RNA (Ribonucleic Acid) and small molecule compound co-delivery system as well as preparation method and application thereof
By using the metal-organic framework UIO-66 vector to encapsulate KHSRP-targeting RNA and small molecule compounds to form nanoscale particles, the targeting and controlled release issues of siRNA and chemotherapy drugs in vivo were resolved, resulting in better cancer treatment efficacy and biosafety.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-29
- Publication Date
- 2026-03-31
AI Technical Summary
Existing siRNA and chemotherapy drug delivery systems face challenges in terms of in vivo targeting and controlled release, resulting in poor cancer treatment efficacy and significant side effects.
Using the metal-organic framework UIO-66 as a carrier, RNA and small molecule compounds targeting KHSRP are encapsulated to form nanoscale particles, achieving targeted delivery and controlled release.
It improved the effectiveness of cancer treatment, reduced damage to normal cells, and demonstrated good biocompatibility and tumor suppression.
Smart Images

Figure CN121754686A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of drug delivery, and in particular to an RNA and small molecule compound co-delivery system, its preparation method, and its application. Background Technology
[0002] KH-type splicing regulatory protein (KHSRP) is a multifunctional RNA-binding protein involved in processes such as mRNA splicing, stability, and miRNA biogeneration. KHSRP is central to many biological processes, including innate and adaptive immune responses, DNA damage responses, inflammatory diseases, tissue remodeling, and lipid metabolism. Furthermore, studies have shown that KHSRP plays a crucial role in the development and progression of various cancers, such as papillary renal cell carcinoma, lung cancer, breast cancer, renal cell carcinoma, colorectal cancer, non-small cell lung cancer, cervical cancer, and prostate cancer. Therefore, KHSRP is considered a potential therapeutic target for cancer.
[0003] Current cancer treatments primarily include radiotherapy, chemotherapy, and immunotherapy. However, while these treatments kill tumor cells, they can also damage surrounding normal cells, resulting in numerous side effects. Small interfering RNA (siRNA) holds great potential in cancer treatment because it can target and silence the expression of target genes at the post-transcriptional level through RNA interference (RNAi) mechanisms, thereby inhibiting tumor growth and metastasis. A treatment strategy that co-delivers siRNA with chemotherapy drugs can significantly improve cancer treatment efficacy and reduce side effects. Once inside the body, the siRNA targets specific target proteins and inhibits their expression, while the delivery system simultaneously releases the chemotherapy drugs, achieving synergistic combined therapy.
[0004] The design of siRNA and chemotherapeutic drug delivery systems requires consideration of various factors, including material selection, particle size and surface modification, as well as how to achieve targeted delivery and controlled release. Currently, lipid-based delivery systems, such as liposomes and lipid nanoparticles (LNPs), are one of the main methods for siRNA delivery. However, although liposomes exhibit good transfection efficiency in in vitro experiments, their in vivo transfection efficiency is often affected by various factors, including cycle time, targeting, immune response, and escape from the endoplasmic reticulum / lysosome, and their application in vivo still faces many challenges. Therefore, how to combine siRNA and small molecule compounds with delivery systems and achieve targeted delivery and controlled release in vivo is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0005] In view of the shortcomings of the prior art described above, the purpose of this invention is to provide an RNA and small molecule compound co-delivery system and its preparation method, so as to solve the problems in the prior art.
[0006] The first aspect of the present invention provides an RNA and small molecule compound co-delivery system, wherein the co-delivery system uses a metal-organic framework as a carrier, and the carrier encapsulates RNA and a small molecule compound targeting KHSRP.
[0007] Preferably, the metal-organic framework is selected from one or more of UIO-66, MIL-100, MIL-101, ZIF-8, ZIF-10, ZIF-11, PCN-9, PCN-222, PCN-224, MAF-7, MOF-5, MOF-200, MOF-210 and MOF-303.
[0008] In some specific embodiments, the metal-organic framework is UIO-66.
[0009] Preferably, the RNA is one or more of small interfering RNA, antisense oligonucleotide, messenger RNA, and microRNA.
[0010] More preferably, the RNA is a small interfering RNA.
[0011] Most preferably, the RNA sequence is selected from any one or more of SEQ ID NO: 1 to 3.
[0012] In some specific embodiments, the RNA sequence is SEQ ID NO: 1.
[0013] Preferably, in some specific embodiments, the substance is selected from one or more of clodiazepine, azacitidine, temozolomide, gemcitabine, and amifostine.
[0014] In some specific embodiments, the small molecule compound is gemcitabine.
[0015] Preferably, the co-delivery system is composed of nanoparticles with a particle size of 10–150 nm.
[0016] More preferably, the particle size of the nanoscale particles is 20-100 nm.
[0017] Preferably, in the co-delivery system, based on 1 mg of UIO-66, the amount of the small molecule compound is 0.01–1 mg, and the amount of the RNA is 0.01–0.5 mmol.
[0018] For example, based on 1 mg of UIO-66, the amount of the small molecule compound can be 0.01–0.05 mg, 0.05–0.1 mg, 0.1–0.2 mg, 0.2–0.3 mg, 0.3–0.4 mg, 0.4–0.5 mg, 0.5–0.6 mg, 0.6–0.7 mg, 0.7–0.8 mg, 0.8–0.9 mg, or 0.9–1 mg.
[0019] For example, based on 1 mg of UIO-66, the amount of RNA can be 0.01–0.05 mmol, 0.05–0.1 mmol, 0.1–0.2 mmol, 0.2–0.3 mmol, 0.3–0.4 mmol, or 0.4–0.5 mmol.
