Application of VvHMG-Y protein and / or VvHMG-Y gene in prevention and / or treatment of grape downy mildew
By increasing the expression levels of VvHMG-Y protein and gene in grapes and activating VvLOR10 gene transcription, the problems of high cost and environmental pollution in grape downy mildew control have been solved, achieving the effect of enhancing grape resistance and reducing pathogen infection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2026-03-31
AI Technical Summary
Existing methods for controlling grape downy mildew are costly, harmful to the environment and health, and enhance the resistance of grape downy mildew to pesticides. There is an urgent need for economical and environmentally friendly control measures.
By increasing the expression levels of VvHMG-Y protein and/or VvHMG-Y gene in grapes, and using VvHMG-Y protein as an upstream transcription factor for the VvLOR10 gene to activate the transcription of the VvLOR10 gene, the resistance of grapes to grape downy mildew is enhanced. Recombinant expression plasmids and recombinant microorganisms are used for gene overexpression.
It enhances the resistance of grapes to downy mildew, inhibits downy mildew infection, reduces the number of pathogens and spores in grape leaves, and provides important application value for prevention and control.
Smart Images

Figure CN121759503A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of biotechnology and genetic engineering, and more specifically, to the application of the VvHMG-Y protein and / or the VvHMG-Y gene in the prevention and / or treatment of grape downy mildew. Background Technology
[0002] The causative agent of grape downy mildew, *Plasmopara viticola*, is a live obligate oomycete and one of the major diseases limiting grape cultivation in southern tropical regions. Rainfall is a significant factor influencing the spread of grape downy mildew. In Guangxi, April to August is the period of concentrated rainfall, with temperatures generally ranging from 20 to 28°C, which is suitable for the growth of *Plasmopara viticola*. Rain-sheltered cultivation can significantly reduce the damage caused by grape downy mildew. However, the disease can still occur during seasons with high humidity and heavy dew, and may even be more severe than under open-field conditions, resulting in a significant reduction in grape yield and quality.
[0003] Strengthening vineyard management, selecting disease-resistant varieties, and using chemical control methods are currently the main methods for controlling grape downy mildew. Among these, spraying chemical pesticides is one of the most common methods. However, in production, long-term and repeated spraying of chemical drugs not only results in high control costs and harms the ecological environment and human health, but also enhances the resistance of grape downy mildew to pesticides. Therefore, there is an urgent need for economical and environmentally friendly green control measures. Summary of the Invention
[0004] To address the aforementioned problems in the prior art, this invention provides the application of VvHMG-Y protein and / or VvHMG-Y gene in the prevention and / or treatment of grape downy mildew.
[0005] The first objective of this invention is to provide the use of the VvHMG-Y protein and / or the VvHMG-Y gene in the prevention and / or treatment of grape downy mildew.
[0006] A second objective of this invention is to provide the application of the VvHMG-Y protein and / or the VvHMG-Y gene in enhancing the resistance of grapes to grape downy mildew.
[0007] A third objective of this invention is to provide the use of biomaterials that increase the expression levels of VvHMG-Y protein and / or VvHMG-Y gene in the prevention and / or treatment of grape downy mildew.
[0008] A fourth objective of this invention is to provide the application of biomaterials that increase the expression levels of VvHMG-Y protein and / or VvHMG-Y gene in enhancing the resistance of grapes to grape downy mildew.
[0009] A fifth objective of this invention is to provide the use of biomaterials that enhance the expression of VvHMG-Y protein and / or VvHMG-Y gene in the preparation of products resistant to grape downy mildew.
[0010] A sixth object of the present invention is to provide the use of the VvHMG-Y protein and / or the VvHMG-Y gene in the prevention and / or treatment of diseases caused by Plasmopara viticola.
[0011] A seventh object of the present invention is to provide the use of biomaterials that increase the expression levels of VvHMG-Y protein and / or VvHMG-Y gene in the preparation of products resistant to diseases caused by Plasmopara viticola.
[0012] The eighth object of the present invention is to provide a method for resisting grape downy mildew by overexpressing the VvHMG-Y gene in grapes.
[0013] To achieve the above objectives, the present invention is implemented through the following solution:
[0014] This invention, by increasing the expression levels of VvHMG-Y protein and VvHMG-Y gene in grapes, determined that VvHMG-Y protein and VvHMG-Y gene can enhance the resistance of grapes to downy mildew, and determined that VvHMG-Y protein is an upstream transcription factor of VvLOR10 gene, which can activate the transcription of VvLOR10 gene.
[0015] The application of VvHMG-Y protein and / or VvHMG-Y gene in the prevention and / or treatment of grape downy mildew, to increase the expression level of the VvHMG-Y protein and / or VvHMG-Y gene in grapes.
[0016] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0017] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0018] Preferably, the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grape leaves are increased.
[0019] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0020] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0021] The application of VvHMG-Y protein and / or VvHMG-Y gene in enhancing grape resistance to downy mildew, thereby increasing the expression level of the VvHMG-Y protein and / or VvHMG-Y gene in grapes.
[0022] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0023] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0024] Preferably, the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grape leaves are increased.
[0025] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0026] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0027] Application of biological materials that enhance the expression of VvHMG-Y protein and / or VvHMG-Y gene in the prevention and / or treatment of grape downy mildew, thereby increasing the expression of the VvHMG-Y protein and / or VvHMG-Y gene in grapes.
[0028] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0029] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0030] Preferably, the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grape leaves are increased.
[0031] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0032] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0033] Preferably, the biomaterial is any one or more of the following (1) to (4):
[0034] (1) A recombinant expression plasmid expressing the VvHMG-Y protein;
[0035] (2) Expression cassette of a nucleic acid molecule containing the gene encoding the VvHMG-Y protein;
[0036] (3) A recombinant expression plasmid containing the nucleic acid molecules described in (2);
[0037] (4) Recombinant microorganisms containing the recombinant expression plasmid described in (3).
[0038] More preferably, the recombinant expression plasmid described in (1) uses pBWA(V)HS-GFP plasmid as its backbone.
[0039] More preferably, the recombinant expression plasmid described in (3) uses pBWA(V)HS-GFP plasmid as its backbone.
[0040] More preferably, the recombinant microorganism described in (4) is a recombinant strain.
