Construction method and application of mouse model of spontaneous precancerous lesion of gastric cancer
By overexpressing the Zeb2 gene in mouse gastric master cells, and using Pgc-CreERT2 mice and Rosa26-Zeb2 mice for mating, combined with tamoxifen induction, a spontaneous gastric precancerous lesion model was constructed. This solved the problems of insufficient cell specificity and high experimental cost in existing technologies, and achieved reliable simulation of gastric precancerous lesions and low-cost experiments.
Patent Information
- Application Number
- CN202511661676.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2026-03-31
AI Technical Summary
Existing methods for constructing mouse models of precancerous lesions of the stomach suffer from insufficient cell specificity, high experimental costs, long cycles, large fluctuations in success rates, and lethal risks, and cannot effectively simulate the precancerous lesion process of gastric chief cells.
By overexpressing the Zeb2 gene in the gastric chief cells of mice, and by mating Pgc-CreERT2 mice and Rosa26-Zeb2 mice, combined with tamoxifen-induced Cre enzyme expression, specific Zeb2 overexpression in gastric chief cells was achieved, thus constructing a spontaneous gastric precancerous lesion model.
A cell-specific, time-controllable, and low-cost model of precancerous lesions of the stomach has been developed, which can reliably simulate the process of precancerous lesions of the stomach, simplifying the experimental procedure and reducing experimental costs.
Smart Images

Figure CN121759516A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal model technology for diseases, and specifically relates to a method and application for constructing a mouse model of spontaneous precancerous lesions of the stomach by targeting gastric chief cells. Background Technology
[0002] The incidence and mortality rates of gastric cancer in my country remain high, presenting a serious situation. Precancerous lesions are a key node in the secondary prevention and control of gastric cancer, mainly encompassing pathological processes such as chronic atrophic gastritis, intestinal metaplasia, and dysplasia. The progression of precancerous lesions involves two landmark events: ① loss of gastric parietal cells; and ② spasmolytic polypeptide-expressing metaplasia (SPEM) in gastric chief cells. Helicobacter pylori infection and gastric mucosal damage can lead to the loss of gastric parietal cells. Furthermore, the loss of parietal cells can also lead to the secretion of gastric intrinsic factor, reducing vitamin B12 absorption, causing anemia to some extent, and insufficient nutrient supply, further exacerbating the loss of gastric parietal cells. [1-4] Repeated Helicobacter pylori infection and loss of gastric parietal cells can further lead to the transformation of gastric chief cells into SPEM cells. Previous studies have used single-cell sequencing to perform cell trajectory analysis and investigate the potential transition between cell types, suggesting that gastric chief cells are the origin of SPEM cells. [5] Existing literature has confirmed that Lgr5-positive gastric chief cells are the origin of gastric cancer cells. Importantly, Helicobacter pylori can also induce the activation of the Wnt / β-catenin pathway in gastric epithelial cells, promoting the transformation of gastric cancer cells. [6-9] Therefore, the progression of precancerous lesions of the stomach is accompanied by the continuous transformation, malignant transformation, and carcinogenesis of gastric chief cells: gastric chief cells → SPEM cells → intestinal metaplastic cells (intestinal metaplasia stage) → carcinogenic cells (dysplasia stage) → gastric cancer cells (gastric cancer stage). [10, 11] .
[0003] However, the Helicobacter pylori method has a long cycle, and individual differences lead to large fluctuations in success rate and low model formation rate, usually requiring the combination of other carcinogenic inducers; the chemical carcinogenic inducer method is highly toxic, non-specific, and individual differences also lead to large fluctuations in success rate. In contrast, transgenic mice can better simulate precancerous lesions of the stomach. Current technology mainly utilizes "clustered regularly spaced short palindromic repeats / CRISPR-associated Cas9 nuclease" (CRISPR / Cas9) technology to systemically knock out "gastric H" + / K + Transgenic mice containing the α-subunit of ATP4a, an enzyme known as ATPase, can spontaneously develop an animal model of precancerous gastric lesions.
[12] However, in this model construction method, the systemic Atp4a knockout mice, where Atp4a knockout is systemic, will result in the absence of H in all tissues (especially gastric parietal cells).+ / K + -ATPase α subunit lacks cell specificity. Symptoms include anacidosis, elevated gastrin levels, parietal cell atrophy, mucosal hyperplasia, and intestinal metaplasia, but in most cases, it remains in a precancerous state without further malignant transformation. Furthermore, the gene deletion in Atp4a knockout mice occurs during the embryonic period, potentially leading to developmental compensation or lethality, resulting in premature death, low reproductive efficiency, and severely impacting research progress, increasing research time, cost, and difficulty.
