Targeted EL-HN or EHc double-domain antibody and self-assembled antibody nanocage thereof

Abstract

The invention discloses a targeted EL-HN or EHc double-structural-domain antibody and a self-assembled antibody nanocage of the targeted EL-HN or EHc double-structural-domain antibody. The invention provides a nano antibody which comprises the 1st-116th site of SEQ ID NO: 4 or the 1st-123th site of SEQ ID NO: 6, and also provides a nano antibody fusion protein as shown in SEQ ID NO: 4 or SEQ ID NO: 6, and application of the two nano antibody fusion proteins and a recombinant protein SC-Fn in preparation of a self-assembled antibody nano cage. According to the present invention, the prepared E31Nb-ST and E2Nb-ST nanometer antibody fusion protein can specifically target EL-HN and EHc structural domains; and the self-assembled multivalent antibody nanocage which simultaneously targets the EL-HN and EHc double structural domains is designed and constructed, and the two structural domains are combined to generate a synergistic interaction effect, so that'whole-course double locking 'of the E protein is realized, and the method has important significance.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to an antibody targeting EL-HN or EHc dual domains and its self-assembled antibody nanocage. Background Technology

[0002] The low affinity of some antibodies limits their application in scientific research and clinical treatment. Studies have shown that multivalent assembly of single antibody molecules can improve the binding ability of antibodies to targets. Current research indicates that strategies for achieving multivalent antibody presentation mainly include antibody fusion expression via flexible linkers, antibody-polymerization by linking antibodies to polymers, and tetramerization by fusing antibodies with streptavidin. However, these methods typically suffer from limitations such as cumbersome procedures, low expression levels, and safety concerns. Therefore, there is a need to explore multivalent antibody development strategies with more optimized structures and simpler processes. Nanocage technology, using self-assembled nanoparticles as a chassis to display antibodies on the surface, is a rapid and efficient strategy for achieving multivalent antibody polymerization, meeting the design requirements of multivalent antibodies.

[0003] Ferritin can self-assemble into uniform, biocompatible nanocage structures. These closed cage structures consist of 24 identical subunits and can be modified through gene fusion or chemical coupling to display biomolecules such as antibodies and drugs. It is one of the most widely used self-assembled protein nanoparticles. SpyTag / SpyCatcher is a highly efficient site-specific protein conjugation method. The two proteins can be rapidly, effectively, and stably linked via isopeptide bonds. Simply mixing SpyTag and SpyCatcher effectively forms stable isopeptide bonds, and the binding conditions are simple.

[0004] The E protein consists of a 100 kDa heavy chain (H) and a 50 kDa light chain (L) linked by disulfide bonds. The light chain has metalloproteinase activity, which can specifically cleave substrate proteins necessary for neurotransmitter release. The N-terminal membrane translocation domain (HN, 50 kDa) of the heavy chain is mainly responsible for mediating the passage of the light chain across the endocytic vesicle membrane, while the C-terminal receptor-binding domain (Hc, 50 kDa) participates in presynaptic binding and endocytosis. Summary of the Invention

[0005] The technical problem solved by this invention is how to prepare self-assembled antibody nanocages targeting the dual domains of EL-HN and EHc, and novel antibodies targeting EL-HN or EHc.

[0006] To address the aforementioned technical problems, the first aspect of this invention provides nanobodies, which are any of the following: The nanobody shown in A includes three heavy chain variable region complementarity-determining regions: CDR1, CDR2, and CDR3. The amino acid sequence of CDR1 includes positions 26-33 of SEQ ID NO: 4, the amino acid sequence of CDR2 includes positions 51-57 of SEQ ID NO: 4, and the amino acid sequence of CDR3 includes positions 96-105 of SEQ ID NO: 4. The nanobody shown in B includes three heavy chain variable regions: CDR1, CDR2, and CDR3. The amino acid sequence of CDR1 includes positions 26-33 of SEQ ID NO: 6, the amino acid sequence of CDR2 includes positions 51-58 of SEQ ID NO: 6, and the amino acid sequence of CDR3 includes positions 97-112 of SEQ ID NO: 6.

[0007] In the above text, the CDR of the antibody is the complementarity-determining region (CDR) of the heavy chain variable region as defined by the IMGT numbering scheme.

[0008] The CDR described in this application is a "complementarity-determining region," which is a region in the antibody variable domain that is highly variable in sequence and forms a structurally defined "hypervariant loop" and / or contains antigen contact residues, or "antigen contact sites." The CDR is primarily responsible for binding to antigen epitopes. A variable region typically contains three CDR regions, named CDR1, CDR2, and CDR3 from the N-terminus.

[0009] In the nanobodies mentioned above, The amino acid sequence of the nanobody shown in A is any of the following: A1) The amino acid sequence includes positions 1-116 of SEQ ID NO:4; A2) is a sequence that has more than 80% identity with A1).

[0010] In some embodiments, the amino acid sequence of A1) is positions 1-116 of SEQ ID NO:4.

[0011] In the nanobodies mentioned above, The amino acid sequence of the nanobody shown in B is any of the following: B1) The amino acid sequence includes positions 1-123 of SEQ ID NO:6; The sequences B2 and B1 have more than 80% identity.

[0012] In some embodiments, the amino acid sequence of B1) is positions 1-123 of SEQ ID NO:6.

[0013] In the preceding text, "identity" refers to the identity of an amino acid sequence or nucleotide sequence. The alignment used to determine the percentage of sequence identity can be achieved in various known ways, such as using publicly available computer software like BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR). Appropriate parameters for aligning sequences can be determined, including the algorithms required to achieve maximum alignment across the entire length of the sequences being compared. However, for the purposes of this article, the sequence comparison computer program ALIGN-2 is used to generate the percentage of sequence identity values. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc., and the source code has been submitted with user documentation to the U.S. Copyright Office, Washington, D.C., 20559, under U.S. Copyright Office registration number TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc. (South San Francisco, California), or can be compiled from the source code. The ALIGN-2 program should be compiled for use on UNIX operating systems, including Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and will not change.

