Nucleic acid molecule and application thereof
By optimizing and modifying the codons of IGFBP-1 mRNA, lipid nanoparticles were made for intratumoral injection, which solved the problem of insufficient CD8+ T cell effector function and significantly enhanced the efficacy of tumor treatment. In particular, it has a significant synergistic effect when used in combination with tumor vaccines in solid tumors.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-09
- Publication Date
- 2026-03-31
AI Technical Summary
There is a lack of effective strategies in the current technology to significantly enhance the effector function of CD8+ T cells to improve the therapeutic effect on tumors, especially in solid tumors, where challenges such as target heterogeneity, immunosuppressive microenvironment and physical barriers exist, and the proportion of durable responses to immunotherapy is limited.
Lipid nanoparticles (LNPs) were fabricated by codon optimization and modification of the mRNA encoding insulin-like growth factor binding protein-1 (IGFBP-1). Intratumoral injection was used to enhance the expression of IGFBP-1 in the tumor microenvironment, arrest the differentiation of CD8+ T cells toward terminal exhaustion, and combined with tumor vaccines to enhance the anti-tumor immune response.
It significantly increases the protein content of IGFBP-1 in the tumor microenvironment, inhibits tumor growth, enhances the anti-tumor function of CD8+ T cells, and significantly improves the therapeutic effect of tumor vaccines, exhibiting a good synergistic effect.
Smart Images

Figure CN121759472A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a nucleic acid molecule and its applications, particularly lipid nanoparticles encapsulating IGFBP-1 mRNA and their role in enhancing CD8+. + Applications of T-cell immune function and / or anti-tumor therapy. Background Technology
[0002] The global cancer burden continues to rise rapidly. The latest assessment from the World Health Organization and its International Agency for Research on Cancer shows that in 2022, there were approximately 20 million new cancer cases and nearly 10 million deaths globally. Based on population aging and risk exposure trends, the number of new cases is projected to rise to ≥35 million by 2050, an increase of approximately 77% compared to 2022 (https: / / www.who.int / news / item / 01-02-2024-global-cancer-burden-growing--amidst-mounting-need-for-services). Therefore, finding effective cancer treatments has become an extremely important and urgent problem in the field of biomedicine. The occurrence and development of cancer are closely related to the host's immune system, especially the core role of cytotoxic CD8⁺ T cells in recognizing and eliminating tumor cells, making "enhancing tumor-specific T cell immunity" an important direction in modern cancer treatment. Currently, widely explored and applied strategies in clinical practice include immune checkpoint inhibitors (ICIs), adoptive cell therapy (such as CAR-T / TCR-T), and tumor vaccines. However, the overall proportion of durable responses is limited, suggesting the need to develop interventions that can further enhance the effector function of CD8⁺ T cells, improve efficacy, and are scalable. Furthermore, although CAR-T has shown significant efficacy in hematological malignancies, it faces multiple challenges in solid tumors, including target heterogeneity, immunosuppressive microenvironment, and physical barriers. Its inherent toxicities (such as cytokine release syndrome and neurotoxicity) can be life-threatening, further limiting its widespread application. (Zugasti, Inés et al (2025). “CAR-T cell therapy for cancer: current challenges and future directions.” Signal transduction and targeted therapy vol. 10, 1 210).
[0003] In the tumor microenvironment, continuous antigen stimulation, metabolic and inhibitory signals jointly drive CD8⁺ T cells to gradually lose their effector function, subsequently differentiating into an exhausted subset. While these cells can still infiltrate tumors, their cytotoxic activity and sensitivity to existing immunotherapies are significantly reduced. (Philip, M., & Schietinger, A. (2022). CD8 + T cell differentiation and dysfunction in cancer. Nature reviews. Immunology, 22(4),209–223.).
