Primer for identifying parasitic nematodes on pine trees, detection method and application

Abstract

The invention belongs to the technical field of biological detection of forestry diseases, and discloses a primer for identifying parasitic nematodes of pine trees, the primer comprises an identification primer, a downstream primer of the identification primer comprises one or more of an ITSR3 sequence, a VRF2M sequence and an ITSR4 sequence, the ITSR3 sequence is 5 '-CCGTTTCACGCAGTTACT-3', the VRF2M sequence is 5 '- The sequence of the VRF2M is 5 '-TCCTCTGCTTACTGATATG-3', and the sequence of the VRF2M is 5 '- And the sequence of the ITSR4 is 5 '-CTGATATGCTTAAGTTCAGC-3'. The sequence of the ITSR4 is shown in the description. According to the present invention, the primers are adopted to perform PCR amplification on the pine tree sample, the obtained amplification product is stable, the stable amplification can be performed to obtain the full-length sequence containing the ITS1 and the ITS2, the gel electrophoresis is performed without the impurity band, and the identification accuracy of the pine tree infection nematode is high. The detection kit adopting the primer can accurately identify the nematodes to the species level, and is suitable for rapid identification of pine tree infection nematodes.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology for forestry diseases, specifically relating to a reagent and detection method for identifying parasites in pine trees. Background Technology

[0002] Pine parasitic nematodes are a serious threat to forestry safety. The pine wilt nematode (Bursaphelenchus xylophilus) is the primary cause of pine wilt disease, which can cause large-scale death of pine trees in a short period. Rapid and accurate identification of the causative species is a prerequisite for disease monitoring and control. Molecular identification methods based on the intratranscribed spacer (ITS) sequence of ribosomal DNA (rDNA) have become the mainstream technique for nematode classification and identification due to their combination of specificity and versatility.

[0003] Primers commonly used for identifying pine parasitic nematodes are ITS sequences. Currently reported primers (Hideaki IvVAHORI, 1998) include... Figure 1 As shown, amplification can be performed using VRF1 and VRF2, or separately using VRF1 and IKF2, or IKF1 and VRF2, and then spliced ​​together to form VRF1 and VRF2 to amplify the full length of ITS1 and ITS2. However, in actual amplification processes, the amplified products obtained using the above methods are very unstable, such as... Figure 2 As shown, the PCR amplification results of VRF1 / IKF2 were relatively good; the amplified IKF1 / VRF2 were all mixed bands and could not be used for sequencing, affecting the sequencing results; the amplification of VRF1 / VRF2 both failed, resulting in the inability to obtain full-length VRF1 / VRF2 sequences (including ITS1 and ITS2). This amplification instability seriously hindered the efficiency and accuracy of nematode identification. Summary of the Invention

[0004] To address the aforementioned shortcomings in existing technologies, this invention provides primers, detection methods, and applications for identifying pine parasitic nematodes. By designing new primers and screening primer combinations that can stably obtain the full-length ITS sequence, this invention ensures efficient identification of pine parasitic nematodes.

[0005] To achieve the above objectives, the present invention employs the following technical solution: a primer for identifying pine parasitic nematodes, comprising an identification primer, wherein the downstream primer of the identification primer comprises one or more of the following sequences: ITSR3 sequence, VRF2M sequence, and ITSR4 sequence, wherein:

[0006] The ITSR3 sequence is 5'-CCGTTTCACTCGCAGTTACT-3';

[0007] The VRF2M sequence is 5'-TCCTCTGCTTACTGATATG-3';

[0008] The ITSR4 sequence is 5'-CTGATATGCTTAAGTTCAGC-3'.

[0009] Furthermore, the upstream primer of the identification primer includes a VRF1 sequence and / or an IKF1 sequence, wherein:

[0010] The VRF1 sequence is 5'-CGTAACAAGGTAGCTGTAG-3';

[0011] The IKF1 sequence is 5'-GGGTCGATGAAGAACGCAG-3'.

[0012] The present invention also provides a detection kit comprising the primers described above for identifying pine parasitic nematodes.

[0013] The application of a primer for identifying pine parasitic nematodes described in this invention in the detection and control of pine tree diseases and pests.

[0014] The present invention relates to the application of a detection kit for the detection and control of pine tree diseases and pests.