[0041] More preferably, the recombinant strain is obtained by transforming the recombinant expression plasmid into Agrobacterium.
[0042] More preferably, the Agrobacterium is GV3101.
[0043] Application of biomaterials that enhance the expression levels of VvHMG-Y protein and / or VvHMG-Y gene in enhancing the resistance of grapes to downy mildew, thereby increasing the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grapes.
[0044] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0045] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0046] Preferably, the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grape leaves are increased.
[0047] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0048] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0049] Preferably, the biomaterial is any one or more of the following (1) to (4):
[0050] (1) A recombinant expression plasmid expressing the VvHMG-Y protein;
[0051] (2) Expression cassette of a nucleic acid molecule containing the gene encoding the VvHMG-Y protein;
[0052] (3) A recombinant expression plasmid containing the nucleic acid molecules described in (2);
[0053] (4) Recombinant microorganisms containing the recombinant expression plasmid described in (3).
[0054] More preferably, the recombinant expression plasmid described in (1) uses pBWA(V)HS-GFP plasmid as its backbone.
[0055] More preferably, the recombinant expression plasmid described in (3) uses pBWA(V)HS-GFP plasmid as its backbone.
[0056] More preferably, the recombinant microorganism described in (4) is a recombinant strain.
[0057] More preferably, the recombinant strain is obtained by transforming the recombinant expression plasmid into Agrobacterium.
[0058] More preferably, the Agrobacterium is GV3101.
[0059] Application of biomaterials that enhance the expression levels of VvHMG-Y protein and / or VvHMG-Y gene in the preparation of products resistant to grape downy mildew.
[0060] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0061] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0062] Preferably, the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grape leaves are increased.
[0063] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0064] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0065] Preferably, the biomaterial is any one or more of the following (1) to (4):
[0066] (1) A recombinant expression plasmid expressing the VvHMG-Y protein;
[0067] (2) Expression cassette of a nucleic acid molecule containing the gene encoding the VvHMG-Y protein;
[0068] (3) A recombinant expression plasmid containing the nucleic acid molecules described in (2);
[0069] (4) Recombinant microorganisms containing the recombinant expression plasmid described in (3).
[0070] More preferably, the recombinant expression plasmid described in (1) uses pBWA(V)HS-GFP plasmid as its backbone.
[0071] More preferably, the recombinant expression plasmid described in (3) uses pBWA(V)HS-GFP plasmid as its backbone.
[0072] More preferably, the recombinant microorganism described in (4) is a recombinant strain.
[0073] More preferably, the recombinant strain is obtained by transforming the recombinant expression plasmid into Agrobacterium.
[0074] More preferably, the Agrobacterium is GV3101.
[0075] Application of VvHMG-Y protein and / or VvHMG-Y gene in the prevention and / or treatment of diseases caused by Plasmopara viticola.
[0076] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0077] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0078] Preferably, the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grape leaves are increased.
[0079] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0080] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0081] Preferably, the biomaterial is any one or more of the following (1) to (4):
[0082] (1) A recombinant expression plasmid expressing the VvHMG-Y protein;
[0083] (2) Expression cassette of a nucleic acid molecule containing the gene encoding the VvHMG-Y protein;
[0084] (3) A recombinant expression plasmid containing the nucleic acid molecules described in (2);
[0085] (4) Recombinant microorganisms containing the recombinant expression plasmid described in (3).
[0086] More preferably, the recombinant expression plasmid described in (1) uses pBWA(V)HS-GFP plasmid as its backbone.
[0087] More preferably, the recombinant expression plasmid described in (3) uses pBWA(V)HS-GFP plasmid as its backbone.
[0088] More preferably, the recombinant microorganism described in (4) is a recombinant strain.
[0089] More preferably, the recombinant strain is obtained by transforming the recombinant expression plasmid into Agrobacterium.
[0090] More preferably, the Agrobacterium is GV3101.
[0091] Application of biomaterials that enhance the expression of VvHMG-Y protein and / or VvHMG-Y gene in the preparation of products resistant to diseases caused by Plasmopara viticola.
[0092] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0093] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0094] Preferably, the expression levels of the VvHMG-Y protein and / or VvHMG-Y gene in grape leaves are increased.
[0095] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0096] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0097] Preferably, the biomaterial is any one or more of the following (1) to (4):
[0098] (1) A recombinant expression plasmid expressing the VvHMG-Y protein;
[0099] (2) Expression cassette of a nucleic acid molecule containing the gene encoding the VvHMG-Y protein;
[0100] (3) A recombinant expression plasmid containing the nucleic acid molecules described in (2);
[0101] (4) Recombinant microorganisms containing the recombinant expression plasmid described in (3).
[0102] More preferably, the recombinant expression plasmid described in (1) uses pBWA(V)HS-GFP plasmid as its backbone.
[0103] More preferably, the recombinant expression plasmid described in (3) uses pBWA(V)HS-GFP plasmid as its backbone.
[0104] More preferably, the recombinant microorganism described in (4) is a recombinant strain.
[0105] More preferably, the recombinant strain is obtained by transforming the recombinant expression plasmid into Agrobacterium.
[0106] More preferably, the Agrobacterium is GV3101.
[0107] A method for combating grape downy mildew involves overexpressing the VvHMG-Y gene in grapes.
[0108] Preferably, the nucleotide sequence of the VvHMG-Y gene is as shown in SEQ ID NO.1 or as a completely complementary sequence to the sequence shown in SEQ ID NO.1.
[0109] Preferably, the amino acid sequence of the VvHMG-Y protein is shown in SEQ ID NO.2.
[0110] Preferably, the VvHMG-Y gene is overexpressed in grape leaves.
[0111] Preferably, the grapes are Thompson Seedless White grapes, with the Latin name Vitis vinifera cv. 'Thompson Seedless'.
[0112] Preferably, the downy mildew strain of grape downy mildew is Pv5-27, which is the "grape downy mildew Pv5-27" in the prior art "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene of grape downy mildew [J]. Chinese Agricultural Science, 2023, 56(05): 879-891."
[0113] Preferably, the biomaterial is any one or more of the following (1) to (4):
[0114] (1) A recombinant expression plasmid expressing the VvHMG-Y protein;
[0115] (2) Expression cassette of a nucleic acid molecule containing the gene encoding the VvHMG-Y protein;
[0116] (3) A recombinant expression plasmid containing the nucleic acid molecules described in (2);
[0117] (4) Recombinant microorganisms containing the recombinant expression plasmid described in (3).