[0004] Further cell lineage analysis revealed that exhausted CD8⁺ T cells are not homogeneous: the "progenitor-like" population, which possesses self-renewal capabilities and remains responsive to treatments such as Anti-PD-1, differs decisively at the molecular and functional levels from the "terminally exhausted" population, which has lost effector function and responds poorly to immune checkpoint inhibitors. This stratification provides a crucial theoretical basis for understanding the differentiated efficacy of immunotherapy and designing strategies to reverse / remodel T cell exhaustion (Miller BC, DR Sen, R. Al Abosy, et al., Subsets of exhausted CD8(+) T cells differentially mediate tumor control and respond to checkpoint blockade. Nat Immunol, 2019. 20(3): p. 326-336.). Therefore, blocking or reversing the differentiation process of CD8⁺ T cells towards terminal exhaustion has become a key pathway and a rational pharmacological target for enhancing anti-tumor immunity and improving the response rate of immunotherapy. Summary of the Invention
[0005] To address the lack of existing technologies that can further enhance CD8 + To address the technical problem of strategies for T-cell effector function and significant therapeutic effects against tumors, this invention provides a nucleic acid molecule and its applications.
[0006] The present invention solves the above-mentioned technical problems by adopting the following technical solutions:
[0007] The first aspect of the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding a CDS encoding insulin-like growth factor binding protein-1 (IGFBP-1), said nucleic acid sequence being shown in SEQ ID NO: 2.
[0008] In some implementations, the nucleic acid molecule further comprises one or more of the following sequences:
[0009] (1) The encoding sequence of the 5'UTR, as shown in SEQ ID NO: 10;
[0010] (2) The encoding sequence of the 3'UTR, as shown in SEQ ID NO: 11;
[0011] In some embodiments, the nucleic acid molecule further comprises:
[0012] (3) The coding sequence of the polyA tail, wherein the coding sequence of the polyA tail consists of 50-150 repeating thymines; preferably 100.
[0013] In some embodiments, the nucleic acid molecule further comprises:
[0014] (4) T7 promoter, wherein the preferred sequence of the T7 promoter is as shown in SEQ ID NO: 8;
[0015] In some embodiments, the nucleic acid molecule further comprises:
[0016] (5) HA tag, wherein the sequence of the HA tag is preferably as shown in SEQ ID NO: 6.
[0017] In some embodiments, the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 3.
[0018] In some embodiments, the nucleic acid molecule is a modified nucleic acid molecule, and the modification is selected from one or two of the following:
[0019] (1) N1-methyl-pseudouridine (m1Ψ) modification, preferably, the modification is a partial or complete substitution; more preferably, the modification is that all UTPs in the nucleic acid molecule are replaced by N1-methyl-pseudouridine (m1Ψ);
[0020] (2) EZcap with cap modifier.
[0021] A second aspect of the present invention provides a pharmaceutical composition comprising a nucleic acid molecule as described in the first aspect of the present invention, and a pharmaceutically acceptable carrier and / or excipient.
[0022] In some embodiments, the carrier is a lipid nanoparticle, the lipid nanoparticle comprising:
[0023] The packaged lipids are cationic lipids (SM102), cholesterol, distearate phosphatidylcholine (DSPC), and polyethylene glycol-modified lipid molecules (DMG-PEG2000); preferably, the mass ratio of SM102:DSPC:cholesterol:PEG2000-DMG is (4.4~4.5):1:(1.8~1.9):(0.4~0.5).
[0024] In some embodiments, the volume ratio of the packaging lipid to the mRNA solution is 1:3.
[0025] In some embodiments, the pharmaceutical composition is lipid nanoparticles.
[0026] In some embodiments, the lipid nanoparticles are lipid nanoparticles with a particle size of 90 nm ± 20 nm.
[0027] In some embodiments, the lipid nanoparticles are lipid nanoparticles with a particle size of 70 nm, 80 nm, 90 nm, 100 nm or 110 nm.
[0028] In some embodiments, the pharmaceutical composition is an intratumoral injection formulation.
[0029] In some embodiments, the pharmaceutical composition also includes a tumor vaccine, such as a melanoma vaccine, as an active ingredient.