[0020] A second aspect of the present invention provides a method for preparing an RNA and small molecule compound co-delivery system, the method comprising: mixing a metal-organic framework with RNA and a small molecule compound in a solution, wherein the solution is any one of physiological saline, sterile water, deionized water, and PBS.
[0021] Preferably, the solution is physiological saline or sterile water.
[0022] Preferably, the concentration of the metal-organic framework in the solution is 0.1–1 mg / mL, the concentration of the small molecule compound in the solution is 0.01–0.5 mg / mL, and the concentration of RNA in the solution is 0.01–1 mol / mL.
[0023] For example, the concentration of the metal-organic framework in the solution can be 0.1–0.2 mg / mL, 0.2–0.3 mg / mL, 0.3–0.4 mg / mL, 0.4–0.5 mg / mL, 0.5–0.6 mg / mL, 0.6–0.7 mg / mL, 0.7–0.8 mg / mL, 0.8–0.9 mg / mL, or 0.9–1 mg / mL.
[0024] For example, the concentration of the small molecule compound in the solution is 0.01–0.1 mg / mL, 0.1–0.2 mg / mL, 0.2–0.3 mg / mL, 0.3–0.4 mg / mL, or 0.4–0.5 mg / mL.
[0025] For example, the concentration of RNA in the solution is 0.01–0.02 mol / mL, 0.02–0.03 mol / mL, 0.03–0.04 mol / mL, 0.04–0.05 mol / mL, 0.05–0.06 mol / mL, 0.06–0.07 mol / mL, 0.07–0.08 mol / mL, 0.08–0.09 mol / mL, or 0.09–0.1 mol / mL.
[0026] Preferably, the method further includes stirring the mixed solution for 0.5 to 48 hours.
[0027] In some specific embodiments, the stirring time is 20 to 25 hours.
[0028] More preferably, the mixing is a one-step mixing or a multi-step mixing.
[0029] More preferably, the mixing is a multi-step mixing process, in which the metal-organic framework is first mixed and stirred with either a small molecule compound or RNA, and then another substance is added and the mixing and stirring are continued to prepare the mixture.
[0030] A third aspect of this invention provides the application of an RNA-small molecule compound co-delivery system in the preparation of drugs for cancer, neurological diseases, inflammation, metabolic diseases, and immune diseases.
[0031] Preferably, the cancers include, but are not limited to, renal papillary cell carcinoma, lung cancer, breast cancer, kidney cancer, colorectal cancer, non-small cell lung cancer, cervical cancer, and prostate cancer.
[0032] Preferably, the neurological diseases include, but are not limited to, anxiety disorders, insomnia, schizophrenia, mania, and depression; preferably, the immune diseases include, but are not limited to, systemic lupus erythematosus.
[0033] Preferably, the metabolic disease includes, but is not limited to, diabetes.
[0034] A fourth aspect of the present invention provides a pharmaceutical composition comprising an RNA and small molecule compound co-delivery system and pharmaceutically acceptable excipients.
[0035] Preferably, the pharmaceutical composition is an injection, and the pharmaceutically acceptable excipient is an injection adjuvant.
[0036] As described above, the RNA and small molecule compound co-delivery system of the present invention has the following beneficial effects:
[0037] 1. The RNA and small molecule compound co-delivery system of the present invention can target KHSRP in vivo to deliver RNA, thereby silencing the KHSRP gene, and at the same time promote the release of small molecule compounds to inhibit KHSRP expression.
[0038] 2. Compared with the use of small molecule compounds alone, the RNA and small molecule compound co-delivery system of the present invention has better cancer treatment effect.
[0039] 3. In vivo experiments in mice have demonstrated that the RNA and small molecule compound co-delivery system of the present invention does not cause damage to the tissues and organs of mice; and has no effect on the red blood cells, hemoglobin, platelets and white blood cells of mice. Attached Figure Description
[0040] Figure 1 The diagram shows the binding of gemcitabine to KHSRP protein in Example 1 of this invention.
[0041] Figure 2 A shows a transmission electron microscope (TEM) diagram of UIO-66 loaded with gemcitabine in Embodiment 1 of the present invention.
[0042] Figure 2 B shows a schematic diagram of ESD element scanning after UIO-66 is loaded with gemcitabine in Embodiment 1 of the present invention. In the figure, red represents C-based, yellow represents O-based, and blue represents Zr-based.
[0043] Figure 2 C shows a scanning electron microscope (SEM) diagram of UIO-66 loaded with gemcitabine in Embodiment 1 of the present invention.
[0044] Figure 2 Display D shows an XRD diagram of UIO-66 loaded with gemcitabine in Embodiment 1 of the present invention.
[0045] Figure 3 The image shown is a transmission electron microscope schematic diagram of UGS NPs in Embodiment 1 of the present invention.
[0046] Figure 4 The diagram shows the infrared absorption peaks of UIO-66NPs, Gem, and UIO-66NPs loaded with Gem in Embodiment 2 of the present invention.
[0047] Figure 5 The image shows the ultraviolet absorption spectrum of Gem in Example 2 of this invention.
[0048] Figure 6 A shows a schematic diagram illustrating the loading efficiency of UIO-66NPs on different concentrations of Gem in Embodiment 2 of the present invention.
[0049] Figure 6 B shows a schematic diagram illustrating the loading percentage of UIO-66NPs on different concentrations of Gem in Embodiment 2 of the present invention.
[0050] Figure 7The graph shown is a release curve of the Gem loaded by UIO-66NPs in Embodiment 2 of the present invention.
[0051] Figure 8 This diagram illustrates the qualitative analysis of siKHSRP loaded in UGS NPs using RNA gel electrophoresis in Example 2 of this invention.