[0014] In some implementations, the 80% or more identity can be 80%, 90%, 95%, 97%, 98%, 99%, or 100% identity.

[0015] The term "nanobody" refers to a variable domain of heavy chain antibody (VHH), which is a protein composed of the variable domain of the antibody heavy chain.

[0016] In a second aspect, the present invention provides a nanobody fusion protein, which is a fusion protein obtained by linking a protein tag to the N-terminus and / or C-terminus of the nanobody described in the first aspect.

[0017] In the fusion protein described above, the protein tag is SpyTag or hFc.

[0018] The amino acid sequence of the fusion protein described above is any of the following: a1) The amino acid sequence includes SEQ ID NO:4; a2) The amino acid sequence includes SEQ ID NO:6; a3) The amino acid sequence includes SEQ ID NO:8; a4) The amino acid sequence includes SEQ ID NO:10.

[0019] In some embodiments, a1) has the amino acid sequence SEQ ID NO:4.

[0020] In some embodiments, the amino acid sequence a2) is SEQ ID NO:6.

[0021] In some embodiments, the amino acid sequence a3) is SEQ ID NO:8.

[0022] In some embodiments, the amino acid sequence a4) is SEQ ID NO:10.

[0023] Thirdly, the present invention provides biomaterials related to the nanobody described in the first aspect or the fusion protein described in the second aspect, wherein the biomaterials are any one of C1) to C12): C1) A nucleic acid molecule encoding the nanobody described in the first aspect or the fusion protein described in the second aspect; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1); C4) A recombinant vector containing the expression cassette described in C2); C5) Recombinant microorganisms containing the nucleic acid molecules described in C1); C6) Recombinant microorganisms containing the expression cassette described in C2); C7) Recombinant microorganisms containing the recombinant vector described in C3); C8) Recombinant microorganisms containing the recombinant vector described in C4); C9) Recombinant cells containing the nucleic acid molecules described in C1); C10) Recombinant cells containing the expression cassette described in C2); C11) Recombinant cells containing the recombinant vector described in C3); C12) Recombinant cells containing the recombinant vector described in C4).

[0024] In the aforementioned biological materials, the nucleic acid molecule in C1) can be either a DNA molecule or an RNA molecule. The DNA molecule can be genomic DNA or a cDNA molecule. The nucleic acid molecule can be the genomic gene or cDNA gene of the protein.

[0025] In the aforementioned biological materials, the expression cassette described in C2) refers to DNA capable of expressing the antibody or its antigen-binding fragment in a host cell. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all regulatory sequences necessary for expressing the nucleic acid molecule containing the antibody or its antigen-binding fragment. The regulatory sequences, under compatible conditions, guide the coding sequence to express the antibody or its antigen-binding fragment in a suitable host cell. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences must include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, a regulator-linked regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains transcriptional regulatory sequences that mediate protein expression. The promoter can be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and can be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell and thus terminate transcription. The termination sequence is operatively linked to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in this application. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively linked to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in this application. The regulatory sequence can also be a signal peptide coding region that encodes an amino acid sequence attached to the amino terminus of the antibody or its antigen-binding fragment, capable of guiding the antibody or its antigen-binding fragment into the cellular secretion pathway. Signal peptide coding regions that can guide the expressed antibody or its antigen-binding fragment into the secretion pathway of the host cell can be used in this application. Adding regulatory sequences that can modulate the expression of the aforementioned antibodies or their antigen-binding fragments according to the growth status of host cells may also be necessary. Examples of regulatory sequences are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby turning gene expression on or off. Other examples of regulatory sequences are those that enable gene amplification. In these examples, the nucleic acid sequence encoding the aforementioned antibody or its antigen-binding fragment should be operatively linked to the regulatory sequence. Expression cassettes may also include the target gene, marker genes (such as TK, DHFR, CAT, and NEO genes), ribosome recognition and binding sites (SD), transcription factor binding sites (TFBS), enhancers, silencers, repressors, introns, poly(A) signal sequences, and / or mRNA splicing signal sequences.The components in the expression box can be directly connected or indirectly connected through connectors.

[0026] In the aforementioned biological materials, the recombinant vector described in C3) can be a cloning vector or an expression vector. When preparing the expression vector, the nucleic acid molecule encoding the aforementioned protein can be located within the vector so that it can be operatively linked to an appropriate expression regulatory sequence. The recombinant expression vector can be any vector (e.g., plasmid or virus) that facilitates recombinant DNA manipulation and expression of nucleic acid sequences. The choice of vector typically depends on its compatibility with the host cell to which it will be introduced. The vector can be a linear or closed circular plasmid. The vector can be a self-replicating vector (i.e., a complete structure existing outside the chromosome that can replicate independently of the chromosome), such as plasmids, extrachromosomal elements, microchromosomes, or artificial chromosomes. The vector can contain any mechanism that ensures self-replication. Alternatively, the vector is a vector that, when introduced into a host cell, integrates into the chromosome and replicates along with the integrated chromosome. The vector contains one or more selection markers that facilitate the selection of transformed cells. A selection marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or confers protrophic trophic traits, etc. Examples of bacterial selection markers include the dal gene in Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. Vectors contain elements that enable stable integration into the host cell genome or ensure autonomous replication of the vector within the cell, independent of the cell genome. In the case of autonomous replication, the vector may also contain an origin of replication, enabling autonomous replication within the target host cell. The origin of replication may carry a mutation that makes it temperature-sensitive in the host cell (see, for example, f. Ehrlich, 1978, Proceedings of the National Academy of Sciences 75:1433). The yield of the gene product can be increased by inserting more than one copy of the nucleic acid molecule encoding the aforementioned protein into the host cell. This copy number increase can be achieved by inserting at least one additional copy of the nucleic acid molecule into the host cell genome, or by inserting an amplifiable selection marker along with the nucleic acid molecule, and by culturing cells in the presence of a suitable selection reagent to select cells containing the amplified copy of the selective marker gene, thereby containing the additional copy of the nucleic acid molecule. The operations used to connect the above-mentioned elements to construct the recombinant expression vector described in this application are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).

