which reaches its peak at 72 hours and decreases after 84 hours. Detailed Implementation

[0028] The following description is based on specific embodiments.

[0029] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to represent selected embodiments of the present invention.

[0030] In this invention, unless otherwise specified, all equipment and raw materials are available from the market or commonly used in the industry. Unless otherwise specified, the methods in the following embodiments are conventional methods in the art.

[0031] Example 1 Verification of the insecticidal effect and mechanism of action of HEA against rice leaf folder under laboratory simulation conditions 1. Experimental Materials and Methods 1.1 Test Materials The tested insect was a 4th instar larva of the rice leaf roller (Cnaphalocrocis medinalis), provided by the Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences. The larvae were conventionally reared in an artificial climate chamber using fresh, uncontaminated rice leaves until they reached a healthy and active state.

[0032] Test compound: N6-(2-hydroxyethyl)adenosine (HEA), purity ≥98%, provided by Zhejiang Subtropical Crops Research Institute.

[0033] Plant materials used in the test: fresh, intact, and disease- and pest-free functional leaves of conventionally grown indica rice varieties.

[0034] Main reagents and instruments: Dimethyl sulfoxide (DMSO, analytical grade), sterile water, colorimetric assay kit for calcium content, Fura-2 AM fluorescent probe, RNA extraction and reverse transcription kit, RT-qPCR related reagents and instruments (primer sequences: CRT-F: CAGACGCTTCAAAACCAGAGGA; CRT-R: CGGGGTTGTCGATTTCTGGA), artificial climate chamber, fluorescent microplate reader, quantitative PCR instrument, etc.

[0035] 1.2 Preparation of HEA treatment solution Using sterile water containing 1% (v / v) DMSO as the solvent, HEA was accurately weighed, dissolved, and diluted to a final volume to prepare a HEA treatment solution with a concentration of 0.6 mg / mL. The solution was stirred thoroughly for later use. This concentration is selected from the effective range of 0.4-0.8 mg / mL as described in claim 1 of this invention. The control group was prepared using sterile water containing 1% DMSO as the solvent.

[0036] 1.3 Leaf treatment and larval feeding Select uniformly sized functional rice leaves and immerse them completely in the HEA treatment solution or control solution for 10 seconds, ensuring the solution is evenly applied to the leaf surface. After removal, place them on sterile filter paper to air dry naturally until the leaf surface is coated with solution but does not drip, simulating the "no dripping" field application standard stated in the claims. Place the treated leaves in sterile petri dishes, inoculating each dish with 30 healthy, uniformly sized fourth-instar larvae. This larval age was chosen based on previous studies (e.g., ...). Figure 2 As shown in the figure, the Calreticulin gene begins to be highly expressed in the 4th instar, making it more sensitive to HEA, which is consistent with the 1st to 4th instar larval control period described in claim 4.

[0037] 1.4 Experimental Design and Feeding Conditions The experiment included a HEA treatment group and a solvent control group. Each group had three biological replicates (i.e., three culture dishes). All culture dishes were placed in an artificial climate chamber with the following conditions: temperature (25±1)℃, photoperiod of 16 hours light: 8 hours dark (16L:8D), and relative humidity of 70%±5%. During the rearing period, fresh treated or control leaves were regularly replaced to ensure a continuous supply of the drug.

[0038] 1.5 Effect Observation and Indicator Testing Mortality rate statistics: 96 hours after treatment, the number of dead larvae in each replicate was counted, the mortality rate was calculated, and independent samples t-tests were performed using SPSS software to compare differences between groups (P<0.01 was considered highly significant).

[0039] Gene expression analysis: Larval samples were collected at 48 h, 60 h, 72 h, and 84 h after treatment, and total RNA was extracted and reverse transcribed into cDNA. Using the Actin gene as an internal control, the relative expression level of the Calreticulin gene was detected by RT-qPCR, and the data were analyzed using the 2-ΔΔCt method.

[0040] Extracellular Ca²⁺ concentration detection: A colorimetric assay kit for calcium content was used, with Fura-2 AM as the fluorescent probe. The probe was prepared as a stock solution in DMSO and diluted with 1×HEPES buffer before use. The fluorescence intensity ratio (Ratio) at 340 nm / 380 nm excitation and 510 nm emission was recorded using a fluorescence detection system to dynamically reflect changes in extracellular Ca²⁺ concentration.

[0041] 2. Results and Analysis 2.1 Insecticide effect After 96 hours of treatment, the average mortality rate of 4th instar larvae of rice leaf roller in the HEA-treated group was 82.3%, while the average mortality rate in the solvent control group was only 5.7%. Statistical analysis showed that the lethality of the HEA-treated group was significantly higher than that of the control group (P<0.01), directly verifying the highly efficient insecticidal effect of the method of the present invention under laboratory conditions.