[0052] Figure 9 The diagram shows the effect of Western blotting on the inhibition of KHSRP by Gem in Embodiment 3 of the present invention.
[0053] Figure 10 This diagram illustrates the effect of Gem on the IC-50 value of tumor cell inhibition after KHSRP expression knockdown and non-knockdown in Example 3 of the present invention.
[0054] Figure 11 The diagram shows the effect of qPCR experiment used in Example 3 of this invention to evaluate the inhibitory effect of UGS NPs on KHSRP.
[0055] Figure 12 The diagram shows the Western Blot experiment used in Embodiment 3 of this invention to evaluate the inhibitory effect of UGS NPs on KHSRP.
[0056] Figure 13 This diagram illustrates the uptake of UGS NPs by ACHN cells in Example 4 of the present invention.
[0057] Figure 14 The image shows the migration ability of ACHN and CAKI-2 cells in the control group, Gem treatment group, and UGS treatment group detected by scratch assay in Example 4 of this invention.
[0058] Figure 15 The image shows the migration ability of ACHN and CAKI-2 cells in the control group, Gem treatment group, and UGS treatment group detected by scratch assay in Example 4 of this invention.
[0059] Figure 16 The diagram illustrates the inhibition of ACHN and CAKI-2 cell proliferation by colony formation experiments in Example 4 of this invention, using the control group, Gem treatment group, and UGS treatment group, respectively.
[0060] Figure 17 The diagram shows the inhibition of ACHN cells and CAKI-2 cells by the 5-ethynyl-2-deoxyuridine (EdU) method in Example 4 of this invention.
[0061] Figure 18The diagram shown is a schematic diagram of the BALB / c nude mouse lung metastasis model creation process in Embodiment 5 of the present invention.
[0062] Figure 19 This is a diagram showing the in vivo imaging study of tumor cell location in NC and UGS mice in Example 5 of the present invention (left) and a schematic diagram of HE staining of mouse lungs.
[0063] Figure 20 The diagram shows HE staining of various tissues from mice in the NC and UGS groups in Example 5 of this invention.
[0064] Figure 21 The diagram shows the tumor growth curves of mice in the NC group and UGS group in Example 5 of this invention.
[0065] Figure 22 A shows a schematic diagram of the tumor sites in mice in the NC group and UGS group after 14 days of treatment in Example 5 of the present invention.
[0066] Figure 22 B shows a schematic diagram of tumor size in mice in the NC group and UGS group after 14 days of treatment in Example 5 of the present invention.
[0067] Figure 23 This diagram illustrates the comparison of tumor weight in mice in the NC group and UGS group after 14 days of treatment in Example 5 of this invention.
[0068] Figure 24 The diagram shows the expression level of KHSRP in mouse tumors in the NC group and UGS group detected by Western Blot experiment in Example 5 of the present invention.
[0069] Figure 25 A-25D shows a schematic diagram of routine blood tests in mice of the NC group and UGS group in Example 5 of this invention. Detailed Implementation
[0070] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0071] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature; see Sambrook et al., *MOLECULAR CLONING: A LABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; these series *METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATINSTRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (PM Wassarman and AP Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (PB Becker, ed.) Humana Press, Totowa, 1999, etc.
[0072] The applicant of this application, through preliminary bioinformatics analysis, determined a positive correlation between KHSRP and epithelial-mesenchymal transition (EMT) markers, and that activation of EMT is a key process in cancer cell metastasis. Therefore, this application assembles a small interfering RNA (siRNA) targeting KHSRP and a small molecule compound targeting KHSRP into a co-delivery system for cancer treatment. Specifically, this application selected gemcitabine, a conventional chemotherapy drug with strong binding affinity to KHSRP protein, as the small molecule compound, and the highly stable metal-organic framework UIO-66 as the delivery carrier for the co-delivery system. Since UIO-66 is a porous metal-organic framework, gemcitabine can be loaded into the gaps in the UIO-66 framework. The siRNA, being negatively charged, can electrostatically adsorb onto the positively charged metal ions on the UIO-66 framework, thus loading onto UIO-66 to form the co-delivery system. Furthermore, this application further investigated the in vitro and in vivo antitumor effects and in vivo safety of this co-delivery system, demonstrating that the siRNA and gemcitabine co-delivery system of this application has strong tumor-suppressive activity and good biocompatibility.
[0073] In each of the following embodiments, the equipment and materials were obtained from the following companies:
[0074] CAKI-2 and ACHN pRCC cell lines were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China);
[0075] Fetal bovine serum (FBS) was purchased from Hyclone;
[0076] The penicillin-streptomycin bispecific antibody solution was purchased from Yisheng Biotechnology.
[0077] McCoy's 5A medium was purchased from Gibco;
[0078] MEM culture medium was purchased from Gibco;
[0079] jetPRIME was purchased from Yisheng Biotechnology;
[0080] Trizol reagent kit was purchased from Invitrogen;
[0081] The Nanodrop 2000 spectrophotometer was purchased from Thermo Scientific.
[0082] Anti-KHSRP antibody was purchased from Abcam;
[0083] Anti-GAPDH antibody was purchased from Abcam;
[0084] Example 1
[0085] In this embodiment, gemcitabine (Gem) and small interfering RNA (siKHSRP) targeting KHSRP were loaded onto the zirconium-based metal-organic framework UIO-66 through physical loading and electrostatic adsorption, respectively, to prepare UIO-66@Gem@siKHSRP NPs (UGS).
[0086] 1.1 Obtaining small interfering RNA (siKHSRP) targeting KHSRP
[0087] The small interfering KHSRP RNA (siKHSRP) in this embodiment was synthesized and customized by RIBOBIO, and the specific siKHSRP sequence is shown in Table 1.