[0118] More preferably, the recombinant expression plasmid described in (1) uses pBWA(V)HS-GFP plasmid as its backbone.
[0119] More preferably, the recombinant expression plasmid described in (3) uses pBWA(V)HS-GFP plasmid as its backbone.
[0120] More preferably, the recombinant microorganism described in (4) is a recombinant strain.
[0121] More preferably, the recombinant strain is obtained by transforming the recombinant expression plasmid into Agrobacterium.
[0122] More preferably, the Agrobacterium is GV3101.
[0123] Compared with the prior art, the present invention has the following beneficial effects:
[0124] This invention enhances the resistance of grapes to downy mildew by increasing the expression of VvHMG-Y protein and / or VvHMG-Y gene in grapes, inhibits downy mildew infection, and reduces the number of pathogens and spores in grape leaves. It has important practical application and promotion value in the prevention and control of grape downy mildew. Attached Figure Description
[0125] Figure 1 This is a plasmid map of pBWA(V)HS-VvHMG-Y-GFP.
[0126] Figure 2 The results of PCR identification of 5 positive clones of pBWA(V)HS-VvHMG-Y-GFP are shown. Lanes 1 to 5 represent the bacterial culture samples of the 5 positive clones, respectively.
[0127] Figure 3 Results of subcellular localization analysis of VvHMG-Y protein.
[0128] Figure 4 The results of transient overexpression of VvHMG-Y on resistance to grape downy mildew are shown in the figure; where A is the symptom observation after transient expression of VvHMG-Y in grape leaves; B is the statistical result of the number of grape downy mildew spores; and C is the result of qPCR detection of VvHMG-Y expression level.
[0129] Figure 5 The plasmid map of pGreenII-62sk-VvHMG-Y.
[0130] Figure 6 The plasmid map of pGreenII-0800-LUC-proVvLOR10.
[0131] Figure 7 Image A shows the identification of recombinant plasmid by enzyme digestion; Image B shows the identification of pGreenII-62sk-VvHMG-Y by NcoI and HindIII digestion; Image C shows the identification of pGreenII-0800-LUC-proVvLOR10 by KpnI and EcoRI digestion.
[0132] Figure 8 The figure shows the results of the dual-luciferase experiment with VvHMG-Y and proVvLOR10.
[0133] Figure 9 The plasmid map of pGEX-6p-1-VvHMG-Y.
[0134] Figure 10 The results of PCR identification of 5 positive clones of pGEX-6p-1-VvHMG-Y are shown. Lanes 1 to 5 represent the bacterial culture samples of the 5 positive clones, respectively.
[0135] Figure 11 Results of low-level expression assay for GST-VvHMG-Y protein.
[0136] Figure 12 The results of GST-VvHMG-Y protein purification.
[0137] Figure 13 Figure 1 shows the gel migration results of the interaction between VvHMG-Y and proVvLOR10.
[0138] Figure 14 The results show the expression levels of VvHMG-Y and VvLOR10 after transient expression of VvHMG-Y in grape leaves. Detailed Implementation
[0139] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0140] Example 1: Construction and transformation of VvHMG-Y overexpression plasmid
[0141] 1. Construction of VvHMG-Y overexpression plasmid
[0142] Using pBWA(V)HS-GFP subcellular localization plasmid as a backbone, the following was constructed: Figure 1 The specific steps for using the pBWA(V)HS-VvHMG-Y-GFP plasmid shown are as follows:
[0143] (1) Amplification of the target fragment
[0144] Using cDNA from the grape variety 'Thompson Seedless' as a template, the VvHMG-Y gene (SEQ ID NO.1) was amplified using primers pBWA(V)HS-VvHMG-Y-GFP-F and pBWA(V)HS-VvHMG-Y-GFP-R. Protective bases and an Eco31I restriction endonuclease recognition site (GGTCTC) were introduced to obtain amplification product 1 (i.e., a fragment of the VvHMG-Y gene (SEQ ID NO.1) with the pBWA(V)HS-GFP plasmid adapter). The primer sequences are as follows:
[0145] The upstream primer of the VvHMG-Y gene (pBWA(V)HS-VvHMG-Y-GFP-F): 5'-CAGT GGTCTC ACAACATGGACCCAGCACCACCC-3', the underlined part is the Eco31I restriction endonuclease recognition site;
[0146] The downstream primer of the VvHMG-Y gene (pBWA(V)HS-VvHMG-Y-GFP-R): 5'-CAGT GGTCTC ATACAATTTCCAAAGAACAGCTGACC-3', the underlined part is the Eco31I restriction endonuclease recognition site.
[0147] (2) Connection reaction
[0148] The amplification product 1 obtained in the previous step was ligated into the pBWA(V)HS-GFP plasmid, and the reaction system is shown in Table 1.
[0149] Table 1 Connection Reaction System
[0150]
[0151] After the above system is mixed evenly, it is immediately placed in a PCR instrument and incubated at 37°C for 30 min; then the reaction is terminated by heating at 65°C for 20 min to obtain the ligation product, which is then transferred to ice for later use.
[0152] (3) Transformation reaction
[0153] Add 10 μL of the ligation product to 100 μL of DH5α competent cells, incubate on ice for 30 min, then heat shock in a 42℃ water bath for 90 s, and after heat shock, place in ice bath for 2 min; add 500 μL of antibiotic-free LB medium, and culture at 37℃ and 200 rpm for 60 min; centrifuge at 12000 rpm / min for 1 min, discard the supernatant, retain the precipitate (bacterial cells), and resuspend the bacterial cells in 100 μL of fresh LB medium; spread 100 μL of the bacterial culture onto a kanamycin-resistant plate, and incubate the plate upside down in a 37℃ incubator overnight.
[0154] (4) Colony identification
[0155] After the bacterial colonies have grown, five single colonies are selected for identification by bacterial culture PCR. The primer sequences for identification are as follows:
[0156] Upstream primer for colony identification: 5'-TTCCAGGGGCCCCTGGGATC-3'
[0157] Downstream primer for colony identification: 5'-TCAATTTCCAAAGAACAGCT-3'.