[0042] 2.2 Verification of Mechanism of Action Spatiotemporal expression characteristics of the Calreticulin gene Experiments showed that the expression of the Calreticulin gene differed significantly in different tissues and developmental stages of the rice leaf folder: Organizational expression (see) Figure 1 The highest expression level was found in hemolymph (relative expression level 7.89), the lowest in epidermis (relative expression level 0.98), and the expression levels in fat body, head, and midgut ranged from 2.28 to 3.22. Developmental stage expression (see Figure 2 HEA expression is low in the larval stage, increases in the 4th instar (relative expression level 3.12), and reaches its maximum in the pupal stage (relative expression level 11.32). This characteristic provides a theoretical basis for the selection of HEA targets, as the 4th instar larvae are the key period for control and are more sensitive to HEA responses.

[0043] Calreticulin gene expression regulation: RT-qPCR results show (see...) Figure 3 In the control group, the expression level of Calreticulin gene remained stable at all time points. In the HEA-treated group, there was no significant difference in gene expression level between the control and control groups from 48 h to 72 h; however, after 84 h of treatment, its expression level increased sharply, reaching a relative expression level of 5.26, which was significantly higher than that of the control group (P<0.01). This result meets the gene expression criterion (≥5.26) set in claim 6, confirming that HEA can specifically and significantly induce target gene expression with a clear time dependence.

[0044] Dynamic changes in extracellular Ca²⁺ concentration: Ca²⁺ concentration detection results show (see...) Figure 4 The extracellular Ca²⁺ content of larvae in the HEA-treated group was significantly higher than that in the control group, reaching a peak at 72 h of treatment, and then began to decline after 84 h, showing a regular change of first increasing and then decreasing. This dynamic pattern is consistent with the description in claim 7, revealing the physiological process by which HEA disrupts the calcium ion homeostasis of pests.

[0045] 3. Conclusion The results showed that treating rice leaves with 0.6 mg / mL HEA solution (prepared with 1% DMSO aqueous solution) followed by feeding it to fourth-instar larvae not only achieved a high insecticidal rate of 82.3%, but also clarified its mechanism of action through molecular and physiological detection: HEA induces a high expression level of the Calreticulin gene in rice leaf folder after 84 hours (relative expression level ≥5.26), and triggers a disorder in the extracellular Ca²⁺ concentration, which peaks at 72 hours and then declines, ultimately disrupting the physiological homeostasis of the pest and causing its death. This provides sufficient experimental data to support the effectiveness of the core claims (such as the method, application, and pesticide product), especially the limiting features regarding the concentration, critical period, gene expression threshold, and dynamic changes in calcium ions.

[0046] Example 2 This example demonstrates a field plot experiment on HEA for controlling rice leaf roller.

[0047] 1. Experimental Objective The effectiveness and feasibility of the HEA control method provided by this invention in actual field conditions were verified.

[0048] 2. Experimental Materials and Conditions Experimental location: Standard experimental field in Yongxing Street, Longwan District, Wenzhou City, Zhejiang Province.

[0049] Experimental crop: The rice variety planted was the local main indica rice, and the planting and management methods were the same as those for conventional high-yield fields.

[0050] Test reagent: N6-(2-hydroxyethyl)adenosine (HEA), with a purity ≥98%, prepared into the HEA solution described in this invention.

[0051] Experimental period: During the peak period of the second generation of rice leaf roller (from the late tillering stage to the booting stage of rice).

[0052] 3. Experimental Design Cell setup: The experiment used a randomized block design with two treatments: HEA treatment area: 100 m². Following the method of this invention, a 0.6 mg / mL HEA solution (prepared with water containing 1% DMSO) was used for foliar spraying.

[0053] Control area (CK): 100 m². Sprayed with an equal volume of water containing 1% DMSO.

[0054] Application plan: The application equipment is a conventional backpack electric sprayer. During spraying, ensure the pesticide solution evenly covers both sides of the rice leaves, until the leaf surface is "covered with pesticide but not dripping." A total of three applications are required, with each application spaced seven days apart. The first application should be carried out in the field during the peak hatching period of rice leaf roller eggs to the peak period of 1st-2nd instar larvae.

[0055] Field management: Except for the experimental treatment, other agricultural operations (such as water and fertilizer management, and other pest and disease control) remained consistent across all districts.

[0056] 4. Survey Methods and Statistical Analysis The investigation was conducted on the 14th day after the last application of the medication.

[0057] Insect population density survey: A parallel skip sampling method was used, with 10 points randomly surveyed in each treatment area, and 5 rice clumps surveyed at each point. The number of surviving rice leaf roller larvae (including all instars) on each rice clump was recorded, and the number of live insects per unit area (per square meter) was calculated, i.e., the insect population density (heads / m²).

[0058] Leaf damage rate survey: At the same survey point, record the total number of leaves in each rice clump and the number of leaves showing typical longitudinal rolling symptoms caused by rice leaf roller, and calculate the leaf damage rate (%).