[0027] The term "microorganism" generally includes bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae, spirochetes, algae, etc. For example, the bacteria mentioned may originate from the genus *Corynebacterium* (…). Corynebacterium sp. (such as Corynebacterium glutamicum, Corynebacterium pekinensis, Corynebacterium obliterans, etc.), bryophytes ( Brevibacterium sp. (such as short bacilli of lactic acid fermentation, short bacilli of yellow, short bacilli of ammonia-eating bacteria, etc.), Escherichia coli spp. ( Escherichia sp. (such as Escherichia coli), Erwinia spp. Erwinia sp. ), Agrobacterium ( Agrobacterium sp. (such as Agrobacterium tumefaciens), Flavobacterium ( Flavobacterium sp. ), Alcaligenes ( Alcaligenes sp. ), Pseudomonas spp. Pseudomonas sp. ) and Bacillus spp. ( Bacillus sp. (e.g., Bacillus subtilis). The viruses may include rotavirus, baculovirus, retrovirus (e.g., lentivirus), adenovirus, adeno-associated virus, poxvirus, papillomavirus, influenza virus, papillomavirus (e.g., SV40), and herpesvirus (e.g., herpes simplex virus). The fungi may be derived from yeasts (e.g., Bacillus subtilis). Saccharomyces sp. (such as Saccharomyces cerevisiae, Candida albicans, Methylospermum oryzae, Pichia pastoris), Fusarium genus ( Fusarium sp. ), Rhizoctonia spp. Rhizoctonia sp. Verticillium ( Verticillium sp. ), Penicillium ( Penicillium sp. Aspergillus ( ) Aspergillus sp. ) and Cephalosporin ( Cephalosporium sp. The actinomycetes may originate from the genus Streptomyces (…). Streptomyces sp. (e.g., Streptomyces). The algae may originate from the phylum Cyanophyta (e.g., cyanobacteria), genus Fucus (e.g., fucus vesiculosus). Fucus sp. ), genus *Cyclocarya* ( Achnanthes sp. ), genus *Codonopsis* ( Amphiprora sp. ), genus Dipterocarpa ( Amphora sp. ), Fiber Algae ( Ankistrodesmus sp. ), genus *Stellaria* ( Asteromonas sp. ) and the genus *Golden Color Algae* ( Boekelovia sp. )wait.

[0028] Fourthly, the present invention provides the use of the nanobody described in the first aspect, the fusion protein described in the second aspect, or the biomaterial described in the third aspect in at least one of the following or in the preparation of a product having at least one of the following functions; D1) Targeting the EL-HN domain; D2) Targeting the EHc domain; D3) Combined with the EL-HN structural domain; D4) Combined with the EHc structural domain; D5) Detection of the EL-HN structural domain; D6) Detect the EHc structural domain.

[0029] In some implementations, the EL-HN domain is the recombinant protein EL-HN, whose amino acid sequence can be the sequence of amino acids 1-840 in GenBank: AB082519.1 (submitted on March 25, 2002).

[0030] In some embodiments, the EHc domain is the recombinant protein EHc, whose amino acid sequence can be the sequence of amino acid positions 841-1252 in GenBank:AB082519.1 (submitted on March 25, 2002).

[0031] Fifthly, the present invention provides any of the following: F1, protein compositions or complexes, including the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6, and the recombinant protein SC-Fn; The amino acid sequence of the recombinant protein SC-Fn is any one of the following: E1) The amino acid sequence includes SEQ ID NO:2; The sequences E2 and E1 have more than 80% identity.

[0032] In some embodiments, the amino acid sequence of E1 is SEQ ID NO:2.

[0033] In the above text, the protein complex targets and binds to the EL-HN domain and the EHc domain.

[0034] F2. A self-assembled antibody nanocage that targets and binds to the EL-HN domain and the EHc domain, comprising the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6, and nanoparticles conjugated to the two fusion proteins; The nanoparticles are the recombinant protein SC-Fn from the fifth aspect.

[0035] Sixthly, the present invention provides any of the following: Application of G1, the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6 and the recombinant protein SC-Fn described in the fifth aspect in the preparation of self-assembled antibody nanocages; The self-assembled antibody nanocage targets and binds to the EL-HN and EHc domains.

[0036] G2. A method for preparing self-assembled antibody nanocages that target and bind to EL-HN and EHc domains, comprising the following steps: mixing the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6, and the recombinant protein SC-Fn described in the fifth aspect, and reacting them to obtain self-assembled antibody nanocages.

[0037] In the above text, the self-assembled antibody nanocage is a self-assembled nanoparticle of conjugated antibody.

[0038] In a specific embodiment, the self-assembled antibody nanocage is a self-assembled nanoparticle that conjugates the fusion protein shown in SEQ ID NO:4 and the fusion protein shown in SEQ ID NO:6.

[0039] In the method described above, the molar ratio of the mixture is 14:14:1.

[0040] In the method described above, the reaction conditions are 4°C and 12 h.

[0041] The development of antibodies combining EHc and EL-HN aims to achieve a neutralizing effect through both "front-end blocking of invasion" and "terminal inhibition." This invention prepares E31Nb-ST and E2Nb-ST nanobody fusion proteins that specifically target the EL-HN and EHc domains; furthermore, it designs and constructs self-assembled multivalent antibody nanocages that simultaneously target both the EL-HN and EHc domains, achieving a synergistic effect by binding these two domains and realizing "full-process dual locking" of the E protein, which is of great significance. Attached Figure Description

[0042] Figure 1 For SDS-PAGE detection of protein SC-Fn, lanes 1-2 are respectively: protein molecular weight standard (kDa) and protein SC-Fn.