[0158] The results are as follows Figure 2 As shown, the target bands of the five positive clones in lanes 1-5 were of the correct size and bright. Then, the positive clone with the correct target band size and the brightest was selected for sequencing confirmation. The sequencing results showed that the VvHMG-Y gene (SEQ ID NO.1) fragment in the plasmid of the positive clone was consistent with the expected sequence, indicating that the VvHMG-Y overexpression plasmid was successfully constructed, denoted as pBWA(V)HS-VvHMG-Y-GFP plasmid.
[0159] 2. Transformation of Agrobacterium
[0160] The empty plasmid (pBWA(V)HS-GFP plasmid) or the VvHMG-Y overexpression plasmid (pBWA(V)HS-VvHMG-Y-GFP plasmid) was transformed into Agrobacterium (GV3101) and cultured at 30℃ for 2 days. Single colonies were inoculated into 10 mL of the corresponding resistant YEP liquid medium and cultured at 28℃ and 170 rpm / min for 1 h on a shaker. The bacterial culture was centrifuged at 4000 rpm / min for 4 min, the supernatant was discarded, and the precipitate (bacterial cells) was retained. Thus, Agrobacterium with the empty plasmid (denoted as 35S::GFP-GV3101) and Agrobacterium with the VvHMG-Y overexpression plasmid (denoted as 35S::VvHMG-Y::GFP-GV3101) were obtained respectively.
[0161] Example 2: Subcellular localization of VvHMG-Y
[0162] 1. Instantaneous transformation of tobacco leaves by Agrobacterium
[0163] (1) Cultivation of the tested tobacco
[0164] The tobacco used in the experiment was Nicotiana benthamiana, which was preserved in the laboratory of the inventor's research group. The tobacco seeds were sown in plastic pots with a diameter of 7 cm. The soil substrate was a 1:1 mixture of nutrient soil and vermiculite. The pots were cultured in a 25°C light incubator for 10 days, then transplanted individually and cultured for another 3 weeks before being used in the experiment.
[0165] (2) Preparation of injection solution
[0166] Following the method for transforming Agrobacterium in Example 1, the marker plasmid used for labeling nuclear localization, namely pBWA(V)HS-NLS-mkate plasmid, was transformed into Agrobacterium (GV3101) to obtain Agrobacterium carrying a nuclear marker, denoted as Nuclear Marker-GV3101.
[0167] Specifically, the GFP gene between the CaMV 35S promoter and NOS in the pBWA(V)HS-GFP plasmid was recombined into an nls-mkate fusion protein editing gene to obtain the pBWA(V)HS-NLS-mkate plasmid. NLS is a nuclear localization signal protein with the amino acid sequence: MDPKKKRKV; mkate is a fusion fluorescent protein with excitation at 561 nm and emission at 580 nm, and its coding sequence is as follows:
[0168] ATGGTGAGCGAGCTGATTAAGGAGAACATGCACATGAAGCTGTACATGGAGGGCACCG
[0169] TGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCA
[0170] CCCAGACCATGAGAATCAAGGCGGTCGAGGGCGGCCCTCTCCCCTTCGCTTCGACAT
[0171] CCTGGCTACCAGCTTCATGTACGGCAGCAAAACCTTCATCAACCACACCCAGGGCATC
[0172] CCCGACTTCTTTAAGCAGTCCTTCCCCGAGGGCTTCACATGGGAGAGAGTCACCACAT
[0173] ACGAAGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCC
[0174] TCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCA
[0175] GAAGAAAACACTCGGCTGGGAGGCCTCCACCGAGACCCTGTACCCCGCTGACGGCGG
[0176] CCTGGAAGGCAGAGCCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTG
[0177] CAACTTGAAGACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGG
[0178] CGTCTACTATGTGGACAGAAGACTGGAAAGAATCAAGGAGGCCGACAAAGAGACCTA
[0179] CGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAGA.
[0180] After resuspending Marker-GV3101 and 35S::GFP-GV3101 and 35S::VvHMG-Y::GFP-GV3101 prepared in Example 1 in 10mM MgCl2 (containing 120μM acetylsylcholine) suspension, the OD600 of each bacterial suspension was adjusted to 0.6.
[0181] Next, the bacterial culture of Marker-GV3101 and the bacterial culture of 35S::GFP-GV3101 were mixed at a volume ratio of 1:1 to obtain injection solution 1, and the bacterial culture of cell nuclear Marker-GV3101 and the bacterial culture of 35S::VvHMG-Y::GFP-GV3101 were mixed at a volume ratio of 1:1 to obtain injection solution 2.
[0182] (3) Injection of tobacco leaves
[0183] Using a 1mL syringe, draw 1mL of injection solution 1 and 1mL of injection solution 2 respectively. Select tobacco seedlings that have been cultured for one month, inject them into the lower epidermis of the tobacco leaves, and label them accordingly. Incubate the injected tobacco plants under 4000LX light for 2 days, and then collect the tobacco leaves.
[0184] 2. Identification using laser confocal microscopy
[0185] Collected tobacco leaves were prepared into slides, and the subcellular localization of VvHMG-Y protein was observed and photographed under a laser confocal microscope. GFP green fluorescent signal labeled VvHMG-Y protein, mkate red fluorescent signal labeled cell nucleus, and purple-red fluorescent signal was autofluorescence of chloroplasts.
[0186] like Figure 3 As shown, a significant GFP fluorescence signal was observed in the nuclei of tobacco leaf mesophyll cells transformed with the VvHMG-Y overexpression plasmid, and this signal overlapped with the mkate fluorescence signal (a nuclear marker). This indicates that the VvHMG-Y protein is localized in the nuclei of tobacco leaf mesophyll cells.