[0059] Data analysis: Independent samples t-tests were performed on the insect population density and leaf damage rate data of the treatment area and the control area using SPSS software to compare the significance of differences (P<0.05 indicates significant difference).

[0060] 5. Test Results The results of the survey 14 days after the last application are shown in the table below: Note: Data in the table are mean ± standard error; different letters after the data in the same column indicate that the difference is significant at the P<0.05 level.

[0061] Data analysis shows that: Insect population control effect: The average insect population density in the HEA treatment area was 3.2 insects / m², which was significantly lower than the 28.6 insects / m² in the control area, with a relative control efficacy of 88.8%.

[0062] Leaf preservation effect: The average leaf damage rate in the HEA treatment area was 8.5%, which was significantly lower than the 63.2% in the control area, indicating a significant relative leaf preservation effect.

[0063] 6. Experimental Conclusions The field plot experiment results of this embodiment show that, following the technical solution provided by this invention (using 0.6 mg / mL HEA solution, foliar spraying with the standard of "leaf coating without dripping water," starting application at the early larval stage and maintaining a certain period of action), the population growth of rice leaf roller in the field can be effectively controlled, significantly reducing the number of larvae and the degree of leaf damage. This directly verifies the effectiveness, operability, and practical value of the method of this invention in real farmland environments, providing strong field empirical evidence for promoting the application of this method and the corresponding HEA solution to green rice production. The experimental results and laboratory simulation data (Example 1) corroborate each other, together forming a chain of evidence supporting the integrity of this invention.

[0064] In the description of this invention, it should be understood that "-" and "~" represent a range between two values, and this range includes the endpoints. For example, "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0065] In the description of this invention, the term "and / or" is merely a description of the relationship between related objects, indicating that there can be three relationships. For example, A and / or B can represent three cases: A exists alone, A and B exist simultaneously, and B exists alone.

[0066] In the description of the invention, the numerical values ​​of time, temperature, ratio, and mass involved can be based on actual measurements, standard equipment parameters, simplified rounding results, or within an acceptable error range, ensuring the practicality and repeatability of the invention.

[0067] In the description of this invention, the terms “about” or “approximately” are used to express approximate values ​​or ranges, allowing for a certain degree of error to ensure the flexibility and practicality of the description, while remaining within an acceptable range of error, with the maximum error not exceeding 10% of the corresponding value or range.

[0068] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for controlling rice leaf roller using HEA, characterized in that, Includes the following steps: 1) Dissolve HEA in a solvent containing a co-solvent to prepare a HEA treatment solution with a concentration of 0.4-0.8 mg / mL; 2) Spray the prepared HEA solution in step 1) evenly onto the rice leaves until the solution clings to the leaf surface but does not drip. 3) The larvae continuously feed on the leaves covered with HEA solution. HEA enters the insect body, induces the expression of the Calreticulin gene in the insect body and regulates the extracellular Ca²⁺ concentration, which lasts for more than 84 hours, thereby achieving the control effect.

2. The method for controlling rice leaf rollers using HEA according to claim 1, characterized in that, In step 1), the solvent is water containing 1% DMSO.

3. The method for controlling rice leaf rollers using HEA according to claim 1, characterized in that, In step 2), the spraying period is during the 1st to 4th instar larval stage of the rice leaf roller.

4. The method for controlling rice leaf rollers using HEA according to claim 1, characterized in that, In step 2), the spraying method is conventional agricultural spraying.

5. The method for controlling rice leaf rollers using HEA according to claim 1, characterized in that, Using the method described above, the relative expression level of the Calreticulin gene in the larvae of the rice leaf roller population that fed on the pesticide reached more than 5.26 after 84 hours of treatment.

6. The method for controlling rice leaf rollers using HEA according to claim 1, characterized in that, The extracellular Ca²⁺ concentration of rice leaf roller larvae that fed on the drug solution induced by the method reached its peak after 72 hours of treatment, and then decreased.

7. The application of a HEA in the preparation of a field-use biological pesticide for controlling rice leaf roller, characterized in that, The biopesticide uses HEA as its active ingredient. It is applied to rice leaves by spraying, so that the pesticide is evenly coated on the leaf surface without dripping. After the rice leaf roller larvae feed on it, HEA disrupts the physiological homeostasis of the insect by regulating the expression of the Calreticulin gene and the extracellular Ca²⁺ concentration, thereby killing the insect.

8. The application according to claim 7, characterized in that, The effective concentration of HEA is 0.6 mg / mL.

9. The application according to claim 7, characterized in that, Its control effect on rice leaf roller reached a significant level after 84 hours of continuous action.

10. A HEA pesticide solution for controlling rice leaf roller, characterized in that, It is prepared by dissolving HEA at a concentration of 0.4~0.8 mg / mL in water containing 1% DMSO, and is used to apply it to rice leaves according to the method described in any one of claims 1 to 6.

Images