[0043] Figure 2 The images show molecular sieve chromatography (A) and dynamic light scattering (B) characterization of protein SC-Fn.

[0044] Figure 3 The image shows the electrophoresis diagrams of the PCR amplification products of the E31Nb-ST and E2Nb-ST genes. Lanes 1-3 are, in order: DNA molecular weight standard (bp), E2Nb-ST, and E31Nb-ST.

[0045] Figure 4 SDS-PAGE assays of antibodies E31Nb-ST and E2Nb-ST were performed. Lanes 1-3 are, in order: protein molecular weight standard (kDa), E31Nb-ST, and E2Nb-ST.

[0046] Figure 5 To verify the antigen-binding activity of nanobody components E31Nb and E2Nb in an ELISA experiment based on nanobody-hFc fusion protein.

[0047] Figure 6 The images show the characterization of self-assembled antibody nanocages SC-Fn / E31Nb-ST+E2Nb-ST. Figure A shows the SDS-PAGE assay, with lanes 1-5 representing protein molecular weight standards (kDa), SC-Fn, E31Nb-ST, E2Nb-ST, and SC-Fn / E31Nb-ST+E2Nb-ST, respectively. Figure B shows molecular sieve chromatography, and Figure C shows dynamic light scattering.

[0048] Figure 7 The results of cytotoxicity experiments for antibody nanocages SC-Fn / E31Nb-ST+E2Nb-ST at different concentrations are shown.

[0049] Figure 8 The results of hemolysis experiments for antibody nanocages SC-Fn / E31Nb-ST+E2Nb-ST at different concentrations are shown. Detailed Implementation

[0050] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0052] Example 1: Preparation and characterization of recombinant protein SC-Fn I. Preparation of recombinant protein SC-Fn The expression plasmid of the recombinant protein SpyCatcher-Ferritin (SC-Fn) is described in the literature Self-assembled ferritin nanoparticles displaying PcrV and OprI as an adjuvant-free Pseudomonas aeruginosa vaccine. Front Immunol. 2023 Jun 21;14:1184863.

[0053] The amino acid sequence of the SC-Fn protein is SEQ ID NO:2, where positions 1-115 of SEQ ID NO:2 are SpyCatcher, positions 116-130 are linkers, and positions 131-293 are Ferritin.

[0054] The nucleotide sequence of the SC-Fn protein encoding gene is SEQ ID NO:1, where positions 1-345 of SEQ ID NO:1 are SpyCatcher, positions 346-390 are linkers, and positions 391-879 are Ferritin.

[0055] The recombinant plasmid SpyCatcher-Ferritin was transformed into... E. coli Engineered strains were prepared from BL21(DE3) competent cells.

[0056] The above-mentioned bacterial strain was inoculated onto ampicillin-resistant LB agar plates using the triple-stripe method and incubated overnight at 37°C. After incubation, single colonies were picked from the plates and transferred to 20 mL of ampicillin-resistant LB liquid medium in a sterile environment. The plates were then incubated overnight at 37°C and 220 rpm for primary activation. The next day, 20 mL of the cultured bacterial solution was added to 2 L of ampicillin-resistant LB liquid medium and incubated again at 37°C and 220 rpm for secondary activation. The shaker parameters were then adjusted to 16°C and 150 rpm for 1 h to cool the culture. In a sterile environment, 400 μL of a prepared 1 MIPTG stock solution was added to the cooled 2 L of bacterial solution and incubated overnight at 16°C and 150 rpm to obtain the cultured bacterial solution.

[0057] The cultured bacterial solution was aliquoted into centrifuge tanks, balanced on a balance, and centrifuged at 6000 rpm and 4°C for 20 min in a high-speed refrigerated centrifuge. The supernatant was discarded, and the bacterial sludge was resuspended in 40 mL of Tris-HCl buffer. The ultrasonic lysate probe was then placed in the resuspended bacterial solution for lysis. The lysed bacterial solution was centrifuged at 12000 rpm and 4°C for 20 min in a high-speed refrigerated centrifuge, and the supernatant was collected.

[0058] Place 5 mL of nickel-based affinity protein chromatography packing material into an empty affinity chromatography column tube, wash three times with Tris-HCl buffer, then transfer the collected supernatant to the column and place it on a vertical mixer at room temperature for 1 h to bind. Discard the bound supernatant, and elute sequentially with prepared gradients of 20 mM imidazole, 50 mM imidazole, 100 mM imidazole, 200 mM imidazole, and 300 mM imidazole, collecting the eluents at each concentration. Identify the collected eluents of different imidazole concentrations using SDS-PAGE, and select an appropriate concentration of eluent for HiTrap chromatography. TMThe target protein was replaced in Tris-HCl buffer using a Desalting chromatography column, aliquoted, and stored at -80°C for later use, yielding purified recombinant protein SC-Fn (buffer solution: 50 mM Tris-HCl, 150 mM NaCl, pH=8.5).

[0059] The recombinant protein SC-Fn was analyzed by SDS-PAGE electrophoresis, and the results are as follows: Figure 1 As shown, the recombinant protein SC-Fn can be expressed in soluble form in E. coli, corresponding to the band near 50.0 kDa in lane 2. II. Characterization of recombinant protein SC-Fn A Superose 6 Incease 10 / 300 GL column was loaded onto an AKTA Pure (Cytiva) purification system. After powering on, the tubing was flushed and equilibrated with Tris-HCl buffer. 500 μL of the purified recombinant protein SC-Fn was loaded via a 500 μL SuperLoop at a flow rate of 0.5 mL / min. The purified SC-Fn protein sample was prepared to a total volume of 1 mL and transferred to a cuvette. The particle size was measured using a nanoparticle size potentiometry instrument.