[0004] Alternatively, utilize "cystine / glutamate transporter 11" Slc7a11 flox / flox Mice can be bred with ATP4b-Cre transgenic mice to obtain mice with the Slc7a11 gene knocked out from gastric parietal cells, which can also form a SPEM lesion model of atrophic gastritis.
[13] However, since it is generally accepted that gastric cancer and precancerous lesions originate from the chief cells of the stomach, rather than parietal cells, gene mice targeting parietal cells do not reflect the core pathological process of precancerous gastric lesions as well as those targeting chief cells. Furthermore, multiple generations of crossbreeding between Atp4a-Cre and multiple fluxed genes are required, and the experiment is often accompanied by parietal cell degeneration, resulting in numerous experimental variables.
[0005] In addition, Pgc-CreERT2 mice were compared with Kras mice. G12D / + Apc flox / flox Trp53 flox / flox Mice can be mated to create mouse models of gastric dysplasia or gastric cancer.
[14] Pgc-CreERT2; KrasG12D + / - Early lesions appeared in mice at approximately 3 months; intramucosal carcinoma appeared at approximately 9 months after Apc knockout; the tri-gene combination (Kras+Apc+Trp53) resulted in metastatic invasive carcinoma at 9 months. Not all individuals carrying the same gene combination developed tumors within the expected timeframe, leading to increased phenotypic differences between experimental groups; Pgc-CreERT2 and Kras were also required. G12D / + Apc flox / flox Trp53 flox / flox With four alleles, the reproductive process requires multiple generations of mating, resulting in a low proportion of offspring with the target genotype, significantly increasing experimental costs and time. Furthermore, mutations at the G12D site of Kras, Apc knockout, and Trp53 knockout lack support from clinical data in patients with precancerous gastric lesions and cannot effectively link them to the core molecular mechanisms of precancerous gastric lesions.
[0006] It is evident that the existing methods for constructing transgenic mouse models of precancerous gastric lesions all have various shortcomings and need further improvement. Moreover, there are currently no mice with ZEB2 overexpression specific to gastric chief cells for constructing spontaneous precancerous gastric lesion mouse models.
[0007] References [1] C. Della Bella, A. Antico, MP Panozzo, et al. Gastric Th17Cells Specific for H(+) / K(+)-ATPase and Serum IL-17 Signature in GastricAutoimmunity, Frontiers in immunology, 13 (2022) 952674. [2] AS Lin, JHB Shuman, A. Kotnala, et al. Loss of Corpus-Specific Lipids in Helicobacter pylori-Induced Atrophic Gastritis, mSphere, 6(2021) e0082621. [3] VP O'Brien, AL Koehne, J. Dubrulle, et al. SustainedHelicobacter pylori infection accelerates gastric dysplasia in a mouse model, Life science alliance, 4 (2021). [4] MV Lenti, M. Rugge, E. Lahner, et al. Genta, et al. Autoimmunegastritis, Nature reviews. Disease primers, 6 (2020) 56. [5] M. Zhang, S. Hu, M. Min, et al. Dissecting transcriptional heterogeneity in primary gastric adenocarcinoma by single cell RNAsequencing, Gut, 70 (2021) 464-475. [6] L. Meng, H. Shi, Z. Wang, et al. The Gamma-glutamyltransferasegene of Helicobacter pylori can promote gastric carcinogenesis by activatingWnt signal pathway through up-regulating TET1, Life sciences, 267 (2021)118921. [7] E. Abdi, S. Latifi-Navid, F. Abedi Sarvestani, et al. Emergingtherapeutic targets for gastric cancer from a host-Helicobacter pyloriinteraction perspective, Expert opinion on therapeutic targets, 25 (2021)685-699. [8] S.H. Kim, H. Kim. Inhibitory Effect of Astaxanthin on GeneExpression Changes in Helicobacter pylori-Infected Human Gastric EpithelialCells, Nutrients, 13 (2021). [9] L. Cao, S. Zhu, H. Lu, et al. Helicobacter pylori-induced RASAL2Through Activation ofNuclear Factor-κB Promotes Gastric Tumorigenesis via β-catenin Signaling Axis, Gastroenterology, 162 (2022) 1716-1731.e1717.