[0187] Example 3: Effect of transient overexpression of VvHMG-Y on resistance to *Peronospora spp.*
[0188] 1. Activation and inoculation of *Peronomyces cerevisiae*
[0189] The *Vitis vinifera* strain Pv5-27 (i.e., *Vitis vinifera* Pv5-27 in the existing technology "Pan Fengying, Qu Junjie, Liu Lulu, et al. Expression pattern and functional analysis of glycosyl hydrolase gene in *Vitis vinifera* [J]. Chinese Agricultural Science, 2023, 56(05): 879-891.") was inoculated onto the tender leaves of one-year-old potted *Vitis vinifera* (Latin name *Vitis vinifera* cv. 'Cabernet Sauvignon') seedlings to activate *Vitis vinifera*. The specific steps are as follows: The tender leaves were placed in a petri dish with moistened filter paper, and 30 μL of *Vitis vinifera* Pv5-27 spore suspension was dropped onto each grape leaf plate. The spore concentration was 1×10⁻⁶. 5 The inoculum concentration was 5 mL, and the petri dishes were sealed with sealing film. After incubation at 25°C for 7 days, the activated *Peronomyces boulardii* strain Pv5-27 was collected and diluted with sterile water to obtain a spore concentration of 1×10⁻⁶. 5 Prepare a spore suspension of 1 spore per mL for later use.
[0190] 2. Instantaneous rotation of grape leaves
[0191] "Thompson nucleus-free white blood cells (Latin name: Vitis vinifera cv.'Thompson)" were cultured in a light-incubated culture room for 5 weeks. Aseptic seedlings of "Seedless" were transplanted into 10cm diameter plastic pots. The soil substrate was a mixture of nutrient soil and vermiculite in a 2:1 ratio. The seedlings were hardened off in a 25℃ light-cured culture room. After 6 weeks of cultivation, tender, fully expanded leaves were selected and vacuumed using a vacuum circulation pump. 30mL of bacterial suspensions of 35S::GFP-GV3101 and 35S::VvHMG-Y::GFP-GV3101 (OD600 adjusted to 0.6) prepared in Example 1 were used to penetrate the leaves. Vacuuming was continued until a boiling-like phenomenon appeared on the liquid surface (a large number of bubbles were expelled from the leaves or the leaf surface). Vacuuming was stopped and maintained for 5 minutes. The gas was released, and this process was repeated 3 times. After the gas was released, the leaves were observed to be transparent, which indicated that the transient transformation was successful. The two treatment groups were designated as the control group (GFP) and the overexpression group (VvHMG-Y-GFP), respectively.
[0192] 3. Determination of the number of downy mildew spores
[0193] Five days after transient transformation, grape leaves from both the control and overexpression groups were perforated to form 1.5 cm leaf discs. One drop of 30 μL of *Peronobacterium spore suspension* Pv5-27 was added to each leaf disc, and the discs were then placed in petri dishes lined with moistened filter paper (sealed with film) and incubated at 25°C for 7 days. The number of *Peronobacterium spores* on the transiently transformed grape leaves was photographed and counted, with three replicates for each group.
[0194] 4. Detect the expression level of VvHMG-Y
[0195] The expression level of VvHMG-Y in the control group (GFP) and the overexpression group (VvHMG-Y-GFP) was detected by real-time quantitative PCR (qPCR). Total RNA was extracted from treated Thomson leucosus leaves using the Spectrum Plant Total RNA Kit (Sigma). RNA quality and concentration were determined by 1% agarose gel electrophoresis, and the concentration was measured using a NanoDrop 2000 spectrophotometer. Then, total RNA was reverse transcribed into cDNA using reverse transcriptase (RT). The reverse transcription reaction system is shown in Table 2.
[0196] Table 2 Reverse Transcription Reaction System
[0197]
[0198]
[0199] Prepare the qPCR reaction system according to the instructions for the real-time quantitative PCR detection kit (LightCycler 480SY Green Master-Roche), place it in the real-time quantitative PCR instrument, and run 40 cycles. The specific qPCR primer sequences are as follows:
[0200] The upstream primer of the VvHMG-Y gene (VvHMG-Y-qPCR-F): 5'-TCAAACTGTCTGTCGGTGTGC-3';
[0201] The downstream primer of the VvHMG-Y gene (VvHMG-Y-qPCR-R): 5'-GACCTTCGATATTTAGTGGCGC-3';
[0202] The upstream primer of the internal reference gene VvEF1-α (VvEF1-α-qPCR-F): 5'-GCAGGGTTTGTTAAGATGAT-3';
[0203] Downstream primer of the internal reference gene VvEF1-α (VvEF1-α-qPCR-R): 5'-TCCACGCTCTTGATGACTCC-3'.
[0204] The qPCR reaction system is shown in Table 3.
[0205] Table 3 qPCR reaction system
[0206]
[0207] Experimental data use 2 -ΔΔCT The method was used to quantitatively analyze relative gene expression.
[0208] 4. Test Results
[0209] like Figure 4 As shown in Figures A through C, 5 days after transient transformation, the expression level of VvHMG-Y in grape leaves of the overexpression group was significantly increased compared to the control group. Furthermore, 3 days after inoculation of grape leaves with *Peronobacterium tumefaciens* Pv5-27, the number of pathogens and spores in the grape leaves of the overexpression group was lower. This indicates that overexpression of VvHMG-Y can enhance the resistance of grapes to *Peronobacterium tumefaciens* and inhibit *Peronobacterium tumefaciens* infection.
[0210] Example 4: Interaction between VvHMG-Y and proVvLOR10
[0211] 1. Determination of the interaction between VvLOR10 and VvHMG-Y proteins
[0212] The VvHMG-Y protein was identified as a candidate upstream transcription factor for the VvLOR10 gene using a yeast one-hybrid assay. The interaction between the promoter of the VvLOR10 gene (denoted as proVvLOR10, SEQ ID NO.3) and the VvHMG-Y protein was further determined using dual-luciferase assay and gel migration assay (EMSA).
[0213] (1) Plasmid construction
[0214] The pGreenII-0800-LUC plasmid was used as a backbone to construct the following... Figure 6 The specific steps for using the pGreenII-0800-LUC-proVvLOR10 plasmid shown are as follows:
[0215] S1. Amplification of the target fragment
[0216] Using cDNA from the grape variety "Thompson Seedless" as a template, the VvHMG-Y gene (SEQ ID NO.1) was amplified using primers pGreenII-62sk-VvHMG-YF and pGreenII-62sk-VvHMG-YR. Homologous arm sequences were then introduced to obtain amplification product 2 (i.e., a fragment of the VvHMG-Y gene (SEQ ID NO.1) containing homologous arm sequences). The specific primer sequences are as follows:
[0217] The upstream primer for the VvHMG-Y gene (pGreenII-62sk-VvHMG-YF): 5'- CATTTGGAGAGGACAGCC CACCACC ATGGACCCAGCACCACCCC-3', the underlined part is the homologous arm sequence;
[0218] Downstream primer for the VvHMG-Y gene (pGreenII-62sk-VvHMG-YR): 5'- TAGAGAGAGACTGGTGAT TTCAGCG TCAATTTCCAAAGAACAGCTGACCTTCGATAT TTAGTGG-3', where the underlined part is the homologous arm sequence.