[0060] The results are as follows Figure 2 As shown, Figure 2 In sample A, the peak position of protein SC-Fn was 11.36 mL. Compared with the peak position and molecular weight of the standard (Gel Filtration Calibration kit HMW, Cytiva, 28403842), the peak position of SC-Fn was earlier than that of Thyroglobulin (669.0 kDa), indicating that its molecular weight was greater than 669.0 kDa. It is preliminarily speculated that the nanoparticles SC-Fn self-assembled into an aggregate form. Figure 2 In section B, the particle size distribution results show that the particle size distribution of SC-Fn nanoparticles is relatively narrow, mainly concentrated in the range of 10 nm to 100 nm, with the highest distribution intensity between about 30 nm and 40 nm. The average particle size at 25 °C is 33.6 nm (PDI=0.2).

[0061] Example 2: Preparation of nanobody-SpyTag fusion proteins E31Nb-ST and E2Nb-ST and verification of the antigen-binding activity of their nanobody components. I. Preparation of Nanobody-SpyTag Fusion Proteins E31Nb-ST and E2Nb-ST 1. Preparation of recombinant plasmids pTSE -E2Nb - hFc Using a template, primers 1 (CCCGGGTCGACCGGTCAGGTGCAGCTGGTGGAGTCTGGGG) and 2 (AGCTGCACCGCTAGCCTTGGTAGGCTTGTAGGCGTCCACCATCACGATGTGGGCTGAGGAGACGGTGACCTGGG) were used for amplification. The amplified product was the encoding gene of the nanobody-SpyTag fusion protein E2Nb-SpyTag, namely the E2Nb-ST encoding gene (its nucleotide sequence is SEQ ID NO:3, and its encoded protein amino acid sequence is SEQ ID NO:4). Figure 3 (As shown in lane 2).

[0062] The amino acid sequence of the nanobody-SpyTag fusion protein E2Nb-ST is SEQ ID NO:4, where parts 1-116 are the nanobody E2Nb and parts 117-129 are SpyTag.

[0063] The nucleotide sequence of the gene encoding the nanobody-SpyTag fusion protein E2Nb-ST is SEQ ID NO:3, where numbers 1-348 are the nucleic acids encoded by the nanobody E2Nb, and numbers 349-387 are the nucleic acids encoded by SpyTag.

[0064] pTSE -E31Nb - hFc Using this as a template, primers 1 (CCCGGGTCGACCGGTCAGGTGCAGCTGGTGGAGTCTGGGG) and 3 (AGCTGCACCGCTAGCCTTGGTAGGCTTGTAGGCGTCCACCATCACGATGTGGGCTGAGGAGATGGTGACCTGGG) were used for amplification. The amplified product was the gene encoding the nanobody-SpyTag fusion protein E31Nb-SpyTag, namely the E31Nb-ST gene (its nucleotide sequence is SEQ ID NO:5, and its encoded protein amino acid sequence is SEQ ID NO:6). Figure 3 (As shown in lane 3).

[0065] The amino acid sequence of the nanobody-SpyTag fusion protein E31Nb-ST is SEQ ID NO:6, where parts 1-123 are the nanobody E31Nb and parts 124-136 are the SpyTag.

[0066] The nucleotide sequence of the gene encoding the nanobody-SpyTag fusion protein E31Nb-ST is SEQ ID NO:5, where numbers 1-369 are the nucleic acid encoded by the nanobody E31Nb, and numbers 370-408 are the nucleic acid encoded by SpyTag.

[0067] plasmid pTSE -E31Nb - hFc and pTSE -E2Nb - hFc The genes encoding nanobodies E31Nb and E2Nb were cloned into pTSE using techniques such as PCR amplification, enzyme digestion, and ligation. hFc The recombinant expression plasmid obtained from the vector. pTSE- hFc It was obtained by linking the Fc domain gene of human immunoglobulin G to the pCMV vector. pTSE- hFc Recorded in non-patent literature: Xie Qing, Li Zhiying, Zhang Wei, et al. Screening and identification of antibodies against protective antigen V of Yersinia pestis [J]. Chinese Journal of Pathogenic Biology, 2022, 17(03):266-271. The amplified products were then digested with restriction endonucleases Sal I and Nhe I, respectively, followed by pTSE- His Vector (pTSE-) His The plasmid was constructed by ligating the mouse antibody Kappa chain signal peptide-Sal I-Nhe I-6×His encoding base sequence (ATGGAGACCGACACCCTGCTGCTCTGGGTGCTGCTGCTCTGGGTGCCCGGGTCGACGCTAGCCATCACCACCATCACCATTAG) to the pCMV vector plasmid. The ligation product was then transformed into Trans 10 competent cells, plated on 2YT-A plates, and incubated overnight at 37°C. Single clones were randomly picked from the overnight culture plates for sequencing analysis. An appropriate amount of correctly sequenced bacterial culture was added to 10 mL of 2YT-A medium and incubated overnight at 37°C and 220 r / min. The plasmid was then extracted according to the instructions of the endotoxin-free plasmid mini-preparation kit. The plasmid concentration was measured using a micro spectrophotometer and stored at -20°C to obtain the recombinant plasmid pTSE- E2Nb-ST-His and recombinant plasmid pTSE- E31Nb-ST-His .

[0068] 2. Expression and purification The above recombinant plasmid pTSE- E2Nb-ST-His and pTSE- E31Nb-ST-His HEK293-F cells (Invitrogen, R79007) were transfected as follows: Select plants in good growth condition one day before transfection, with a density of 2×10⁻⁶.6 FreeStyle at approximately cell / mL TM HEK293-F cells were centrifuged to remove the supernatant, resuspended in FreeStyle 293 medium, and the cell density was adjusted to 1.0 × 10⁶ cells / year. 6 Cells were cultured at 37°C, 5% CO2, and 125 r / min in a shaking incubator; on the day of transfection, the cell density was recounted, and the cell density should be 2 × 10⁻⁶ cells / mL. 6 Approximately 1 cell / mL.