[10] Goldenring JR, Mills JC. Cellular Plasticity, Reprogramming, andRegeneration: Metaplasia in the Stomach and Beyond. Gastroenterology 2022;162:415-430.
[11] Bockerstett KA, Lewis SA, Noto CN, et al. Single-CellTranscriptional Analyses Identify Lineage-Specific Epithelial Responses toInflammation and Metaplastic Development in the Gastric Corpus.Gastroenterology 2020;159:2116-2129.e2114.
[12] Pan Huafeng, Ni Jiahui, Liu Wei, et al. A method for constructing a spontaneous animal model of gastric precancerous lesions and its application: CN202111565992.9[P].CN114231560B.
[13] Huang Yi, He Xinyu, Luo Ying, et al. Construction and identification method of SPEM lesion model based on atrophic gastritis: CN202510624557.0[P].CN120485277A.
[14] Douchi D, Yamamura A, Matsuo J, et al. Induction of GastricCancer by Successive Oncogenic Activation in the Corpus. Gastroenterology. 2021 Dec;161(6):1907-1923. Summary of the Invention To address the shortcomings of the existing technologies, this invention constructs a mouse model that spontaneously develops precancerous lesions of the stomach by specifically overexpressing the Zeb2 gene in gastric chief cells.
[0008] In a first aspect, the present invention provides a method for constructing a mouse model of spontaneous precancerous gastric lesions, comprising the steps of: Construct a Pgc-Cre gene mouse carrying only the Cre gene; Construct Rosa26-Zeb2 mice carrying only the Zeb2 gene; Mice carrying both Cre and Zeb2 genotypes were obtained by mating the Pgc-Cre gene mice and the Rosa26-Zeb2 gene mice. The mice were then given a drug to induce Cre nuclear translocation and promote Zeb2 gene expression, thereby obtaining a mouse model of spontaneous gastric precancerous lesions. The drug was tamoxifen.
[0009] The Pgc-Cre gene mouse mentioned above is constructed by using gene editing technology to knock the Cre gene sequence into the Pgc gene of the mouse at a specific site, such as using CRISPR / Cas9 gene editing technology.
[0010] In some embodiments of this application, the Pgc-CreERT2 gene mouse is constructed by the following method: a first gRNA sequence is designed based on the reverse strand of the Pgc gene, which guides the Cas9 enzyme to precisely locate a specific position in the Pgc gene to achieve the insertion of the Cre gene. The first gRNA sequence is shown in SEQ ID NO:1: TACAGAGAGGCGGGGCAGATGGG.
[0011] Furthermore, in some embodiments of this application, the first gRNA sequence targeting the mouse Pgc gene, a donor vector containing "IRES-CreERT2-P2A-EGFP-WPRE-BGH pA", and Cas9 mRNA are co-injected into fertilized mouse eggs to generate knock-in offspring.
[0012] The Rosa26-Zeb2 gene mouse is constructed by using gene editing technology to knock the Zeb2 gene sequence into the Rosa26 gene of the mouse at a specific site, such as using CRISPR / Cas9 gene editing technology.
[0013] In some embodiments of this application, the Rosa26-Zeb2 gene mouse is constructed by designing a second gRNA sequence based on the reverse strand of the ROSA26 gene to guide the Cas9 enzyme to precisely locate a specific position in the ROSA26 gene to achieve the insertion of the Zeb2 gene. The second gRNA sequence is shown in SEQ ID NO:2: CTCCAGTCTTTCTAGAAGATGGG.
[0014] Furthermore, in some embodiments of this application, the Pgc-Cre gene mouse is generated by injecting the second gRNA sequence, the "CAG promoter-loxP-PGK-Neo-6*SV40pA-loxP-Kozak-FLAG tag-Mouse Zeb2CDS-IRES-EGFP-WPRE-BGH pA" donor vector, and Cas9 mRNA into fertilized mouse eggs to generate site-knock-in offspring.
[0015] In some embodiments of this application, the drug is administered via intraperitoneal injection.
[0016] In some embodiments of this application, the dosage of the drug is 20 mg / kg body weight to 40 mg / kg body weight.
[0017] In some embodiments of this application, the drug is administered once daily for 5 to 7 consecutive days, and the mice are 5 to 7 weeks old when the drug is administered.