[0219] The sequence of the VvLOR10 promoter (proVvLOR10) was found using NCBI. Then, the proVvLOR10 gene fragment (SEQ ID NO.3) was obtained through gene synthesis. Using this fragment as a template, the proVvLOR10 (SEQ ID NO.3) fragment was amplified using primers pGreenII-0800-LUC-proVvLOR10-F and pGreenII-0800-LUC-proVvLOR10-R. Homologous arm sequences were then introduced to obtain amplification product 3 (i.e., the proVvLOR10 (SEQ ID NO.3) fragment with homologous arm sequences). The specific primer sequences are as follows:
[0220] The specific primer sequences are as follows:
[0221] The upstream primer for the proVvLOR10 sequence (pGreenII-0800-LUC-proVvLOR10-F): 5'- CCCCTCGA GGTCGACGGTATCGATA TGCATGAGTTGTAAAATTCAAAAAAATAATAA CAAAAAGAA-3', where the underlined part is the homologous arm sequence;
[0222] Downstream primer for the proVvLOR10 sequence (pGreenII-0800-LUC-proVvLOR10-R): 5'- TTTTGGCG TCTTCCATGGTCCCCCG CTTGAGTCTTGTCTGCTGGGCG-3', the underlined part is the homologous arm sequence.
[0223] S2. Enzyme digestion and ligation
[0224] Linearized plasmids were obtained by digesting pGreenII-62sk and pGreenII-0800-LUC plasmids with restriction enzymes BsaI and Eco31I. The digestion system is shown in Table 2.
[0225] Table 4 Enzyme digestion system
[0226]
[0227] After the above system was thoroughly mixed, it was immediately incubated in a PCR instrument at 37°C for 60 min; then the reaction was terminated by heating at 65°C for 20 min, and the product was transferred to ice for later use. The enzyme digestion products were purified using a PCR purification kit (Axygen DNA Gel Recovery Kit; Axygen.AP-GX-250) to obtain linearized pGreenII-62sk and linearized pGreenII-0800-LUC plasmids. Using Biorun 2*EasyClone Mix, amplification product 2 was ligated to the linearized pGreenII-62sk plasmid to obtain pGreenII-62sk-VvHMG-Y plasmid, and amplification product 3 was ligated to the linearized pGreenII-0800-LUC plasmid to obtain pGreenII-0800-LUC-proVvLOR10 plasmid. The ligation reaction procedure was as follows: incubation at 37°C for 30 min; then heating at 65°C for 20 min to terminate the reaction, and the product was transferred to ice for later use.
[0228] S3. Transformation
[0229] Following the transformation reaction in Example 1, pGreenII-62sk-VvHMG-Y plasmid and pGreenII-0800-LUC-proVvLOR10 plasmid were transformed into DH5α competent cells, respectively.
[0230] S4. Identification
[0231] Because the recognition and cleavage sites of the restriction enzymes BsaI and Eco31I were not in their initial positions after the target fragment was ligated into each plasmid, the pGreenII-62sk-VvHMG-Y plasmid was digested with restriction enzymes NcoI and HindIII, and the pGreenII-0800-LUC-proVvLOR10 plasmid was digested with KpnI and EcoRI. The enzyme digestion identification results are as follows. Figure 7 As shown in A and B, the two restriction enzyme bands of pGreenII-62sk-VvHMG-Y are 782bp and 3506bp in size, and the two restriction enzyme bands of pGreenII-0800-LUC-proVvLOR10 are 2724bp and 4614bp in size. The size of each restriction enzyme band is as expected, indicating that the two recombinant plasmids were successfully constructed.
[0232] (2) Dual-luciferase assay
[0233] S1. Co-transfection of Arabidopsis protoplasts
[0234] 10 μL of pGreenII-62sk-VvHMG-Y plasmid and pGreenII-0800-LUC-proVvLOR10 plasmid (purified plasmids of 500 ng or more) were added to Arabidopsis protoplasts via PEG-mediated incubation. The protoplasts were cultured in complete darkness at 28°C for 18–24 h, centrifuged at 300 rpm for 3 min to collect the protoplasts, resuspended in 100 μL of 1×Cell Lysis Buffer, and lysed at 25°C by static incubation or vortexing for 5 min. All the liquid (i.e., cell lysis products) was pipetted and aspirated into a 1.5 mL centrifuge tube, centrifuged at 10000 rpm for 2 min at 25°C, and the supernatant was used for subsequent detection.
[0235] S2. Luminescence detection
[0236] Add 100 μL of Luciferase Substrate, warmed to 25°C, to a detection tube or microplate. Then carefully pipette 20 μL of the supernatant from the cell lysis products into the wells of the detection tube or microplate. Mix quickly by pipetting and immediately place the tube or plate in a luminometer or microplate reader to detect Firefly luciferase reporter gene activity. Next, add 100 μL of freshly prepared Renilla substrate working solution, mix quickly by pipetting and immediately place the tube or plate in a luminometer or microplate reader to detect Renilla luciferase reporter gene activity. Perform each assay in triplicate.
[0237] like Figure 8 As shown, transient overexpression of VvHMG-Y can increase the activity of the reporter gene VvLOR10, indicating that VvHMG-Y interacts with the VvLOR10 promoter and can enhance the transcriptional activation activity of the VvLOR10 promoter.
[0238] (3) Gel migration assay (EMSA)
[0239] Construction of S1.GST-VvHMG-Y purified protein expression plasmid
[0240] Using the pGEX-6p-1 plasmid expressing the protein tag GST as a backbone, the following was constructed: Figure 9The pGEX-6p-1-VvHMG-Y plasmid shown has the following GST coding sequence: 5'-ATGTCCCCTATACTAGGTTATTGGAAAATTAAGGGCCTTGTGCAACCCACTCGACTTC -3'.