[0069] Preparation of transfection complex: 24 μL of FectoPRO transfection reagent (Polyplus, 116-001) was diluted in 3 mL of Opti-MEM, gently mixed, and 24 μg of plasmid DNA was added. After mixing, the mixture was incubated at room temperature for 10 min to obtain a mixed solution.

[0070] Add the mixture to the prepared FreeStyle TM In HEK293-F cells, gently mix and return to the cell shaker for continued culture. Cell viability was monitored 72 h post-transfection. When cell viability dropped to 80-85%, the culture supernatant was collected by centrifugation at 8000 r / min for 10 min and filtered through a 0.45 µm filter membrane for purification.

[0071] Rinse the AKTA purifier with filtered deionized water, and after the UV and conductivity curves have stabilized, install the HisTrap. TM The HP pre-packed column was loaded into the purifier, and the system was rinsed with deionized water until the UV and conductivity curves stabilized. Equilibrate 5-10 column volumes with buffer (20 mM PB + 500 mM NaCl). Once the UV and conductivity monitoring lines stabilized, load the sample at a flow rate of 1 mL / min, and rinse until the baseline stabilized. After loading the sample, place the B1 tube into the elution buffer (500 mM imidazole + 20 mM PB + 500 mM NaCl), set the flow rate to 1 mL / min, and perform gradient elution in the following order: 5%, 10%, 15%, 20%, 30%, 50%, 100%. Collect the sample when the UV value exceeds 100 and stop elution when the UV value returns to 100. Then rinse the purifier with 0.01 M citrate buffer (pH 6.0). Once the curve stabilized, the HiTrap column was loaded. TM The pre-packed desalting column was mounted on the purification instrument. Protein sample was injected through the loading well using a syringe for replacement. The sample was collected when the UV value exceeded 100 and stopped when the UV value returned to 100. After replacement, the protein sample was sterilized by filtration through a 0.22µm filter membrane. Protein concentration was determined using a NanoDrop UV spectrophotometer (Thermo Scientific). SDS-PAGE was used to verify the accuracy of protein size; the results are shown below. Figure 4 As shown, it can be seen that the nanobody fusion protein E31Nb-ST ( Figure 4 Lane 2) and E2Nb-ST Figure 4 Lane 3) was successfully expressed in the HEK293-F cell system and secreted into the supernatant, along with... Figure 4 The corresponding band is around 15.0 kDa.

[0072] The amino acid sequence of the nanobody-SpyTag fusion protein E2Nb-ST is SEQ ID NO:4, where the amino acid sequence of the nanobody E2Nb is positions 1-116 of SEQ ID NO:4. Based on the analysis results from https: / / www.imgt.org / IMGT_vquest / input, the complementarity-determining regions (CDRs) of the heavy chain variable region are defined as follows: CDR1 is positions 26-33 of SEQ ID NO:4, CDR2 is positions 51-57 of SEQ ID NO:4, and CDR3 is positions 96-105 of SEQ ID NO:4.

[0073] The amino acid sequence of the nanobody-SpyTag fusion protein E31Nb-ST is SEQ ID NO:6, where the amino acid sequence of the nanobody E31Nb is positions 1-123 of SEQ ID NO:6. Based on the analysis results from https: / / www.imgt.org / IMGT_vquest / input, the complementarity-determining regions (CDRs) of the heavy chain variable region are defined as follows: CDR1 is positions 26-33 of SEQ ID NO:6, CDR2 is positions 51-58 of SEQ ID NO:6, and CDR3 is positions 97-112 of SEQ ID NO:6.

[0074] II. Validation of the binding activity of nanobody-hFc fusion protein to E31Nb and E2Nb antigens Antigen-binding activity is an important indicator for evaluating the ability of antibody molecules to specifically recognize target antigens. Since the nanobody-SpyTag fusion proteins E31Nb-ST and E2Nb-ST contain nanobody components E31Nb and E2Nb, this study used nanobody-hFc fusion proteins (E31Nb-hFc and E2Nb-hFc) as detection materials for indirect ELISA experiments to evaluate whether these core functional components retain their inherent antigen-binding ability in the fusion form. (The nanobody-hFc fusion protein samples E31Nb-hFc and E2Nb-hFc were prepared in our laboratory by adding the expression plasmid pTSE-...) E31Nb-hFc and pTSE- E2Nb-hFc By transfecting FreeStyle TM(The hFc nanobody was expressed and purified using HEK293-F cells and affinity chromatography). This detection strategy is based on the following considerations: the fusion of nanobody with hFc does not change its variable region sequence and antigen-binding epitope, therefore the hFc fusion form can be used to reflect the binding activity of the nanobody component itself.

[0075] The amino acid sequence of E2Nb-hFc is SEQ ID NO:8, where positions 1-116 of SEQ ID NO:8 represent the nanobody E2Nb, and positions 117-345 represent hFc. The nucleotide sequence encoding the nucleic acid of E2Nb-hFc is SEQ ID NO:7.

[0076] The amino acid sequence of E31Nb-hFc is SEQ ID NO:10, where positions 1-123 of SEQ ID NO:10 represent the nanobody E31Nb, and positions 124-352 represent hFc. The nucleotide sequence encoding the nucleic acid of E31Nb-hFc is SEQ ID NO:9.