[0018] In a second aspect, the present invention also provides a mouse model of spontaneous precancerous lesions of the stomach obtained by the construction method described above.
[0019] A third aspect of the invention also provides the use of the described construction method or the described mouse model in screening drugs for the prevention and / or treatment of precancerous lesions of the stomach.
[0020] The beneficial effects of this invention are as follows: 1. Cell specificity: The construction method of this invention utilizes the Pgc promoter to achieve inducible CreERT2 expression only in gastric chief cells, which is different from the traditional Atp4a, Atp4b or systemic knockout systems.
[0021] 2. Time controllability: The construction method of this invention achieves adult-stage induced activation through the “CreERT2-tamoxifen” system, avoiding embryonic lethality or compensation.
[0022] 3. Single-gene carcinogenesis: The construction method of this invention can induce a complete gastric precancerous lesion chain through ZEB2 overexpression, breaking through the conventional idea that "multiple genes must be stacked to cause cancer".
[0023] In summary, the mouse model constructed in this invention is driven by inducible Cre specific to gastric chief cells, limited to gastric chief cells (and a very small number of gastric neck / isthmus cells), avoiding gene perturbation in non-target cells; CreERT2 fused with a mutant estrogen receptor ligand-binding domain, in the absence of tamoxifen, is no different from normal mice, but without expressing the Zeb2 gene, it does not affect the survival and reproductive function of the mice. Only in the presence of tamoxifen does it enter the nucleus and mediate recombination, overexpressing Zeb2 and producing gastric precancerous lesions, thus achieving a controllable time-induced lesion model; the high expression of Zeb2 is derived from clinical sample data analysis, which is reliable, and a single gene can produce gastric precancerous lesions. Whether it is Zeb2 or not... PGC+ / - (Hybrid) or Zeb2 PGC+ / + Pathological changes can occur in homozygous individuals, therefore, mating is simple, low-cost, and the experimental cycle is short. Attached Figure Description
[0024] Figure 1 Flowchart for constructing a mouse model of spontaneous precancerous gastric lesions according to the present invention; Figure 2 This is the result of gene screening analysis for precancerous lesions of the stomach in this invention, wherein... Figure 2 A represents the results of the heatmap analysis. Figure 2 B represents the result of the chord diagram analysis; Figure 3 This is a schematic diagram of the Pgc-Cre gene mouse construction process of the present invention; Figure 4 The results of gene identification in the F1 generation of Pgc-Cre mice according to the present invention, wherein... Figure 4 A is a strategy for PCR primer design. Figure 4 B represents the PCR test result; Figure 5 This is a schematic diagram illustrating the construction process of the Rosa26-Zeb2 gene mouse of the present invention; Figure 6 The results of gene identification in the F1 generation of Rosa26-Zeb2 gene mice of this invention are shown below. Figure 6 A is a strategy for PCR primer design. Figure 6 B represents the PCR test result; Figure 7 Results of hematoxylin-eosin staining in a mouse model; Figure 8 AB-PAS staining results for a mouse model; Figure 9 These are the results of single-cell sequencing analysis of a mouse model, among which... Figure 9 A and Figure 9 B represents the overall analysis result. Figure 9 C represents the results of epithelial cell analysis. Detailed Implementation
[0025] To enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to embodiments.
[0026] Since gastric cancer and precancerous lesions originate from the transformation of gastric chief cells, and the pepsinogen C (PGC) gene is highly expressed in these cells, Pgc-CreERT2 mice, combined with the cre-loxp system, can be used to specifically overexpress or knock out genes in gastric chief cells. Furthermore, RNA sequencing of samples from patients with precancerous gastric lesions revealed high expression of the Zeb2 gene. Based on this, this invention utilizes Pgc-CreERT2 mice (intraperitoneal injection of tamoxifen to induce Cre enzyme activation only in cells with high Pgc expression, promoting nuclear transcription and expression of the target gene) and Rosa26-Zeb2 mice (the Zeb2 gene requires Cre enzyme recognition and binding to a specific DNA sequence—the loxP site—to initiate Zeb2 expression) to produce the following offspring: ① Possesses both Cre and Zeb2 genotypes (Zeb2 for short) PGC-tg / + The offspring of the genotype: intraperitoneal injection of tamoxifen breaks the fusion between Cre and the estrogen receptor (ER), promotes the entry of Cre enzyme into the cell nucleus, recognizes and binds to the loxP site, and initiates the expression of Zeb2; while other cells of this genotype mouse that do not express the Pgc gene cannot initiate the expression of the Zeb2 gene because they cannot express Cre enzyme.