[0030] A third aspect of the present invention provides the use of a nucleic acid molecule as described in the first aspect of the present invention or a pharmaceutical composition as described in the second aspect of the present invention in the preparation of an antitumor drug.
[0031] In some implementations, the tumor is a melanoma.
[0032] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.
[0033] The reagents and raw materials used in this invention are all commercially available.
[0034] The positive and progressive effects of this invention are as follows:
[0035] This invention involves codon optimization and modification of mouse IGFBP-1 mRNA, followed by lipid encapsulation to form lipid nanoparticles (IGFBP-1 mRNA LNPs). Intratumoral injection of IGFBP-1 mRNA LNPs significantly increases the protein content of IGFBP-1 in peripheral blood (serum) and the tumor microenvironment (tumor stromal fluid), and also significantly inhibits mouse tumor growth and CD8 in the mouse tumor microenvironment. + T cell differentiation towards terminal exhaustion increases CD8. +The anti-tumor function of T. Furthermore, when the IGFBP-1 mRNA LNP lipid nanoparticles described in this invention are used in combination with tumor vaccines, they can significantly improve the therapeutic effect of tumor vaccines, exhibiting a good synergistic effect and showing broad application prospects in the field of tumor treatment. Attached Figure Description
[0036] Figure 1 Expression of IGFBP-1 mRNA in cells (AML12: mouse cells).
[0037] Figure 2 This is for the encapsulation of lipid nanoparticles.
[0038] Figure 3 The particle size distribution of lipid nanoparticles.
[0039] Figure 4 The values represent the IGFBP-1 protein content in the tumor and peripheral blood of mice in the tumor model; where (A) is the IGFBP-1 concentration in the tumor interstitial fluid and (B) is the serum IGFBP-1 concentration.
[0040] Figure 5 To validate IGFBP-1 mRNA LNPs in mice to enhance CD8 + The effect of T cell anti-tumor function; where (A) is the growth curve of mouse subcutaneous tumors; (B) is the tumor mass; (C) is the CD8+ / CD45+ ratio; (D) is the infiltration and depletion of CD8+ cells within the tumor. + T cell percentage; (E) represents CD8. + T cell proliferation and cytokine secretion.
[0041] Figure 6 The expression of wild-type IGFBP-1 mRNA and mutant IGFBP-1 S139A mRNA in cells.
[0042] Figure 7 To enhance CD8 levels in IGFBP-1 mRNA LNPs + The anti-tumor effect of T cells depends on the binding ability of IGFBP-1 to IGF-1. Mouse validation experiment; where (A) is the growth curve of subcutaneous tumor in mice; (B) is the tumor mass; (C) is the tumor infiltration and depletion of CD8. + T cell percentage; (D) represents CD8. + T cell proliferation and cytokine secretion.
[0043] Figure 8 This study validated the efficacy of IGFBP-1 mRNA LNPs combined with the B16-F10 tumor vaccine in mice; (A) shows the growth curve of subcutaneous tumors in mice; (B) shows the tumor infiltration and depletion of CD8.+ T cell percentage; (C) represents intratumoral infiltration of CD8 cells. + T cell cytokine secretion status. Detailed Implementation
[0044] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.
[0045] Example 1: Synthesis and Expression Verification of IGFBP-1 mRNA
[0046] The original coding sequence (CDS) of the mouse insulin-like growth factor binding protein-1 (IGFBP-1) gene (SEQ ID NO: 1 after removing the stop codon) was codon-optimized (SEQ ID NO: 2). The coding region DNA sequence was synthesized in vitro, and an HA tag (SEQ ID NO: 6) was added to the 3' end. The sequence was then cloned downstream of the T7 promoter (SEQ ID NO: 8) on the pcDNA3.1 vector. A linearized IGFBP-1 DNA template was amplified by PCR. 5'-UTR (SEQ ID NO: 10) and 3'-UTR (SEQ ID NO: 9) were added to the 5' and 3' ends of the IGFBP-1 DNA template, respectively, using primers pcDNA3.1-T7-5'UTR-F (SEQ ID NO: 8) and TL-3'UTR-100T-R (SEQ ID NO: 9). 11) By PCR amplification, 100 repeats of thymine T were introduced into the downstream end of the DNA template, thereby synthesizing 100 polyA tails in the mRNA product during subsequent in vitro transcription.