[0088] Table 1 siKHSRP sequences
[0089]
[0090]
[0091] After activity screening, SEQ ID NO:1, which showed the strongest inhibitory effect on KHSRP, was selected for the subsequent preparation of the co-delivery system.
[0092] 1.2 Screening of small molecule compounds that specifically bind to KHSRP
[0093] Drug screening was conducted based on the KHSRP protein crystal structure. KHSRP protein structures were obtained from protein databases. The KHSRP protein crystal structures were processed using UCSF Chimera, and the optimal binding site was predicted using the SiteMap database. The screening library included drug molecules approved by the U.S. Food and Drug Administration. It was derived from the ZINC20 database, a specialized screening molecule library consisting of 1,766 drug molecules.
[0094] Specifically, Autodock 1.2.0 was used for batch filtering, and the raccoon utility in the Autodock suite was used to batch convert small molecular structures into pdbqt format. The box size was set to a side length of [missing information]. A cube was constructed, with a spacing step size of 0.375. The coordinates of the KHSRP protein docking box were: center_x = 9.57, center_y = 3.86, center_z = -5.95. The maximum number of search conformations was set to 10,000. A genetic algorithm was used for conformation sampling and scoring, and the optimal conformation was selected based on the docking scores. Small molecule compounds were sorted in descending order of docking scores, and the top five were selected as candidates. The resulting small molecule compounds and their scores are shown in Table 2.
[0095] Table 2. The top five small molecule compounds selected through molecular docking screening and their scores.
[0096] Small molecule compounds Docking fraction / (kcal / mol) Chlordiazepine -7.029 Azacitidine -5.825 Temozolomide -5.771 Gemcitabine -5.769 Amifostine -5.690
[0097] Gemcitabine (Gem) is a common chemotherapy drug for cancer treatment and has a strong binding affinity to the KHSRP protein. Therefore, gemcitabine was chosen as a small molecule compound for the subsequent preparation of the delivery system. The binding of gemcitabine to the KHSRP protein is as follows: Figure 1 As shown, gemcitabine can form multiple hydrogen bonds with the KHSRP protein, and the two have a strong binding force.
[0098] 1.3 Preparation of metal-organic framework UIO-66 nanoparticles (UIO-66NPs)
[0099] First, 90.0 mg (0.386 mmol) of ZrCl4 and 128.2 mg (0.772 mmol) of terephthalic acid were added to a 20 mL vial, followed by 15 mL of N,N-dimethylformamide (DMF), and the mixture was sonicated to dissolve. After obtaining a clear solution, the sample was heated at 110 °C for 24 h. After heating, it was diluted in 15 mL of DMF for 72 h and washed in 15 mL of methanol. Finally, it was dissolved in 15 mL of water treated with diethyl pyrocarbonate (DEPC). The prepared UIO-66NPs were characterized as follows: Figure 2 As shown in A-2D.
[0100] 1.4 Preparation of UIO-66@Gem@siKHSRP NPs (UGS)
[0101] An appropriate amount of Gem was dissolved in physiological saline to prepare a 100 μg / mL Gem solution; an appropriate amount of UIO-66NPs was added to physiological saline to prepare a 500 μg / mL UIO-66NPs solution. 1 mL of the Gem solution was added to 1 mL of the UIO-66NPs aqueous solution, and the mixture was magnetically stirred for 24 h to obtain a Gem-loaded UIO-66NPs aqueous solution (UIO-66@Gem NPs).
[0102] UIO-66@Gem NPs were collected by centrifugation of physiological saline solution. An appropriate amount of UIO-66@Gem NPs was dissolved in sterile water to prepare a 500 μg / mL UIO-66@Gem NPs aqueous solution. 50 μmol of siKHSRP was dissolved in 1 mL of sterile water to prepare a siKHSRP aqueous solution. 1 mL of the UIO-66@Gem NPs aqueous solution and 1 mL of the siKHSRP aqueous solution were mixed and stirred at room temperature for 30 min to prepare UIO-66@Gem@siKHSRP (UGS) NPs. The particle size of the UGS NPs was detected using a Nano ZS90 (Worcestershire, UK), and observed using transmission electron microscopy. The results are shown below. Figure 3 As shown, the particle size of the UGS NPs prepared in this application is 50–100 nm.
[0103] Example 2
[0104] This example describes the qualitative and quantitative analysis of siRNA and small molecule compounds loaded on UIO-66NPs.
[0105] 2.1 Fourier transform infrared spectroscopy (FITR) was used to identify that UIO-66NPs could load Gem.
[0106] Infrared detection was performed on UIO-66 NPs, Gem, and UIO-66@Gem NPs loaded with Gem, and the results are as follows: Figure 4 As shown, the results prove that UIO-66NPs successfully loaded the Gem.
[0107] 2.2 Ultraviolet absorption spectroscopy was used to analyze the loading capacity of UIO-66NPs for Gem.
[0108] First, the UV absorption peak of Gem was detected, and the specific results are as follows: Figure 5 As shown. Different concentrations of Gem were analyzed for UV absorption peak detection. A standard curve was plotted with different Gem concentrations on the x-axis and absorbance on the y-axis. The final standard curve was y = 0.0218x + 0.013, R0. 2 =0.998. This standard curve was used for subsequent Gem loading and release experiments.