[0027] ② Offspring with only the Cre genotype (i.e., Pgc-CreERT2 mice): Intraperitoneal injection of tamoxifen, Cre enzyme expressed in gastric chief cells, but no exogenous Zeb2 expression, therefore this genotype of mouse cannot overexpress the Zeb2 gene.
[0028] ③ Offspring carrying only the Zeb2 genotype (i.e., Rosa26-Zeb2 mice): All tissues and cells of this mouse carry the exogenously inserted Zeb2 gene. Even with intraperitoneal injection of tamoxifen, because its gastric chief cells and other cells do not carry the gene expressing Cre enzyme, no type of cell in this genotype mouse can overexpress the Zeb2 gene.
[0029] ④ Wild-type mice: Because there are no exogenously inserted Cre and Zeb2 genes, even with intraperitoneal injection of tamoxifen, no type of cell in the mouse can overexpress the Zeb2 gene.
[0030] Among them, Zeb2 PGC-tg / + The offspring can be used to construct models of spontaneous precancerous lesions of the stomach, demonstrating the core pathological processes of precancerous lesions of the stomach.
[0031] Example 1: Screening for key genes in precancerous lesions of the stomach Samples from patients with superficial gastritis were collected via biopsy as control samples. Samples from various stages, including chronic atrophic gastritis, intestinal metaplasia, and dysplasia, were also collected for RNA transcriptome sequencing and heatmap analysis. Figure 2 A. Due to space limitations, only some genes are shown. The results indicate that the ZEB2 gene expression is increased in both the intestinal metaplasia and dysplasia groups. Figure 2 (A and 2B).
[0032] Example 2: Constructing a mouse model of spontaneous gastric precancerous lesions Steps for constructing a mouse model of spontaneous gastric precancerous lesions Figure 1 As shown, it includes the following steps: 1. Constructing Pgc-Cre gene mice Pgc-Cre + / - The mice were constructed and provided by Cyagen (Suzhou) Biotechnology Co., Ltd.: SCXK(Su)2022-0016.
[0033] (1) Strategy for constructing Pgc-Cre gene mice: Based on the reverse strand of the Pgc gene, a first gRNA sequence (SEQ ID NO:1 TACAGAGAGGCGGGGCAGATGGG) was designed. The first gRNA targeting the mouse Pgc gene, a donor vector containing "IRES-CreERT2-P2A-EGFP-WPRE-BGH pA", and Cas9 mRNA were co-injected into fertilized mouse eggs to generate knock-in offspring. Figure 3 ).
[0034] (2) F1 generation gene identification: F0 progenitor animals were identified through PCR detection and sequence analysis; they were then mated with wild-type mice to verify germline transmission and produce F1 generation animals, including the strategy for F1 generation PCR primer design ( Figure 4 A), and the results of its PCR identification ( Figure 4 B).
[0035] The PCR method is as follows: ①PCR was performed in a 50µL system for 33 cycles under standard conditions, with both primers listed below added to each reaction system.
[0036] First pair of primers: Upstream: 5'-TTCCAACCGGTCCTGGAGTC-3'SEQ ID NO:3 Downstream: 5'-ACCCCTAGGAATGCTCGTCA-3'SEQ ID NO:4 Second pair of primers: Upstream: 5'-CACTCCCACTGTCCTTTCCTAATA-3'SEQ ID NO:5 Downstream: 5'-CAGCAACCTGAGAAGTTACCCTAT-3'SEQ ID NO:6 ②The Taq DNA polymerase used was LongAmp Taq DNA polymerase (NEBM0323L).
[0037] ③The two controls used in PCR typing are: Water control: No DNA template added Wild-type control: Mouse genomic DNA 2. Construction of Rosa26-Zeb2 gene mice Rosa26-Zeb2 + / - The mice were constructed and provided by Cyagen (Suzhou) Biotechnology Co., Ltd.: SCXK(Su)2022-0016.