[0047] The linear IGFBP-1 DNA sequence obtained by PCR was used as a template for in vitro transcription using T7 RNA polymerase (K1083, APExBIO). During transcription, EZcap (B8177, APExBIO) was added to cap the mRNA product. Modified N1-methyl-pseudouridine (m1Ψ)-UTP (B8049, APExBIO) was used to reduce the immunogenicity of the mRNA product and increase its expression level. After digesting the DNA template in the reaction system using DNase I (EN0521, Thermo Scientific), the product was further purified to obtain IGFBP-1 mRNA. The mRNA synthesized from the original IGFBP-1 sequence (SEQ ID NO: 4) and the codon-optimized mRNA (SEQ ID NO: 2) were transfected into the normal mouse hepatocyte cell line AML12 (ATCC, Cat# CRL-2254). Figure 1 As shown, both the original IGFBP-1 mRNA and the codon-optimized mRNA can be expressed in cells. Furthermore, higher IGFBP-1 protein levels were detected in cell supernatants transfected with codon-optimized IGFBP-1 mRNA, indicating that codon optimization can improve mRNA expression efficiency.
[0048] Example 2: Obtaining lipid nanoparticles (LNPs) by encapsulating mRNA with lipids
[0049] To achieve efficient mRNA delivery in vivo, lipid nanoparticles (LNPs) were selected to encapsulate mRNA, such as... Figure 2 As shown, all lipid molecules used have been approved by the FDA and have good safety profiles. The lipid molecules used include four types: cationic lipid SM102 (C1042, APE×BIO), cholesterol (B1702, APE×BIO), distearate phosphatidylcholine DSPC (850365, Avanti), and polyethylene glycol-modified lipid molecule PEG2000-DMG (880151, Avanti). The four lipid components were formulated into ethanol stock solutions at the following concentrations: SM102 (20 mg / mL); DSPC (10 mg / mL); cholesterol (10 mg / mL); DMG-PEG2000 (5 mg / mL). The stock solutions of the four lipid components were mixed with ethanol at the volume ratios shown in Table 1 to prepare 1 ml of packaged lipids.
[0050] Table 1. Packaging lipid ratio
[0051] reagents Dosage SM102 (20 mg / mL) 221.58 μL DSPC (10 mg / mL) 98.61 μL Cholesterol (10 mg / mL) 185.78 μL DMG-PEG2000 (5 mg / mL) 93.95 μL Anhydrous ethanol (HPLC grade) 400.08 μL
[0052] The packaged lipids were rapidly mixed with IGFBP-1 mRNA solution at a volume ratio of 1:3 to obtain LNP samples with a diameter of approximately 100 nm. The LNP samples were diluted with 1×PBS, added to the corresponding measuring cups, and the measurement parameters were set. The particle size distribution and uniformity were then measured using Zetasizer Pro. Figure 3 As shown in the figure. The results indicate that the particle size of the IGFBP-1 mRNA LNP samples remained stable and showed good uniformity in all three tests.
[0053] Example 3: Validation of IGFBP-1 mRNA LNP expression in mice
[0054] The in vivo expression of intratumorally delivered IGFBP-1 mRNA was evaluated using a B16-F10 subcutaneous melanoma tumorigenesis model. Six-week-old male C57BL / 6 mice (purchased from Shanghai Lingchang Biotechnology Co., Ltd.) were randomly divided into four groups (n=8 per group) according to the experimental design; each group of mice was subcutaneously inoculated with 1×10- mRNA in the abdomen. 6 B16-F10 cells (ATCC, Cat# CRL-6475; RRID: CVL_0159). When the tumor volume reached approximately 20 mm. 3 Drug administration was then initiated, administered intratumorally every 3 days for a total of 4 doses: the control group received 25 μL PBS; the control LNP group received 5 μg LNP-Vector; and the experimental group received 5 μg LNP-IGFBP-1 (the dosing regimen remained consistent with the control LNP group). At the experimental endpoint, the animals were disposed of and serum and tumor stroma fluid were collected for the detection of IGFBP-1 protein levels.