[0015] This invention also provides a method for identifying pine parasitic nematodes, using primers for identifying pine parasitic nematodes as described in the aforementioned scheme. The method steps are as follows:

[0016] S1. Take tissue samples from infected pine trees and extract total DNA;

[0017] S2. PCR Amplification System and Procedure: The 25 μL reaction system includes: 2.5 μL 10×PCR Buffer, 2 μL dNTP™ imprint (2.5 mmol / L), 1 μL upstream primer (10 μmol / L), 1 μL downstream primer (10 μmol / L), 0.2 μL Taq DNA polymerase (5 U / μL), and 1 μL template DNA. The total DNA extracted in step S1 was subjected to PCR amplification. The reaction procedure was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; final extension at 72℃ for 10 min.

[0018] S3. Take 5 μL of PCR product and electrophoresis it in a 1.5% agarose gel (containing 0.5 μg / mL EB) at a constant voltage of 120 V for 30 min. Observe the amplification effect using a UV gel imaging system. Recover the specific bands using a gel recovery kit and perform Sanger sequencing.

[0019] S4. The sequencing results obtained in S3 were compared with known nematode ITS sequences using the BLAST tool for homology.

[0020] Furthermore, in step S4, the homology comparison uses a similarity of ≥99% as the basis for species identification.

[0021] Further, step S4 involves: using SeqMan software to assemble the sequencing results from S3 to obtain the Contig sequence; submitting the sequence to the NCBI database and performing homology comparison with known nematode ITS sequences using the BLAST tool.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The primers of this invention were used to perform PCR amplification on pine tree samples. The amplified products were stable and could stably amplify the full-length sequences containing ITS1 and ITS2. Gel electrophoresis showed no impurities, indicating high accuracy in identifying pine tree nematodes. The detection kit using these primers can accurately identify pine tree nematodes down to the species level and is suitable for rapid identification of pine tree nematodes. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the primer sequences and amplification products involved in this invention;

[0025] Figure 2 Gel electrophoresis results of PCR amplification of pine samples infected with nematodes using VRF1 / IKF2, IKF1 / VRF2, and VRF1 / VRF2, respectively;

[0026] Figure 3 The results of gel electrophoresis of the amplification products using VRF1 combined with newly designed downstream primers;

[0027] Figure 4 The amplified DNA electrophoresis results of 10 nematode populations were detected using primers IKF1 / ITSR3 (ITS2) and primers VRF1 and ITSR3 (full length of ITS1 and ITS2). Detailed Implementation

[0028] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] I. Experimental Materials

[0030] 1. Pine tree samples infected with nematodes: Eleven pine parasitic nematode populations were isolated from infected pine tree tissues in my country, including four *Bursaphelenchus xylophilus* (BxHS, BxMWS, BxYS, BxYNS), three *Bursaphelenchus mucronatus* (BmZJ, BmHB, BmHoS), two *Bursaphelenchus doui* (NeZZS, NeAs), one *Oscheius dolichura* (NeYD12), and one *Aphelenchoides stammeri* (NePs). Sterile water was used as a negative control.

[0031] 2. Main reagents and instruments: Genomic DNA extraction kit (Omega), Taq DNA polymerase, 10×PCR Buffer, dNTP Mixture (Takara); PCR amplifier (Bio-Rad T100), UV gel imaging system (Tanon 2500).

[0032] 3. Primer design and synthesis: Referring to the existing upstream primers VRF1 (5'-CGTAACAAGGTAGCTGTAG-3') and IKF1 (5'-GGGTCGATGAAGAACGCAG-3'), three optimized downstream primers were designed to address the binding defects of the downstream primer VRF2 (Table 1).

[0033] Table 1 Primer sequences used in this study

[0034] Primer name Primer sequence (5'→3') Remark VRF1 CGTAACAAGGTAGCTGTAG Existing upstream primers IKF1 GGGTCGATGAAGAACGCAG Existing upstream primers ITSR3 CCGTTTCACTCGCAGTTACT This study designed downstream primers. VRF2M TCCTCTGCTTACTGATATG This study designed downstream primers. ITSR4 CTGATATGCTTAAGTTCAGC This study designed downstream primers.

[0035] II. Experimental Methods

[0036] 1. Nematode genomic DNA extraction: Take a single nematode sample and extract total DNA using a genomic DNA extraction kit according to the instructions. Measure the DNA concentration (50~100 ng / μL) and purity (OD260 / OD280=1.8~2.0) using Nanodrop 2000. Store at -20℃ for later use.