[0038] (1) Strategy for constructing Rosa26-Zeb2 gene mice: Based on the reverse strand of the ROSA26 gene, a second gRNA sequence (SEQ ID NO:2: CTCCAGTCTTTCTAGAAGATGGG) was designed. The second gRNA targeting the mouse ROSA26 gene, a donor vector containing "CAG promoter-loxP-PGK-Neo-6*SV40pA-loxP-Kozak-FLAG tag-Mouse Zeb2 CDS-IRES-EGFP-WPRE-BGH pA", and Cas9 mRNA were co-injected into fertilized mouse eggs to generate knock-in offspring. Figure 5 ).
[0039] (2) F1 generation gene identification: F0 progenitor animals were identified through PCR detection and sequence analysis; they were then mated with wild-type mice to verify germline transmission and produce F1 generation animals, including the strategy for F1 generation PCR primer design ( Figure 6 A), and the results of its PCR identification ( Figure 6 B).
[0040] The PCR method is as follows: ①PCR was performed in a 50µL system for 33 cycles under standard conditions, with both primers listed below added to each reaction system.
[0041] First pair of primers: Upstream: 5'-AAAGATCGCTCTCCACGCCCTAG-3'SEQ ID NO:7 Downstream: 5'-GATGGGGAGAGTGAAGCAGAACG-3'SEQ ID NO:8 Second pair of primers: Upstream: 5'-ACGTAAACGGCCACAAGTTC-3'SEQ ID NO:9 Downstream: 5'-ATGGGAAGTTAGTAGCAAACAAGAG-3'SEQ ID NO:10 ②The Taq DNA polymerase used was LongAmp Taq DNA polymerase (NEBM0323L).
[0042] ③The two controls used in PCR typing are: Water control: No DNA template added Wild-type control: Mouse genomic DNA 3. Build Zeb2 PGC-tg / + mice Zeb2 mice were obtained by mating Pgc-CreERT2 mice with Rosa26-Zeb2 mice. PGC-tg / + Mice.
[0043] 4. Zeb2 PGC-tg / + Pathological analysis of mouse models (1) Hematoxylin-eosin staining Zeb2 mice were obtained by mating Pgc-CreERT2 mice with Rosa26-Zeb2 mice. PGC-tg / + Following this, at seven weeks of age, the mice were intraperitoneally injected with tamoxifen (40 mg / kg) once daily for six days. Mice were then stained at 8 weeks and 30 weeks (see Table 1). Pathological findings at 8 weeks showed significant atrophy and intestinal metaplasia: disordered gland arrangement, reduced gland size, enlarged cell nuclei occupying half the total volume, and the appearance of mucus lakes. At 30 weeks, gland size further decreased sharply, cell nuclei almost filled the entire cell, fibromuscular tissue hyperplasia was observed, and severe dysplasia and carcinogenesis were visible. Figure 7 ).
[0044] Table 1 Hematoxylin-eosin staining method
[0045] (2) AB-PAS staining.
[0046] Following the hematoxylin-eosin staining method, mice at 8 and 30 weeks of age were stained (staining methods are shown in Table 2). The results showed that the saline group showed almost no blue staining, slight blue staining of the apical mucinous neck cells (normal), red neutral mucus staining in the middle, and weak or no staining of the basal chief cells. At 8 weeks, obvious blue or bluish-purple areas appeared in the middle and basal parts of the mice, indicating intestinal metaplasia. At 30 weeks, the blue staining in the mice increased sharply, with a further expansion in intensity and extent. Figure 8 The results, combined with the previous hematoxylin-eosin staining, suggested early carcinogenesis.
[0047] Table 2 AB-PAS staining method
[0048] (3) Single-cell sequencing analysis Mice that had received intraperitoneal injection of tamoxifen for 12 weeks and mice in the saline group were selected for single-cell sequencing analysis. Compared with the saline group, the tamoxifen group showed a significant decrease in parietal cells, endothelial cells, and endocrine cells, while the tamoxifen group showed a sharp increase in epithelial cells, myeloid cells, inflammatory cancer-associated fibroblasts (CAF), and brush cells. Figure 9 A and 9B). Further analysis of epithelial cells revealed inflammatory epithelial cells, pre-metaplastic cells expressing antispasmodic peptides, and mature metaplastic cells expressing antispasmodic peptides. Figure 9 C). The above results clearly demonstrate the inflammation-mediated process of precancerous lesions in the stomach.