[0055] Compared with the PBS control group and the control LNP group, intratumoral injection of LNP-IGFBP-1 significantly increased the protein content of IGFBP-1 in peripheral blood (serum) and the tumor microenvironment (tumor stromal fluid), suggesting that intratumorally delivered IGFBP-1 mRNA achieves effective protein expression locally. Figure 4 A and Figure 4 As shown in B.
[0056] Example 4: Validation of IGFBP-1 mRNA LNPs enhancing CD8 in mice + The effect of T-cell anti-tumor function
[0057] Six-week-old male C57BL / 6 mice were divided into four groups according to the experimental design; each group of mice was subcutaneously injected with 1×10n ... 6 B16-F10 cells (ATCC, Cat# CRL-6475; RRID: CVL_0159). When the tumor volume reached approximately 20 mm. 3Drug administration was then initiated, administered intratumorally every 3 days (i.e., intratumoral injection on days 0, 3, 6, and 9 after tumor implantation in the mouse abdomen): the control group received 25 μL PBS; the control LNP group received 5 μg LNP-Vector; and the experimental group received 5 μg LNP-IGFBP-1 (the dosing regimen remained consistent with the control LNP group). The size of the mouse tumor was measured and recorded at each administration.
[0058] Compared with the control group PBS and LNP without encapsulated mRNA, intratumoral injection of LNP-IGFBP-1 significantly inhibited tumor growth in mice and promoted CD8. + T cell infiltration into tumor tissue and inhibition of CD8 in the mouse tumor microenvironment + The differentiation of T cells towards terminal exhaustion enhances their anti-tumor function. For example... Figure 5 A- Figure 5 As shown in E.
[0059] Example 5: Validation of IGFBP-1 mRNA LNPs enhancing CD8 in mice + The anti-tumor effect of T cells depends on the binding ability of IGFBP-1 to IGF-1.
[0060] To demonstrate that IGFBP-1 mRNA LNPs exert their antitumor function in mice through IGFBP-1 binding, a mutant IGFBP-1 S139A mRNA (SEQ ID NO: 5) with a serine mutation at position 139 (alanine instead of serine) was designed and synthesized, following the aforementioned method. IGFBP-1 mRNA and IGFBP-1 S139A mRNA were transfected into mouse B16-F10 cells (ATCC, Cat# CRL-6475; RRID: CVL_0159). Successful expression of wild-type IGFBP-1 and mutant IGFBP-1 S139A was detected in the cell culture supernatant, as shown in the results below. Figure 6 As shown.
[0061] Six-week-old male C57BL / 6 mice were divided into four groups according to the experimental design; each group of mice was subcutaneously injected with 1×10n ... 6 B16-F10 cells (ATCC, Cat# CRL-6475; RRID: CVL_0159). When the tumor volume reached approximately 20 mm. 3Drug administration was then initiated, administered intratumorally every 3 days (i.e., intratumoral injections were performed on days 0, 3, 6, 9, and 12 after the first intratumoral injection): the control group received 25 μL PBS; the control LNP group received 5 μg LNP-Vector; and the experimental groups received 5 μg LNP-IGFBP-1 and 5 μg LNP-IGFBP-1-S139A (the dosing regimen remained consistent with the control LNP group). Tumor size was measured and recorded at each administration.