[0077] The specific steps are as follows: Dilute the antigen protein (recombinant EL-HN protein or recombinant EHc protein) to 2 ng / µL with carbonate coating buffer (weigh 0.795 g Na2CO3 and 1.465 g NaHCO3 and dissolve them in 400 mL of deionized water measured in a graduated cylinder, adjust the pH to 9.6 after complete dissolution, and bring the volume to 500 mL with deionized water). Add 100 µL / well to a 96-well ELISA plate and incubate overnight at 4°C. Discard the coating buffer and wash the overnight coated ELISA plate 6 times with PBST (0.1% Tween-20) for 1 min each time. Blot dry any remaining liquid in the wells, add 200 µL / well of blocking buffer (3% skim milk powder), and block at 37°C for 2 h. Discard the blocking buffer, wash 6 times with PBST (0.1% Tween-20), blot dry, and appropriately dilute the antibodies to be tested (E31Nb-hFc and E2Nb-hFc, respectively) with blocking buffer. Add 100 µL / well of the diluted antibody to the ELISA plate and incubate at 37°C for 1.5 h. Discard the primary antibody, wash the 96-well ELISA plate 6 times with PBST (0.1% Tween-20), blot dry, dilute goat anti-human IgG (HRP) (Zhongshan Jinqiao, ZB-2304) with blocking buffer at a ratio of 1:4000, add 100 µL / well to the 96-well ELISA plate, and incubate at 37°C for 45 min. Discard the secondary antibody, wash 6 times with PBST (0.1% Tween-20), blot dry any remaining liquid, and prepare the chromogenic solution (10... The chromogenic solution contains 1 mL of 10×OPD, 9 mL of a mixture of 0.2 M Na₂HPO₄ and 0.1 M citric acid, and 10 µL of 30% hydrogen peroxide. 100 µL of this solution is added to each well of the ELISA plate and incubated in the dark for 15 min. The color development is observed, and after complete development, 50 µL of 2 M H₂SO₄ is added to each well to terminate the reaction. Detection wavelengths are 492 nm and 630 nm. Detection values ​​are recorded, and the binding curve is fitted using GraghPad Prism to calculate the EC50. 50 .

[0078] The results are as follows Figure 5 As shown, the EC of E31Nb-hFc combined with EL-HN was calculated. 50 The value is 0.51 nM, EC of E2Nb-hFc combined with EHc 50The value was 0.039 nM, indicating that E31Nb-hFc specifically binds to the antigen EL-HN, and E2Nb-hFc specifically binds to the antigen EHc, demonstrating that the nanobody components E31Nb and E2Nb retain effective antigen-binding ability after fusion. Since the nanobody components in E31Nb-ST and E2Nb-ST are identical to those in E31Nb-hFc and E2Nb-hFc, the above ELISA data validates the antigen-binding function of this core component, providing functional evidence for the expected antigen-binding capabilities of E31Nb-ST and E2Nb-ST.

[0079] Example 3: Preparation and Characterization of Self-Assembled Antibody Nanocages I. Preparation of self-assembled antibody nanocages The recombinant protein SC-Fn prepared in Example 1 was mixed with the nanobody fusion proteins E31Nb-ST and E2Nb-ST prepared in Example 2 at a molar ratio of 1:14:14 and bound at 4°C for 12 h. The resulting reaction product was a self-assembled antibody nanocage SC-Fn / E31Nb-ST+E2Nb-ST.

[0080] The above reaction products were identified by SDS-PAGE, and the results are as follows: Figure 6 As shown in Figure A, SDS-PAGE analysis confirmed the successful preparation of self-assembled antibody nanocages SC-Fn / E31Nb-ST+E2Nb-ST, and... Figure 6 The band near 70 kDa in lane A, 5 corresponds to this.

[0081] The reaction products were subjected to molecular sieve chromatography: A Superose 6 incease 10 / 300 GL column was loaded onto an AKTA Pure (Cytiva) purification system. After startup, the tubing was flushed and equilibrated with Tris-HCl buffer. 500 μL of each SC-Fn / E31Nb-ST+E2Nb-ST sample was loaded through a 500 μL SuperLoop at a flow rate of 0.5 mL / min. The SC-Fn / E31Nb-ST+E2Nb-ST mixture was then prepared to a total volume of 1 mL and transferred to a cuvette. The particle size of the sample was determined using a nanoparticle size potentiometry instrument.

[0082] Molecular sieve chromatography results are as follows Figure 6As shown in Figure B, it can be seen that the peak volume of the self-assembled antibody nanocage SC-Fn / E31Nb-ST+E2Nb-ST is 8.73 mL, which is smaller than the peak volume of the nanoparticle SC-Fn (11.36 mL), indicating that its molecular weight is larger than that of SC-Fn. This further proves that the nanoantibody fusion proteins E31Nb-ST and E2Nb-ST are successfully coupled with the nanoparticle SC-Fn.

[0083] The particle size distribution of the self-assembled antibody nanocage SC-Fn / E31Nb-ST+E2Nb-ST was further determined by dynamic light scattering experiments, and the results are as follows: Figure 6 As shown in Figure C, the particle size distribution of SC-Fn / E31Nb-ST+E2Nb-ST is relatively narrow, mainly concentrated in the range of 30 nm to 100 nm, with the highest distribution intensity between approximately 60 nm and 80 nm. The average particle size at 25 °C is 59.8 nm (PDI=0.2), which is larger than that of the SC-Fn nanoparticles, consistent with the results of SDS-PAGE and dynamic light scattering analysis.

[0084] II. Safety Evaluation of Self-Assembled Antibody Nanocages 1. Cytotoxicity evaluation The cultured HUVEC cells (iCell, iCell-h110) were counted and resuspended in culture medium to adjust the cell concentration to 1×10⁻⁶. 6 Cells / mL, 100 μL per well (containing 1×10⁻⁶ cells / mL) 5 Cells were added to 96-well flat-bottom cell culture plates, with three parallel groups, and cultured at 37°C in a 5% CO2 cell culture incubator for 24 h. The cell culture plates were then removed, the cell culture supernatant was discarded, and the plates were washed 2-3 times with PBS. The self-assembled antibody nanocages SC-Fn / E31Nb-ST+E2Nb-ST prepared above were diluted to different concentrations (0 μg / mL, 62.5 μg / mL, 125 μg / mL, 250 μg / mL, 500 μg / mL) and added to the cell culture plates. After culturing for another 24 h, 10 μL of CCK-8 solution was added to each well, and the plates were cultured at 37°C in a 5% CO2 cell culture incubator for 2 h. The absorbance was then measured using a microplate reader.