[0109] Gem solutions with concentrations of 100 μg / mL, 500 μg / mL, and 1000 μg / mL were prepared. 1 mL of each concentration was added to 1 mL of a 500 μg / mL UIO-66NPs aqueous solution, and the mixture was magnetically stirred for 24 h to obtain a Gem-loaded UIO-66NPs aqueous solution. The concentration of Gem in the UIO-66NPs aqueous solutions loaded with different concentrations was determined using a UV spectrophotometer and the standard curve method. This allowed for the calculation of the loading efficiency and percentage of Gem by UIO-66NPs. Specifically, loading efficiency = loaded Gem amount / total Gem amount, and loading percentage = loaded Gem amount / total mass. The loading efficiency of UIO-66NPs for different Gem concentrations is shown below. Figure 6 As shown in Figure A, the results indicate that with increasing Gem concentration, the number of unloaded UIO-66NPs capable of loading Gem gradually decreases, leading to a gradual increase in free Gem in the system and a decrease in Gem loading efficiency. The loading percentage of UIO-66NPs for different Gem concentrations is shown in Figure A. Figure 6 As shown in Figure B, the results indicate that as the Gem concentration increases, the amount of loaded Gem gradually increases, and the percentage of loaded Gem in the total system mass gradually rises.
[0110] 2.3 Ultraviolet absorption spectroscopy was used to analyze the release capacity of Gem-loaded UIO-66NPs (UIO-66@Gem NPs) for Gem.
[0111] Take 1 mL of the UIO-66@Gem NPs prepared in Example 1 above and place it in a 14000 kDa dialysis bag. Place the dialysis bag in a beaker containing 20 mL of PBS solution. Place the beaker in a 37°C water bath and keep shaking. At different time points of 0 h, 6 h, 12 h, 18 h, 24 h, 30 h, 35 h, 42 h, and 48 h, take 0.5 mL of dialysate from the beaker and add an equal volume of PBS. Use a UV spectrophotometer to detect the absorbance of Gem in the dialysate and calculate the concentration of Gem by substituting the result into the standard curve above. Specific results are as follows: Figure 7 As shown, the results indicate that UIO-66@Gem NP can slowly release Gem.
[0112] 2.4 Qualitative analysis of the siKHSRP loading capacity of UGS NPs was performed using RNA gel electrophoresis.
[0113] Furthermore, RNA gel electrophoresis was used to evaluate whether siKHSRP was effectively loaded into UGS NPs. Specifically, 5 nM siKHSRP was used as a control group. Following the method in Example 1, different amounts of siKHSRP (0 nM, 30 nM, 60 nM, 125 nM, 250 nM, 500 nM) were loaded into UIO-66 to prepare UGS NPs. Unloaded siKHSRP and UGS NPs were detected by RNA gel electrophoresis. The results are as follows: Figure 8 As shown, unloaded siKHSRP exhibits strong banding, while no banding is detected in UGS NPs loaded with different amounts of siKHSRP, proving that UIO-66NPs can effectively load siKHSRP.
[0114] Example 3
[0115] In this embodiment, cell experiments, Western blotting, and qPCR were used to evaluate the inhibitory effects of Gem, siKHSRP, and UGS NPs on KHSRP.
[0116] 3.1 Western Blot analysis of the inhibitory effect of Gem on KHSRP
[0117] ACHN cells were seeded at 10,000 cells / well in 6-well plates. 526 ng of Gem was added to each well. After culturing for 10, 20, and 30 minutes, the cells were lysed on ice, centrifuged, and the supernatant was collected. Protein concentration was determined colorimetrically. The same amount of lysis buffer was added, and the mixture was incubated in a boiling water bath for 3 minutes. The cells were then loaded, electrophoresed, transferred to a membrane, blocked with BSA, incubated overnight at 4°C with primary antibodies (Anti-KHSRP antibody and Anti-GAPDH antibody), and incubated with secondary antibody (anti-HRP). Color development and chemiluminescence were then performed, and the experimental results were recorded. The detection results are as follows: Figure 9 As shown, the results demonstrate that with the extension of Gem treatment time, the inhibitory effect of Gem on KHSRP is significantly enhanced, and Gem can significantly inhibit the expression of KHSRP.
[0118] 3.2 Cellular experiments to detect the effect of Gem knockdown on KHSRP expression on the IC-50 value of tumor cell inhibition.
[0119] First, the siRNA from Example 1 was transfected into cells using jetPRIME (YEASEN, China). Specifically, cells were treated with si-KHSRP (5 μL per well) for 24–48 h to knock down the expression of KHSRP in the cells.
[0120] ACHN cells were seeded at 5000 cells / well in 6-well plates. Different concentration gradients of Gem were added to the wells. After 12 hours of culture, cell viability was measured. The 6-well plates were then placed in a microplate reader, and absorbance was measured at 450 nm to determine the IC50 value of Gem for the cells. Specific results are as follows: Figure 10 As shown in the figure (the horizontal axis represents Gem concentration and the vertical axis represents cell viability), compared with cells that have not undergone KHSRP knockdown, knocking down KHSRP with siKHSRP can reduce the IC-50 value of tumor cells to GEM.
[0121] 3.3 qPCR and Western Blot experiments were used to evaluate the inhibitory effect of UGS NPs on KHSRP.
[0122] ACHN cells were seeded at 20,000 cells / well in 6-well plates. After reaching 70%-80% confluence, the cells were treated, divided into a control group (NC group) and treatment groups with different concentrations of UGS NPs (10 μg / mL, 50 μg / mL, and 100 μg / mL). After 24 h of treatment, total RNA was extracted using Trizol reagent (Invitrogen), and RNA concentration was measured using a Nanodrop 2000 spectrophotometer (Thermo Scientific). After complementary DNA synthesis, KHSRP expression was detected using reverse transcription-quantitative polymerase chain reaction (qPCR) with KHSRP-specific primers (Sangon Biotech, Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a control, and the relative expression level of RNA was calculated. Specific primer sequences are shown in Table 3, and qPCR results are as follows. Figure 11 As shown.