[0062] Compared with the control group PBS and LNP without encapsulated mRNA, intratumoral injection of LNP-IGFBP-1 significantly inhibited tumor growth in mice, while intratumoral injection of LNP-IGFBP-1-S139A with a mutated IGF-1 binding site significantly suppressed the tumor-suppressing biological effect mediated by LNP-IGFBP-1. Simultaneously, LNP-IGFBP-1-S139A with a mutated IGF-1 binding site significantly weakened and eliminated LNP-IGFBP-1-mediated T-cell anti-tumor immune function. Figure 7 A- Figure 7 As shown in D.
[0063] Example 6: Validation of the efficacy of combined IGFBP-1 mRNA LNPs with B16-F10 tumor vaccine in mice
[0064] Six-week-old male C57BL / 6 mice were divided into four groups, and each mouse was subcutaneously injected with 1×10 6 B16-F10 cells (ATCC, Cat# CRL-6475; RRID: CVL_0159) were administered intramuscularly at days 3, 7, 10, and 17, starting from the day of tumor inoculation. The control group received an equal volume of 25 μL PBS. Tumors reached a size of 20 mm. 3 Subsequently, the LNP-IGFBP-1 group was administered the drug intratumorally every 3 days at a dose of 5 μg per injection. The size of the mouse tumor was measured and recorded each time.
[0065] Compared with the PBS control group and the tumor vaccine-only group, intratumoral injection of LNP-IGFBP-1 significantly improved the efficacy of the tumor vaccine, inhibited tumor growth in mice, and suppressed CD8 in the tumor microenvironment. + The differentiation of T cells towards terminal exhaustion further enhances their anti-tumor function. For example... Figure 8 A to Figure 8 As shown in C.
[0066] appendix:
[0067] Original CDS sequence of mouse IGFBP-1 (after removing the stop codon):
[0068] (SEQ ID NO:1)
[0069] Codon-optimized mouse IGFBP-1 CDS sequence: This sequence is obtained by codon optimization based on the original mouse IGFBP-1 CDS sequence in order to improve expression efficiency. Therefore, it differs from the original sequence, but the translation results are the same and the encoded amino acid sequence remains consistent.
[0070] ATGCCCGAGTTTCTGACTGTGGTGTCTTGGCCTTTCCTGATTCTGCTGAGCTTTCAGATCGGCGTGGCTGCCGGAGCTCCTCAGCCTTGGCACTGTGCCCCTTGTACCGCTGAAAGGCTGGGTCTGTGTCCTCCTGTGCCAGCTTCTTGTCCTGAAATTAGCAGACCAGCTGGATGTGGATGTTGCCCTACATGTGCTCTCCCTATGGGAGCTGCTTGTGGAGTGGCTACAGCAAGATGTGCTCAGGGATTATCTTGTAGGGCTCTGCCTGGCGAGCCAAGGCCACTGCATGCTCTGACCAGAGGACAGGGAGCTTGTGTGCCAGAACCTGCTGCCCCTGCTACATCTACCCTGTTTTCAAGTCAGCACGAGGAAGCTAAAGCTGCCGTGGTGAGCGCTGATGAGCTGTCTGAATCTCCTGAGATGACAGAGGAGCAGCTGCTGGATAGCTTTCACCTGATGGCCCCTTCTAGGGAGGACCAGCCAATCCTGTGGAACGCCATCTCTACCTACTCCAGCATGCGCGCCAGGGAGATCGCTGACCTGAAAAAGTGGAAGGAGCCATGTCAGAGGGAGCTGTACAAGGTGCTGGAAAGGTTAGCCGCTGCCCAGCAGAAGGCCGGCGATGAGATCTACAAGTTTTATCTGCCCAACTGCAACAAGAACGGCTTCTACCACTCCAAGCAGTGCGAGACAAGCCTGGATGGCGAGGCCGGGCTGTGTTGGTGCGTGTATCCTTGGTCTGGCAAGAAGATCCCTGGCTCTCTGGAAACCAGAGGCGACCCTAACTGCCACCAGTACTTCAACGTGCACAAC(SEQ ID NO:2)