[0037] 2. PCR Amplification System and Procedure: A 25 μL reaction system was used, consisting of: 2.5 μL 10×PCR Buffer, 2 μL dNTP™ primer (2.5 mmol / L), 1 μL upstream primer (10 μmol / L), 1 μL downstream primer (10 μmol / L), 0.2 μL Taq DNA polymerase (5 U / μL), 1 μL template DNA, and ddH2O to a final volume of 25 μL (the detection kit can be prepared using the above components). The reaction procedure was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; and a final extension at 72℃ for 10 min.

[0038] 3. Amplification product detection and sequencing: Take 5 μL of PCR product and electrophoresis it in a 1.5% agarose gel (containing 0.5 μg / mL EB) at a constant voltage of 120 V for 30 min. Observe the amplification effect using a UV gel imaging system. Specific bands are recovered using a gel extraction kit and subjected to Sanger sequencing (bidirectional sequencing).

[0039] 4. Sequence analysis and identification: SeqMan software was used to assemble the sequencing results to obtain the contig sequence; the sequence was submitted to the NCBI database and compared with known nematode ITS sequences using the BLAST tool. A similarity of ≥99% was used as the basis for species identification.

[0040] III. Experimental Results

[0041] Amplification results of the *B. xylenicus* strain BxYNS (Figure 3) showed that: among the existing primer combinations, VRF1 / VRF2 produced no amplification product, IKF1 / VRF2 showed multiple extraneous bands, and only VRF1 / IKF2 produced an amplified band, but the fragment was short; however, the three downstream primers designed in this study, when paired with VRF1, all produced specific bands. The VRF1 / ITSR3 band was approximately 750–1000 bp in length, consistent with the expected full-length ITS1+ITS2 sequence, and the band was clear and free of extraneous bands. ITSSR3 enhanced specific binding to the target sequence through base optimization, reducing non-specific amplification and thus eliminating extraneous band interference. The VRF1 / VRF2M and VRF1 / ITSR4 bands were slightly shorter, but also showed no extraneous band interference.

[0042] Furthermore, VRF1 / ITSR3 and IKF1 / ITSR3 were used to amplify other nematode samples. The results showed that all samples could be amplified. The sequences were compared and analyzed on NCBI (https: / / www.ncbi.nlm.nih.gov / ), and were found to be full-length sequences containing ITS1 and ITS2, which could be used for nematode identification.

[0043] Eleven nematode populations were amplified using the optimal primer pairs VRF1 / ITSR3 and IKF1 / ITSR3. The results (Figure 4) showed that all nematode samples yielded single specific bands with no extraneous or nonspecific amplifications, and the negative control showed no amplification. The amplified bands of VRF1 / ITSR3 were all consistent with the full-length sequence, and the band of IKF1 / ITSR3 corresponded to the ITS2 region, further validating the broad-spectrum applicability of the new primers.

[0044] The sequencing sequences of the VRF1 / ITSR3 amplification products, after splicing, ranged in length from 723 to 986 bp, all containing complete ITS1 and ITS2 regions. NCBI BLAST alignment results (Table 2) showed that: 4 sequences (BxHS, BxMWS, BxYS, BxYNS) had ≥99.5% homology with Bursaphelenchus xylophilus; 3 sequences (BmZJ, BmHB, BmHoS) had ≥99.2% homology with Bursaphelenchus mucronatus; 2 sequences (NeZZS, NeAs) had ≥99.0% homology with Bursaphelenchusdoui; and NeYD12 and NePs had ≥98.8% homology with Oscheius dolichura and Aphelenchoidesstammeri, respectively. The identification results were accurate and reliable.

[0045] Table 2. Identification results of nematode populations

[0046] Nematode samples Identify species name NCBI Homology Similarity Serial ID number BxHS Bursaphelenchus xylophilus 99.7% Seq ID:1 BxMWS Bursaphelenchus xylophilus 99.5% Seq ID:2 BxYS Bursaphelenchus xylophilus 99.6% Seq ID:3 BxYNS Bursaphelenchus xylophilus 99.8% Seq ID:4 BmHoS Bursaphelenchus mucronatus 99.2% Seq ID:5 BmHB Bursaphelenchus mucronatus 99.3% Seq ID:6 BmZJ Bursaphelenchus mucronatus 99.4% Seq ID:7 NeYD12 Oscheius dolichura 98.8% Seq ID:8 NePs Aphelenchoides stammeri 99.0% Seq ID:9 NeAs Bursaphelenchus doui 99.0% Seq ID:10 NeZZS Bursaphelenchus doui 99.1% Seq ID:11