[0123] Table 3 qPCR primer sequences
[0124] Serial Number Primer name Primer sequence SEQ ID NO: 4 KHSRP-F ATCCGCAAGGACGCTTTCG SEQ ID NO: 5 KHSRP-R TGCTCTCCGGTTGATCTCCAT SEQ ID NO: 6 GAPDH F GGAGCGAGATCCCTCCAAAAT SEQ ID NO: 7 GAPDH R GGCTGTTGTCATACTTCTCATGG
[0125] Further, cells were lysed on ice for 30 minutes using lysis buffer (PC102, Epizyme). Protein concentration was determined using a BCA protein quantification kit (ZJ101, Epizyme). Proteins (20 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on a 10% polyacrylamide gel and transferred to a nitrocellulose membrane (WJ004, EpiZyme). The membrane was blocked with 5% skim milk at room temperature for 1 hour, then incubated overnight at 4°C with primary antibodies (Anti-KHSRP antibody and Anti-GAPDH antibody). After thorough washing, the membrane was incubated with secondary antibody conjugated with horseradish peroxidase at room temperature for 1 hour, followed by Western blotting using an enhanced chemiluminescence detection reagent. Chemiluminescence signals were detected using an imaging system (AI600, GE, USA). The intensity of individual protein bands was measured using ImageJ software. Western blotting results are shown below. Figure 12 As shown.
[0126] The qPCR and Western Blot results showed that UGS NPs significantly inhibited the expression of KHSRP in cells, and the inhibitory effect gradually increased with the increase of UGS NPs concentration.
[0127] Example 4
[0128] This embodiment is an in vitro cell observation experiment. Tumor cells were treated with UGS NPs to evaluate the tumor cells' ability to take up UGS NPs. At the same time, the inhibitory effect of UGS NPs on tumor cells was further evaluated through tumor cell invasion and migration experiments and proliferation experiments.
[0129] 4.1 Investigation of ACHN cells' ability to take up UGS NPs
[0130] ACHN cells were seeded at 20,000 cells / well in 6-well plates. Once the cell confluence reached 70%-80%, 100 μl of 100 μg / ml UGS NPs was added for phagocytosis. After 24 h of drug treatment, the cells were digested and fixed overnight at 4°C with 2.5% glutaraldehyde. The prepared cells were then washed and dehydrated in a low-viscosity solution and polymerized at 60°C. Finally, the cells were observed using a transmission electron microscope.
[0131] The results are as follows Figure 13 As shown, this demonstrates that UGS NPs can be effectively taken up by tumor cells.
[0132] 4.2 Cell scratch assay to evaluate the inhibitory effect of UGS NPs on pRCC cell migration
[0133] ACHN and CAKI-2 cells were seeded at 20,000 cells / well in 6-well plates. After reaching 70%-80% confluence, the cells were divided into three groups: control group (NC group), gemcitabine treatment group (Gem group), and UGS NPs treatment group (UGS group). The control group received 100 μl of PBS, the gemcitabine treatment group received 526 ng of Gem, and the UGS treatment group received 100 μl of 100 μg / ml of UGS, respectively. After 24 hours of treatment, the cell layer was vertically scraped using the tip of a pipette. The cells were washed three times with phosphate-buffered saline (PBS) to remove detached cells, and then 1640 medium was added. Cell migration was observed and photographed under a microscope at 0 h and 24 h. Wound healing rate was measured using ImageJ software.
[0134] The results are as follows Figure 14 As shown, the control group (NC group) cells without any treatment had strong migration and healing abilities, while the Gem group and UGS group cells had weak migration and healing abilities. Compared with the Gem group, UGS NPs treatment significantly inhibited the migration ability of CAKI-2 cells (P<0.05) and ACHN cells (P<0.01), proving that the UGS prepared in this application can significantly inhibit the migration of pRCC cells.
[0135] 4.3 Transwell assay to evaluate the inhibitory effect of UGS NPs on the invasion and migration of pRCC cells.
[0136] ACHN and CAKI-2 cells were seeded at 20,000 cells / well in 6-well plates. Once the cell confluence reached 70%-80%, the cells were divided into three groups: a control group (NC group), a gemcitabine treatment group (Gem group), and a UGS NPs treatment group (UGS group). 100 μl of PBS, 526 ng of Gem, and 100 μl of 100 μg / ml UGS were added to each group, respectively. After 24 hours of treatment, the total cell count reached 100,000. The cells were then digested and resuspended, and 30,000 cells were added to the upper layer of the chamber. 500 μl of 10% FBS medium was added to the lower chamber. In this example, 100 μl of matrix gel was placed on the upper surface of the polycarbonate membrane for the cell invasion assay; matrix gel was not used for the cell migration assay. The cells were incubated at 5% CO2 and 37°C for 24 hours. After incubation, the culture chambers were removed, and the penetrated cells were observed by crystal violet staining and microscopic imaging. Observe the number of cells that move from the upper chamber to the lower chamber.
[0137] The results are as follows Figure 15As shown, the control group (NC group) cells without any treatment had strong invasive and migration abilities, while the treatment groups treated with gemcitabine or UGS NPs could significantly inhibit the invasive and migration abilities of tumor cells. Compared with the Gem group, UGS NPs inhibited the invasive and migration abilities of pRCC cells more strongly, with only a small number of cells invading and migrating after 24 hours, proving that the UGS NPs prepared in this application can significantly inhibit the invasive and migration abilities of pRCC cells.
[0138] 4.4 Colony formation assay was used to investigate the proliferation capacity of pRCC cells.