[0071] IGFBP-1 DNA:
[0072]
[0073] IGFBP-1 ORF mRNA:
[0074] AUGCCCGAGUUUCUGACUGUGGUGUCUUGGCCUUUCCUGAUUCUGCUGAGCUUUCAGAUCGGCGUGGCUGCCGGAGCUCCUCAGCCUUGGCACUGUGCCCCUUGUACCGCUGAAAGGCUGGGUCUGUGUCCUCCUGUGCCAGCUUCUUGUCCUGAAAUUAGCAGACCAGCUGGAUGUGGAUGUUGCCCUACAUGUGCUCUCCCUAUGGGAGCUGCUUGUGGAGUGGCUACAGCAAGAUGUGCUCAGGGAUUAUCUUGUAGGGCUCUGCCUGGCGAGCCAAGGCCACUGCAUGCUCUGACCAGAGGACAGGGAGCUUGUGUGCCAGAACCUGCUGCCCCUGCUACAUCUACCCUGUUUUCAAGUCAGCACGAGGAAGCUAAAGCUGCCGUGGUGAGCGCUGAUGAGCUGUCUGAAUCUCCUGAGAUGACAGAGGAGCAGCUGCUGGAUAGCUUUCACCUGAUGGCCCCUUCUAGGGAGGACCAGCCAAUCCUGUGGAACGCCAUCUCUACCUACUCCAGCAUGCGCGCCAGGGAGAUCGCUGACCUGAAAAAGUGGAAGGAGCCAUGUCAGAGGGAGCUGUACAAGGUGCUGGAAAGGUUAGCCGCUGCCCAGCAGAAGGCCGGCGAUGAGAUCUACAAGUUUUAUCUGCCCAACUGCAACAAGAACGGCUUCUACCACUCCAAGCAGUGCGAGACAAGCCUGGAUGGCGAGGCCGGGCUGUGUUGGUGCGUGUAUCCUUGGUCUGGCAAGAAGAUCCCUGGCUCUCUGGAAACCAGAGGCGACCCUAACUGCCACCAGUACUUCAACGUGCACAAC (SEQ ID NO: 4)
[0075] Mutant IGFBP-1 S139A mRNA with serine at position 139 of mouse IGFBP-1 mutated to alanine:
[0076] AUGCCCGAGUUUCUGACUGUGGUGUCUUGGCCUUUCCUGAUUCUGCUGAGCUUUCAGAUCGGCGUGGCUGCCGGAGCUCCUCAGCCUUGGCACUGUGCCCCUUGUACCGCUGAAAGGCUGGGUCUGUGUCCUCCUGUGCCAGCUUCUUGUCCUGAAAUUAGCAGACCAGCUGGAUGUGGAUGUUGCCCUACAUGUGCUCUCCCUAUGGGAGCUGCUUGUGGAGUGGCUACAGCAAGAUGUGCUCAGGGAUUAUCUUGUAGGGCUCUGCCUGGCGAGCCAAGGCCACUGCAUGCUCUGACCAGAGGACAGGGAGCUUGUGUGCCAGAACCUGCUGCCCCUGCUACAUCUACCCUGUUUUCAAGUCAGCACGAGGAAGCUAAAGCUGCCGUGGUGAGCGCUGAUGAGCUGUCUGAAGCUCCUGAGAUGACAGAGGAGCAGCUGCUGGAUAGCUUUCACCUGAUGGCCCCUUCUAGGGAGGACCAGCCAAUCCUGUGGAACGCCAUCUCUACCUACUCCAGCAUGCGCGCCAGGGAGAUCGCUGACCUGAAAAAGUGGAAGGAGCCAUGUCAGAGGGAGCUGUACAAGGUGCUGGAAAGGUUAGCCGCUGCCCAGCAGAAGGCCGGCGAUGAGAUCUACAAGUUUUAUCUGCCCAACUGCAACAAGAACGGCUUCUACCACUCCAAGCAGUGCGAGACAAGCCUGGAUGGCGAGGCCGGGCUGUGUUGGUGCGUGUAUCCUUGGUCUGGCAAGAAGAUCCCUGGCUCUCUGGAAACCAGAGGCGACCCUAACUGCCACCAGUACUUCAACGUGCACAAC (SEQ ID NO: 5)
[0077] Appendix: Sequence List of IGFBP-1 mRNA Related Elements
[0078] name sequence SEQ ID NO: HA tag TACCCGTATGATGTGCCAGACTATGCA 6 T7 starter TAATACGACTCACTATAG 7 pcDNA3.1-T7-5'UTR-F CTTACGCCGTAATACGACTCACT 8 TL-3'UTR-100T-R TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTACTCAGGCTTTAT 9 5'UTR CTTACGCCGTAATACGACTCACTATAAGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC 10 3'UTR TAGGCGGCCGCTTAATTAAGCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG 11
[0079] While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.