[0085] The results are as follows Figure 7 As shown, under different concentration conditions, the antibody nanocage SC-Fn / E31Nb-ST+E2Nb-ST had no significant effect on the survival rate of HUVEC cells, suggesting that it had no significant cytotoxicity.

[0086] 2. Evaluation of hemolysis Blood was collected from the orbital rim of Kunming mice using sterile anticoagulant tubes coated with EDTA. The collected orbital blood was centrifuged at 4000 rpm for 15 min, and the supernatant was discarded. The erythrocyte sediment was washed three times with physiological saline, and the washed erythrocyte sediment was diluted with physiological saline to a 2% v / v erythrocyte suspension. The prepared SC-Fn / E31Nb-ST+E2Nb-ST sample was diluted to different concentrations (62.5 μg / mL, 125 μg / mL, 250 μg / mL, 500 μg / mL) to obtain sample solutions of different concentrations. 800 μL of each sample solution, positive control (pure water), and negative control (PBS) were mixed with 200 μL of erythrocyte suspension and incubated at 37℃ for 2 h. Each sample was tested in triplicate. After incubation, the above samples were centrifuged at 4000 rpm for 15 min, and 100 μL of supernatant was added to each 96-well cell culture plate. The absorbance value was then measured using a microplate reader.

[0087] The results are as follows Figure 8 As shown, the positive control group showed significant hemolysis, while no significant hemolysis was observed in the negative control group and the sample treatment groups with different concentrations of antibody nanocages SC-Fn / E31Nb-ST+E2Nb-ST. This suggests that SC-Fn / E31Nb-ST+E2Nb-ST has no significant hemolytic effect and has good biocompatibility.

[0088] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Nanobody, which is any one of the following: The nanobody shown in A includes three heavy chain variable region complementarity-determining regions: CDR1, CDR2, and CDR3. The amino acid sequence of CDR1 includes positions 26-33 of SEQ ID NO: 4, the amino acid sequence of CDR2 includes positions 51-57 of SEQ ID NO: 4, and the amino acid sequence of CDR3 includes positions 96-105 of SEQ ID NO:

4. The nanobody shown in B includes three heavy chain variable regions: CDR1, CDR2, and CDR3. The amino acid sequence of CDR1 includes positions 26-33 of SEQ ID NO: 6, the amino acid sequence of CDR2 includes positions 51-58 of SEQ ID NO: 6, and the amino acid sequence of CDR3 includes positions 97-112 of SEQ ID NO:

6.

2. The nanobody according to claim 1, characterized in that: The amino acid sequence of the nanobody shown in A is any of the following: A1) The amino acid sequence includes positions 1-116 of SEQ ID NO:4; A2) is a sequence that has more than 80% identity with A1).

3. The nanobody according to claim 1, characterized in that: The amino acid sequence of the nanobody shown in B is any of the following: B1) The amino acid sequence includes positions 1-123 of SEQ ID NO:6; The sequences B2 and B1 have more than 80% identity.

4. A nanobody fusion protein, which is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of any of the nanobodies described in claims 1-3.

5. The fusion protein according to claim 5, characterized in that: The protein tag is SpyTag or hFc.

6. The fusion protein according to claim 4 or 5, characterized in that: The amino acid sequence of the fusion protein is any of the following: a1) The amino acid sequence includes SEQ ID NO:4; a2) The amino acid sequence includes SEQ ID NO:6; a3) The amino acid sequence includes SEQ ID NO:8; a4) The amino acid sequence includes SEQ ID NO:

10.

7. A biomaterial relating to the nanobody of any one of claims 1-3 or the fusion protein of any one of claims 4-6, wherein the biomaterial is any one of C1) to C12): C1) A nucleic acid molecule encoding any of the nanobodies according to claims 1-3 or any of the fusion proteins according to claims 4-6; C2) An expression cassette containing the nucleic acid molecule described in C1); C3) A recombinant vector containing the nucleic acid molecule described in C1); C4) A recombinant vector containing the expression cassette described in C2); C5) Recombinant microorganisms containing the nucleic acid molecules described in C1); C6) Recombinant microorganisms containing the expression cassette described in C2); C7) Recombinant microorganisms containing the recombinant vector described in C3); C8) Recombinant microorganisms containing the recombinant vector described in C4); C9) Recombinant cells containing the nucleic acid molecules described in C1); C10) Recombinant cells containing the expression cassette described in C2); C11) Recombinant cells containing the recombinant vector described in C3); C12) Recombinant cells containing the recombinant vector described in C4).

8. The use of any of the nanobodies according to claims 1-3, or any of the fusion proteins according to claims 4-6, or the biomaterial according to claim 7 in at least one of the following or in the preparation of products having at least one of the following functions; D1) Targeting the EL-HN domain; D2) Targeting the EHc domain; D3) Combined with the EL-HN structural domain; D4) Combined with the EHc structural domain; D5) Detection of the EL-HN structural domain; D6) Detect the EHc structural domain.

9. Any of the following: F1, protein compositions or complexes, including the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6, and the recombinant protein SC-Fn; The amino acid sequence of the recombinant protein SC-Fn is any one of the following: E1) The amino acid sequence includes SEQ ID NO:2; Sequences that share more than 80% identity with E2) and E1); F2. A self-assembled antibody nanocage that targets and binds to the EL-HN domain and the EHc domain, comprising the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6, and nanoparticles conjugated to the two fusion proteins; The nanoparticles are the recombinant protein SC-Fn.

10. Any of the following: Application of G1, the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6, and the recombinant protein SC-Fn described in claim 9 in the preparation of self-assembled antibody nanocages; The self-assembled antibody nanocage targets and binds to the EL-HN domain and the EHc domain. G2. A method for preparing self-assembled antibody nanocages that target and bind to EL-HN and EHc domains, comprising the following steps: mixing the fusion protein shown in SEQ ID NO:4, the fusion protein shown in SEQ ID NO:6, and the recombinant protein SC-Fn described in claim 9 and reacting them to obtain self-assembled antibody nanocages.

Images