[0139] ACHN and CAKI-2 cells were seeded at 20,000 cells / well in 6-well plates. After the cells reached 70%-80% confluence, they were divided into three groups: control group (NC group), gemcitabine treatment group (Gem group), and UGS NPs treatment group (UGS group). 100 μl of PBS, 526 ng of Gem, and 100 μl of 100 ug / ml UGS were added to each group, respectively. After treatment for 24 hours, the cells were digested and resuspended.
[0140] 5000 cells were then seeded into 6-well plates. Each well was filled with 2000 μL of complete culture medium, and the cells were incubated at 37°C with 5% CO2 for 14 days. Culture was terminated after visible clones were observed in the culture dishes. The culture medium was discarded, and the cells were soaked twice in PBS. Paraformaldehyde was added to fix the cell clones, and after air drying, the cells were stained with crystal violet and photographed under a microscope to count the clones.
[0141] The results are as follows Figure 16 As shown, compared with the NC group, the proliferation capacity of CAKI-2 cells and ACHN cells treated with Gem and UGS NPs was significantly reduced; in addition, compared with the Gem group, UGS NPs treatment significantly reduced the proliferation capacity of CAKI-2 cells (P<0.01) and ACHN cells (P<0.05), proving that the UGS NPs prepared in this application can significantly inhibit the proliferation of tumor cells.
[0142] 4.5 The proliferation of pRCC cells was investigated using the 5-ethynyl-2-deoxyuridine (EdU) method.
[0143] ACHN and CAKI-2 cells were seeded at 20,000 cells / well in 6-well plates. After the cells reached 70%-80% confluence, they were divided into three groups: control group (NC group), gemcitabine treatment group (Gem group), and UIO-66@Gem@siKHSRPNPs treatment group (UGS group). 100 μl of PBS, 526 ng of Gem, and 100 μl of 100 ug / ml UGS were added to each group, respectively. After 24 hours of treatment, the cells were digested and resuspended.
[0144] 5000 ACHN and CAKI-2 cells were then cultured in 24-well plates and exposed to 10 μM 5-ethynyl-2-deoxyuridine (EdU) (EpiZyme) at 37°C and 5% CO2 for 2 h, followed by fixation with 4% paraformaldehyde. After washing with PBS / 0.3% bovine serum albumin, the cells were incubated with Alexa Fluor 555 (EDU kit) for 30 min and DAPI for 10 min. EdU results were observed using a Leica DM6 B vertical microscope system (Leica, Germany).
[0145] The results are as follows Figure 17 As shown, after DAPI staining, all cell nuclei were stained blue, while newly proliferated cell nuclei were stained red by EDU. Merge represents a combination of DAPI and EDU images. Compared to the NC group, the number of proliferating CAKI-2 and ACHN cells treated with Gem and UGS was significantly reduced. Compared to the Gem group, UGSNPs showed a more significant inhibitory effect on the proliferation of CAKI-2 and ACHN cells.
[0146] The above cell experiments all confirmed that the UGS NPs prepared in this application have a strong anti-tumor ability against tumor cells in vitro.
[0147] Example 5
[0148] This embodiment is an in vivo investigation experiment, establishing a female BALB / c nude mouse lung metastasis model (Charles River). The specific modeling process is as follows: Figure 18 As shown, 1×10 5 ACHN cells were injected into mice. Three weeks later, d-fluorescein (Goldbio) was injected intraperitoneally into the mice at a dose of 100 mg / kg, and in vivo imaging of the mice was performed using the AniView100 imaging system.
[0149] 5.1 Evaluation of the therapeutic effect of UGS NPs on ACHN cell lung metastases in vivo
[0150] Grouping: Six female BALB / c nude mice with lung metastasis model prepared above were randomly divided into a control group (NC group) and a UGS NPs treatment group (UGS group), with 3 mice in each group. The NC group was injected intravenously with 200 μl of PBS solution, and the UGS group was injected intravenously with 200 μl of UGS NPs solution. After successful modeling, the drugs were administered, and the mice were injected intravenously every 3 days to evaluate the therapeutic effect of UGS NPs on tumors.
[0151] Six weeks after treatment with UGS NPs, one mouse from each of the NC and UGS groups was used for in vivo imaging observation, and lung tissue was collected for HE staining. Specific in vivo mouse imaging images are shown below. Figure 19 As shown on the left, the HE staining results of the lungs of mice in the NC group and the UGS group are as follows. Figure 19 (Right) As shown. The results showed that the fluorescently labeled tumor cells had metastasized extensively to the lungs of NC group mice, which were infected with a large number of ACHN cells, and the lung morphology had changed significantly, with many nodules produced; while no tumor cell aggregation imaging was detected in the lungs of UGS group mice, and the lung tissue was basically normal, with almost no infection by ACHN cells, proving that the UGS NPs of this application can significantly inhibit lung metastasis of ACHN cells.
[0152] 5.2 Assessment of the damage to tissues and organs caused by UGS NPs treatment in mice
[0153] Six weeks after treatment with UGS NPs, one mouse from each of the NC and UGS groups was euthanized, and its heart, liver, spleen, lung, and kidney were collected for HE staining and observation. The results are as follows: Figure 20 As shown, the UGS NPs of this application do not cause damage to the heart, liver, spleen, lungs, and kidneys of mice, demonstrating their good biocompatibility.