Claims
1. A nucleic acid molecule, characterized in that, It contains a nucleic acid sequence encoding a CDS of insulin-like growth factor binding protein-1, as shown in SEQ ID NO:
2.
2. The nucleic acid molecule as described in claim 1, characterized in that, The nucleic acid molecule also contains one or more of the following sequences: (1) The encoding sequence of the 5'UTR, as shown in SEQ ID NO: 10; (2) The encoding sequence of the 3'UTR, as shown in SEQ ID NO: 11; Preferably, the nucleic acid molecule further comprises: (3) The coding sequence of the polyA tail, wherein the coding sequence of the polyA tail consists of 50-150 repeating thymines; preferably 100; More preferably, the nucleic acid molecule further comprises: (4) T7 promoter, wherein the preferred sequence of the T7 promoter is as shown in SEQ ID NO: 8; More preferably, the nucleic acid molecule further comprises: (5) HA tag, wherein the sequence of the HA tag is preferably as shown in SEQ ID NO:
6.
3. The nucleic acid molecule as described in claim 1 or 2, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO: 3; And / or, the nucleic acid molecule is a modified nucleic acid molecule, wherein the modification is selected from one or two of the following: (1) N1-methyl-pseudouridine (m1Ψ) modification, preferably, the modification is a partial or complete substitution; more preferably, the modification is that all UTPs in the nucleic acid molecule are replaced by N1-methyl-pseudouridine (m1Ψ); (2) EZcap with cap modifier.
4. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a nucleic acid molecule as described in any one of claims 1-3, and a pharmaceutically acceptable carrier and / or excipient.
5. The pharmaceutical composition according to claim 4, characterized in that, The carrier is a lipid nanoparticle, and the lipid nanoparticle comprises: The packaged lipids are cationic lipids (SM102), cholesterol, distearate phosphatidylcholine (DSPC), and polyethylene glycol-modified lipid molecules (DMG-PEG2000); preferably, the mass ratio of SM102:DSPC:cholesterol:PEG2000-DMG is (4.4~4.5):1:(1.8~1.9):(0.4~0.5).
6. The pharmaceutical composition according to claim 5, characterized in that, The volume ratio of the packaging lipid to the mRNA solution is 1:3, and / or the pharmaceutical composition is lipid nanoparticles, preferably lipid nanoparticles with a particle size of 90 nm ± 20 nm, such as lipid nanoparticles of 70 nm, 80 nm, 90 nm, 100 nm or 110 nm.
7. The pharmaceutical composition according to any one of claims 4 to 6, characterized in that, The drug composition is an intratumoral injection formulation.
8. The pharmaceutical composition according to any one of claims 4 to 7, characterized in that, The pharmaceutical composition also includes a tumor vaccine, such as a melanoma vaccine, as an active ingredient.
9. The use of the nucleic acid molecule as described in any one of claims 1 to 3 or the pharmaceutical composition as described in any one of claims 4 to 8 in the preparation of an antitumor drug.
10. The application as described in claim 9, characterized in that, The tumor is melanoma.