[0241] The specific steps for constructing the GST-VvHMG-Y purified protein expression plasmid are as follows:
[0242] Using pGreenII-62sk-VvHMG-Y plasmid as a template, the VvHMG-Y sequence (SEQ ID NO.1) was amplified using primers pGEX-6p-1-VvHMG-YF and pGEX-6p-1-VvHMG-YR, and homologous arm sequences were introduced to obtain the amplification product. The specific primer sequences are as follows:
[0243] The upstream primer for the VvHMG-Y gene (pGEX-6p-1-VvHMG-YF): 5'- TTCCAGGGGCCCCTGGGATCATGGACCCAGCACCACCCCC-3', the underlined part is the homologous arm sequence;
[0244] The downstream primer for the VvHMG-Y gene (pGEX-6p-1-VvHMG-YR): 5'- TGAATTTTACAACTCATGCA TCAATTTCCAAAGAACAGCT-3', the underlined part is the homologous arm sequence.
[0245] S2. Enzyme digestion and ligation
[0246] Following the S2 restriction enzyme digestion and ligation method for plasmid construction in this embodiment, the pGEX-6p-1 plasmid was digested and ligated using restriction enzymes BamHI and SmaI.
[0247] S3. Transformation
[0248] The plasmid was transformed according to the S3 transformation method described in this embodiment.
[0249] S4. Identification
[0250] After the bacterial colonies grew, five single colonies were selected and subjected to PCR identification using the upstream and downstream primers for colony identification from Example 1. The results are as follows. Figure 10 As shown, the target bands of the five positive clones in lanes 1-5 were of the correct size and bright. Then, the positive clone with the correct target band size and the brightest was selected for sequencing confirmation. The sequencing results showed that the VvHMG-Y fragment sequence in the plasmid of this positive clone was consistent with the expected sequence, indicating that the GST-VvHMG-Y purified protein expression plasmid was successfully constructed, and it was denoted as pGEX-6p-1-VvHMG-Y plasmid.
[0251] S5. Protein Low-Level Expression Assay
[0252] The pGEX-6p-1-VvHMG-Y plasmid was transformed into the expression strain *Escherichia coli* BL21 to obtain the BL21 strain expressing the GST-VvHMG-Y protein (denoted as GST-VvHMG-Y-BL21). The strain was then inoculated into 8 mL of LB medium and cultured until the OD600 reached 0.6. At this point, 1 mL of bacterial culture was collected for later use (labeled as the pre-induction group). 0.2 mM, 0.5 mM, or 1 mM IPTG (isopropyl-β-D-thiogalactoside) were added to the remaining bacterial culture, and expression was induced at 12°C for 24 h. The bacterial cells were collected by centrifugation, and each gram of bacterial cells was resuspended in 10 mL of lysis buffer (Lysis buffer: 150 mM NaCl, 50 mM Tris-HCl, pH 8.0, 10% Glycerol). The cells were then sonicated to collect the supernatant and precipitate, and the precipitate was resuspended in the same volume of lysis buffer as the supernatant. Take 30 μL of each sample (supernatant or precipitate after IPTG induction treatment with 0.2 mM, 0.5 mM, or 1 mM), add 10 μL of SDS Sample Buffer (4x), mix well, boil at 100℃ for 10 min, load the samples, and perform SDS-PAGE detection. The results are as follows: Figure 11 As shown, the expression level of GST-VvHMG-Y protein in the supernatant was highest when induced for 24 h at 12℃ and 1mM IPTG (isopropyl-β-D-thiogalactopyranoside).
[0253] Following the same method, the pGEX-6p-1 plasmid expressing the GST protein tag was transformed into BL21 to obtain the BL21 strain expressing the GST tag protein (denoted as GST-BL21), and the expression of the GST tag protein was induced.
[0254] S6. Protein Purification
[0255] GST-VvHMG-Y-BL21 was inoculated into LB medium and cultured until OD600 reached 0.6. 1 mM IPTG was added, and expression was induced at 12°C for 24 h. Cells were collected by centrifugation. 5 mL of lysis buffer was added to each gram of cells, and the cells were resuspended and sonicated. Cell lysates were collected and filtered. The filtered cell lysates were incubated with GST-tagged protein purification resin (Solepro, P2020) at 4°C for 3 h. The resin was collected, and eluted with elution buffers 1–9 (20 mM reduced glutathione GSH), collecting eluents 1–9. 30 μL of each sample (cell lysate, cell lysate supernatant, flowthrough, and eluents 1–9) were added, and 10 μL of SDS Sample Buffer (4x) was added. The mixture was boiled for 10 min, centrifuged, and loaded onto the sample for SDS-PAGE analysis. Results are shown below. Figure 12 As shown, the GST-VvHMG-Y protein was successfully purified.
[0256] S7. Probe Preparation
[0257] Based on the fragments in the VvLOR10 promoter region that VvHMG-Y is expected to bind to, which contain A / T enriched regions, a DNA double-strand detection probe was designed to analyze the binding of VvHMG-Y to the A / T enriched regions of the VvLOR10 promoter.
[0258] Using Plant CARE (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) to predict the cis-acting element of proVvLOR10, and designing a truncated proVvLOR10 based on the "AT-TATA-box" motif, the primer sequences for synthesizing the DNA double-strand detection probe are as follows:
[0259] The upstream primer of the VvLOR10prof1 probe (VvLOR10prof1-F): 5'-ATTATATAAGGCATTTTAATTACTC-3';
[0260] The downstream primer of the VvLOR10prof1 probe (VvLOR10prof1-R): 5'-GAGTAATTAAAATGCCTTATATAAT-3'.
[0261] The upstream primer of the VvLOR10prof2 probe (VvLOR10prof2-F): 5'-TTGAAGTATTTTATTACAGCATATAATTAATTAACTATATAAAA-3';
[0262] The downstream primer of the VvLOR10prof2 probe (VvLOR10prof2-R): 5'-TTTTATATAGTTAATTAATTATATGCTGTAATAAAATACTTCAA-3'.
[0263] The VvLOR10pro f1 and VvLOR10pro f2 probes are also labeled with biotin, while the unlabeled VvLOR10pro f2 probe acts as a competitive binding probe against the biotin-labeled VvLOR10pro f2 probe, denoted as Competitor f2. Furthermore, a mutant probe f2-1 (denoted as Mut) of the VvLOR10pro f2 probe was designed.