[0047] The newly designed primer ITSR3 has a binding site closer to the downstream region of the ITS sequence. When paired with VRF1, it can amplify the full-length sequence containing both ITS1 and ITS2 in a single step, eliminating the need for multiple rounds of amplification and splicing, thus significantly simplifying the experimental procedure. From an application perspective, the VRF1 / ITSR3 primer combination exhibits significant broad-spectrum advantages: it can effectively amplify not only major pathogenic nematodes such as *Pinus pineatus* and *Pinus pseudopineatus*, but also closely related or associated nematodes such as *Bursaphelenchus doui* and *Oscheius dolichura*, which is of great significance for the identification of complex samples (such as mixed-infected pine tissue). Furthermore, the PCR conditions of this primer combination are mild (stable amplification is possible at annealing temperatures of 55–60°C), requiring minimal experimental equipment and facilitating its widespread application in grassroots laboratories.

[0048] The optimized primer pair (VRF1 / ITSR3) designed in this study, consisting of the downstream primer ITS13 and the upstream primer VRF1, can stably amplify the full-length ITS1 and ITS2 sequences of pine parasitic nematodes, exhibiting high specificity and wide applicability. PCR amplification and sequencing comparison using this primer combination can accurately identify pine parasitic nematodes to the species level, providing an efficient and reliable molecular biological detection tool for early monitoring and epidemiological investigation of diseases such as pine wilt disease. A detection kit made using the primers designed in this invention can be applied to the rapid detection of pine pests and diseases, facilitating timely and targeted control measures.

[0049] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principle of the present invention should be included within the protection scope of the present invention.

Claims

1. A primer for identifying pine tree parasitic nematodes, characterized in that, This includes identification primers, and the downstream primers for these primers include one or more of the following sequences: ITSR3, VRF2M, and ITSR4. The ITSR3 sequence is 5'-CCGTTTCACTCGCAGTTACT-3'; The VRF2M sequence is 5'-TCCTCTGCTTACTGATATG-3'; The ITSR4 sequence is 5'-CTGATATGCTTAAGTTCAGC-3'.

2. The primer for identifying pine parasitic nematodes according to claim 1, characterized in that, The upstream primer of the identification primer includes a VRF1 sequence and / or an IKF1 sequence, wherein: The VRF1 sequence is 5'-CGTAACAAGGTAGCTGTAG-3'; The IKF1 sequence is 5'-GGGTCGATGAAGAACGCAG-3'.

3. A test kit, characterized in that, Includes the primers for identifying pine parasitic nematodes as described in claim 1 or 2.

4. The application of the primer for identifying pine parasitic nematodes as described in claim 1 or 2 in the detection and control of pine tree diseases and pests.

5. The application of the detection kit according to claim 3 in the detection and control of pine tree diseases and pests.

6. A method for identifying pine tree parasitic nematodes, characterized in that, The method, which uses the primers for identifying pine parasitic nematodes as described in claim 1 or 2, comprises the following steps: S1. Take tissue samples from infected pine trees and extract total DNA; S2. PCR Amplification System and Procedure: The 25 μL reaction system includes: 2.5 μL 10×PCR Buffer, 2 μL dNTP™ imprint (2.5 mmol / L), 1 μL upstream primer (10 μmol / L), 1 μL downstream primer (10 μmol / L), 0.2 μL Taq DNA polymerase (5 U / μL), and 1 μL template DNA. The total DNA extracted in step S1 was subjected to PCR amplification. The reaction procedure was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, for a total of 35 cycles; final extension at 72℃ for 10 min. S3. Take 5 μL of PCR product and electrophoresis it in a 1.5% agarose gel (containing 0.5 μg / mL EB) at a constant voltage of 120 V for 30 min. Observe the amplification effect using a UV gel imaging system. Recover the specific bands using a gel recovery kit and perform Sanger sequencing. S4. The sequencing results obtained in S3 were compared with known nematode ITS sequences using the BLAST tool for homology.

7. The method for identifying pine parasitic nematodes according to claim 6, characterized in that, In step S4, homology comparison is based on a similarity of ≥99% as the basis for species identification.

8. The method for identifying pine parasitic nematodes according to claim 6, characterized in that, Step S4 is as follows: The sequencing results of S3 were assembled using SeqMan software to obtain the contig sequence; the sequence was submitted to the NCBI database and homology was compared with known nematode ITS sequences using the BLAST tool.

Images