[0154] 5.3 Evaluation of the therapeutic effect of UGS NPs on tumors in mice
[0155] Grouping and Treatment: Eight female BALB / c nude mice with lung metastasis model prepared above were randomly divided into a control group (NC group) and a UGS NPs treatment group (UGS group), with four mice in each group. The NC group was intravenously injected with 200 μl of PBS solution, and the UGS group was intravenously injected with 200 μl of UGS NPs solution. After successful modeling, drug administration began, with intravenous injections every 3 days. After the first UGS NPs treatment, the tumor volume of mice in the NC group and UGS group was measured daily. Treatment was terminated after 14 days. The tumor growth curve is shown in the figure below. Figure 21 As shown, the results indicate that the tumors in the NC group mice that did not receive drug treatment grew rapidly, while the tumor growth in the UGSNPs-treated group mice was significantly reduced compared to the NC group (P < 0.001).
[0156] In addition, 14 days after treatment with UGS NPs, the tumor sites in mice in the NC and UGS groups were observed, and tumors were removed from the body for further observation. The results were as follows: Figure 22 As shown in A-22B, UGS NPs treatment significantly inhibited the growth of subcutaneous tumors in mice compared to the control group.
[0157] Furthermore, the removed tumors were weighed, and the tumor weights of mice in the NC group and UGS group were compared as follows: Figure 23 As shown, the results indicate that UGS NPs treatment can significantly reduce tumor weight (P < 0.01).
[0158] 5.4 Inhibitory effect of UGS NPs on KHSRP expression in mouse tumors
[0159] Western blotting was used to detect the expression level of KHSRP in tumors of mice in the NC and UGS groups using anti-KHSRP antibody and β-Actin Antibody. The results are as follows: Figure 24 As shown, compared with the control group, UGS NPs treatment significantly reduced the expression of KHSRP in tumors.
[0160] Assessment of the effect of 5.5 UGS NPs on mouse blood routine tests
[0161] Four mice from each of the NC and UGS groups were used, and peripheral blood was collected for complete blood count (CBC) analysis. The CBC parameters included red blood cells (RBC), hemoglobin (HGB), platelets (PLT), and white blood cells (WBC). The CBC results are as follows: Figure 25 As shown in A-25D, the results demonstrated that UGS NPs treatment had no significant effect on the levels of red blood cells, hemoglobin, platelets, and white blood cells in mice.
[0162] The above in vivo experiments all confirmed that the UGS NPs prepared in this application have a strong anti-tumor effect in vivo, and that the UGS NPs have high safety in vivo, do not cause damage to the tissues and organs of mice, and have no significant effect on the blood routine of mice.
[0163] In summary, this application demonstrates through in vitro cell experiments and in vivo mouse experiments that the UGS NPs of this application have a significant inhibitory effect on the proliferation and migration of tumor cells, can inhibit the expression of KHSRP in cells and tumors, have a strong anti-tumor effect, and have high in vivo safety.
[0164] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A system for co-delivery of RNA and small molecule compounds, characterized in that, The co-delivery system takes metal organic framework as a carrier, and the carrier encapsulates the RNA targeting KHSRP and the small molecule compound.
2. The co-delivery system of claim 1, wherein, The metal organic framework is selected from one or more of UIO-66, MIL-100, MIL-101, ZIF-8, ZIF-10, ZIF-11, PCN-9, PCN-222, PCN-224, MAF-7, MOF-5, MOF-200, MOF-210 and MOF-303.
3. The co-delivery system of claim 1, wherein, The RNA is one or more of small interfering RNA, antisense oligonucleotide, messenger RNA, microRNA; preferably, the RNA is small interfering RNA.
4. The co-delivery system of claim 3, wherein, The RNA sequence is any one or more selected from SEQ ID NO: 1-3.
5. The co-delivery system according to claim 1, wherein, The small molecule compound is one or more selected from clorazepate, azacitidine, temozolomide, gemcitabine and amifostine.
6. The co-delivery system of claim 1, wherein, The co-delivery system is a nano-particle, and the particle size of the nano-particle is 10-150 nm; preferably, the particle size of the nano-particle is 20-100 nm.
7. The co-delivery system of claim 1, wherein, In the co-delivery system, the amount of the small molecule compound is 0.01-1 mg, and the amount of the RNA is 0.01-0.5 mmol, based on 1 mg of UIO-66.
8. A method for preparing a co-delivery system of RNA and a small molecule compound according to any one of claims 1 to 7, characterized by, The method comprises mixing the metal organic framework with the RNA and the small molecule compound in a solution, and the solution is any one of physiological saline, sterile water, deionized water and PBS.
9. The production method according to claim 8, characterized by, The concentration of the metal organic framework in the solution is 0.1-1 mg / mL, the concentration of the small molecule compound in the solution is 0.01-0.5 mg / mL, and the concentration of the RNA in the solution is 0.01-0.1 mmol / mL.
10. The method of claim 8, wherein, The method further comprises stirring the mixed solution for 0.5-48 h; and / or, the mixing is one-step mixing or multi-step mixing, preferably, the mixing is multi-step mixing, wherein the metal organic framework is first mixed with either the small molecule compound or the RNA, and then the other is added for further mixing and stirring.
11. Use of the RNA and small molecule compound co-delivery system according to any one of claims 1-7 in the preparation of a medicament for treating cancer, neurological disease, inflammation, metabolic disease and immune disease; preferably, the cancer includes but is not limited to renal papillary cell carcinoma, lung cancer, breast cancer, renal cancer, colorectal cancer, non-small cell lung cancer, cervical cancer and prostate cancer; preferably, the neurological disease includes but is not limited to anxiety, insomnia, schizophrenia, mania and depression; preferably, the immune disease includes but is not limited to systemic lupus erythematosus; preferably, the metabolic disease includes but is not limited to diabetes.
12. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the RNA and small molecule compound co-delivery system according to any one of claims 1-7 and a pharmaceutically acceptable adjuvant; preferably, the pharmaceutical composition is an injection, and the pharmaceutically acceptable adjuvant is an injection adjuvant.