[0264] The primer sequences for the mutant probe f2-1 (denoted as Mut-VvLOR10prof2-1) and the mutant probe f2-2 (denoted as Mut-VvLOR10prof2-2) are as follows:
[0265] The upstream primer of the Mut-VvLOR10prof2-1 probe (Mut-VvLOR10prof2-1-F): 5'-TTGAA TCCAG GCCGG TACAGCATATAATTAATTAACTATATAAAA-3', the underlined part is the mutation site;
[0266] Downstream primer of the Mut-VvLOR10prof2-1 probe (Mut-VvLOR10prof2-1-R)
[0267] 5'-TTTTATATAGTTAATTAATTATATGCTGTAATAAAATACTTCAA-3'.
[0268] The upstream primer of the Mut-VvLOR10prof2-2 probe (Mut-VvLOR10prof2-2-F): 5'-TTGAAGTATTTTATTACAGCATATAATTAATTAAC GGGCCC AAA-3', the underlined part is the mutation site;
[0269] The downstream primer of the Mut-VvLOR10prof2-2 probe (Mut-VvLOR10prof2-2-R): 5'-TTTTATATAGTTAATTAATTATATGCTGTAATAAAATACTTCAA-3'.
[0270] Probes VvLOR10pro f1, VvLOR10pro f2, Competitor f2, Mut-VvLOR10prof2-1, and Mut-VvLOR10prof2-2 were synthesized by Wuhan Jinkairui Biotechnology Co., Ltd. based on the above primer sequences.
[0271] S8. Mixed Reaction
[0272] Add the reactants in the following order: 1 μL of each of the above probes is added to 5 μL of GST-VvHMG-Y protein or 5 μL of GST tag protein, 2 μL of EMSA / Gel-Shift binding buffer and 2 μL of ddH2O, and mixed well. The mixed reactants are then incubated in a PCR instrument at 25°C for 30 min to form protein-probe complexes.
[0273] S9. Gel electrophoresis and detection
[0274] A 6v / v% non-denaturing polyacrylamide gel was prepared, and the protein-probe complex was added to the gel for protein electrophoresis. After electrophoresis, the protein was transferred to a membrane and then subjected to UV cross-linking to make the protein bind to the membrane more firmly. Finally, the membrane was washed and detected.
[0275] like Figure 13 As shown, the GST-VvHMG-Y protein can bind to the VvLOR10pro f2 probe, but cannot bind to the VvLOR10pro f1, Competitor f2, Mut-VvLOR10prof2-1, and Mut-VvLOR10prof2-2 probes. This indicates that the GST-VvHMG-Y protein specifically binds to the A / T enrichment region of the VvLOR10pro f2 probe in the VvLOR10 promoter. This suggests a direct interaction between VvHMG-Y and proVvLOR10, and that VvHMG-Y can regulate the transcriptional activation activity of proVvLOR10.
[0276] Example 5: Effect of transient overexpression of VvHMG-Y on VvLOR10
[0277] Thomson Seedless White grape leaves were obtained from the control group (GFP) and the overexpression group (VvHMG-Y-GFP) according to the method in Example 3. The expression levels of VvLOR10 and VvHMG-Y were then detected using the real-time quantitative PCR (qPCR) method described in Example 3. The specific qPCR primer sequences are as follows:
[0278] The upstream primer of the VvHMG-Y gene (VvHMG-Y-qPCR-F): 5'-TCAAACTGTCTGTCGGTGTGC-3';
[0279] The downstream primer of the VvHMG-Y gene (VvHMG-Y-qPCR-R): 5'-GACCTTCGATATTTAGTGGCGC-3'.
[0280] The upstream primer of the VvLOR10 gene (VvLOR10-qPCR-F): 5'-CAACGGCTCTGTCATCATCAA-3';
[0281] The downstream primer of the VvLOR10 gene (VvLOR10-qPCR-R): 5'-CCTCTAAACACTTTCCACCTCCTA-3'.
[0282] The upstream primer of the internal reference gene VvEF1-α (VvEF1-α-qPCR-F): 5'-GCAGGGTTTGTTAAGATGAT-3';
[0283] Downstream primer of the internal reference gene VvEF1-α (VvEF1-α-qPCR-R): 5'-TCCACGCTCTTGATGACTCC-3'.
[0284] like Figure 14 As shown, transient expression of VvHMG-Y significantly upregulated VvHMG-Y expression, and VvLOR10 expression was also significantly upregulated. This indicates that transient overexpression of VvHMG-Y in grape leaves can upregulate VvLOR10 expression, suggesting that VvHMG-Y enhances grape resistance to downy mildew by upregulating VvLOR10 expression.
[0285] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. Use of VvHMG-Y protein and / or VvHMG-Y gene in preventing and / or treating grape downy mildew.
2. Use of VvHMG-Y protein and / or VvHMG-Y gene in enhancing grape resistance to grape downy mildew.
3. Use of biological material for increasing expression of VvHMG-Y protein and / or VvHMG-Y gene in preventing and / or treating grape downy mildew.
4. Use of biological material for increasing expression of VvHMG-Y protein and / or VvHMG-Y gene in enhancing grape resistance to grape downy mildew.
5. Use of biological material for increasing expression of VvHMG-Y protein and / or VvHMG-Y gene in preparing products for resisting grape downy mildew.
6. Use of VvHMG-Y protein and / or VvHMG-Y gene in preventing and / or treating diseases caused by Plasmopara viticola.
7. Use of biological material for increasing expression of VvHMG-Y protein and / or VvHMG-Y gene in preparing products for resisting diseases caused by Plasmopara viticola.
8. Use according to any one of claims 3 to 5 or claim 7, characterised in that, The biological material is any one or several of the following (1) to (4): (1) recombinant expression plasmid expressing the VvHMG-Y protein; (2) expression cassette containing nucleic acid molecule encoding the VvHMG-Y protein; (3) recombinant expression plasmid containing the nucleic acid molecule in (2); (4) recombinant microorganism containing the recombinant expression plasmid in (3).
9. A method for resisting grape downy mildew, overexpressing VvHMG-Y gene in grape.
10. The method of claim 9, wherein, Overexpressing VvHMG-Y gene in grape leaves.