[0049] In summary, this invention constructs a Cre-driven mouse model specific to gastric chief cells, limited to gastric chief cells (and a very small number of cervical / isthmic cells), thus avoiding gene perturbation in non-target cells. The CreERT2 fusion mutant estrogen receptor ligand-binding domain, in the absence of tamoxifen, behaves no differently from normal mice. However, without expressing the Zeb2 gene, it does not affect the mouse's survival or reproductive function. Only in the presence of tamoxifen does it enter the nucleus and mediate recombination, overexpressing Zeb2 and generating precancerous lesions of the stomach, thereby achieving a controllable time-induced lesion model. The high expression of Zeb2 is derived from clinical sample data analysis, which is reliable and demonstrates that a single gene can induce precancerous lesions of the stomach. Whether it is Zeb2 or not... PGC+ / - (Hybrid) or Zeb2 PGC+ / + (Homozygous) individuals can all exhibit pathological changes. Mating is simple, the cost is low, and the experimental cycle is short, making them suitable for screening drugs for the prevention and / or treatment of gastric cancer.
[0050] This invention is not limited to the applications listed in the specification and embodiments. It can be applied to various fields suitable for this invention. Without departing from the spirit and essence of this invention, those skilled in the art can easily make other modifications and variations, but these corresponding modifications and variations should all fall within the protection scope claimed by this invention.
[0051] The above description is only a part of the embodiments of the present invention, and is not intended to limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the content of the present invention specification should be included within the protection scope of the present invention.
Claims
1. A method for constructing a mouse model of a spontaneous gastric precancerous lesion, characterized by, The method comprises the following steps: constructing a Pgc-Cre gene mouse carrying only an inducible Cre gene; constructing a Rosa26-Zeb2 gene mouse carrying only a Zeb2 gene; crossing the Pgc-Cre gene mouse and the Rosa26-Zeb2 to obtain a mouse carrying both the Cre and Zeb2 genes, and then administering a drug to the mouse to induce the Cre into the nucleus and promote the expression of the Zeb2 gene, thereby obtaining a spontaneous gastric precancerous lesion mouse model; the drug is tamoxifen.
2. The construction method according to claim 1, characterized in that, The Pgc-Cre gene mouse is constructed by the following method: according to the reverse strand of the Pgc gene, a first gRNA sequence is designed to guide the Cas9 enzyme to accurately position at a specific position of the Pgc gene to realize the insertion of the Cre gene, and the first gRNA sequence is shown as SEQ ID NO:
1.
3. The construction method of claim 2, wherein, The Pgc-Cre gene mouse is obtained by co-injecting the first gRNA sequence, an "IRES-CreERT2-P2A-EGFP-WPRE-BGH pA" donor vector and Cas9 mRNA into a fertilized mouse egg.
4. The construction method of claim 1, wherein, The Rosa26-Zeb2 gene mouse is constructed by the following method: according to the reverse strand of the ROSA26 gene, a second gRNA sequence is designed to guide the Cas9 enzyme to accurately position at a specific position of the ROSA26 gene to realize the insertion of the Zeb2 gene, and the second gRNA sequence is shown as SEQ ID NO:
2.
5. The construction method according to claim 4, characterized in that, The Rosa26-Zeb2 gene mouse is obtained by co-injecting the second gRNA sequence, an "CAG promoter-loxP-PGK-Neo-6*SV40pA-loxP-Kozak-FLAG tag-Mouse Zeb2 CDS-IRES-EGFP-WPRE-BGH pA" donor vector and Cas9 mRNA into a fertilized mouse egg.
6. The construction method of claim 1, wherein, The drug is administered by intraperitoneal injection.
7. The construction method of claim 6, wherein, The amount of the drug is 20 mg / kg body weight - 40 mg / kg body weight.
8. The construction method of claim 1, wherein, The drug is administered once a day for 5-7 consecutive days, and the mice are 5 weeks old - 7 weeks old when the drug is administered.
9. The spontaneous gastric precancerous lesion mouse model obtained by the method of any one of claims 1-8.
10. The use of the construction method of any one of claims 1-8 or the mouse model of claim 9 in screening drugs for preventing and / or treating gastric precancerous lesions.
Citation Information
Patent Citations
Construction method and application of spontaneous gastric precancerous lesion animal model
CN114231560A
A method for constructing a spontaneous gastric precancerous lesion animal model and its application
CN114231560B
Construction and identification method based on atrophic gastritis SPEM lesion model
CN120485277A