KASP primer for identifying genotype of chicken green-shell egg and application of KASP primer

The KASP technique for identifying the genotype of green-shelled chicken eggs utilizes specific primers and fluorescently labeled PCR methods, which solves the problems of false positives, false negatives, and time consumption in existing technologies, achieving efficient and accurate genotype identification suitable for large-scale sample testing.

CN121759624APending Publication Date: 2026-03-31CHINA AGRI UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-09-29
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing conventional PCR and agarose gel electrophoresis methods pose risks of false positives and false negatives when identifying the genotype of chicken green-shelled eggs, and large-scale testing is time-consuming, making it difficult to meet the needs of efficient and accurate genotype identification.

Method used

Competitive allele-specific PCR (KASP) technology was used to design specific primer pairs for the EAV-HP insert fragment of the SLCO1B3 gene. Combined with FAM and VIC fluorescent labels, genotype was determined by PCR amplification and fluorescence signal analysis, eliminating the need for agarose gel electrophoresis.

Benefits of technology

It improves the accuracy and efficiency of genotyping, reduces human error and operation time, is suitable for large-scale sample testing, and reduces economic and labor costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses KASP primers for identifying genotypes of chicken green-shell eggs and application of the KASP primers. Compared with a common flow of identifying genotypes through PCR (Polymerase Chain Reaction) and agarose gel electrophoresis, the method for performing KASP genetic typing by utilizing the primers with the sequences as shown in SEQ ID NO: 1-3 provided by the invention has the advantages that the steps of preparing agarose gel and performing electrophoresis are omitted, and the economic cost is reduced; when large-scale detection is carried out, a large amount of manpower resources are saved, and the detection time is shortened; analysis is directly carried out according to an instrument detection result, personal errors are reduced, and the accuracy of a typing result is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to KASP primers for identifying the genotype of green-shelled chicken eggs and their applications. Background Technology

[0002] The green shell of chicken is caused by SLCO1B3 (Solute carrier organic an-ion transporterfamily member 1B3, SLCO1B3 A avian retrovirus inserted at the 5' end of the gene EAV-HP Caused by, EAV-HP After insertion, SLCO1B3 The gene is specifically expressed in the uterus, resulting in a green eggshell color. When the genotype is O / O or O / o, the chicken lays green-shelled eggs; when the genotype is o / o, the chicken lays white-shelled eggs. Currently, the main method for identifying the green-shelled egg genotype is to extract DNA from the individual chicken and analyze it... EAV-HP Primers were designed for the insert fragment and conventional PCR (Polymerase Chain Reaction, PCR) and agarose gel electrophoresis were performed.

[0003] The method of combining conventional PCR and agarose gel electrophoresis to determine individual genotype has the advantages of high specificity, high sensitivity, speed and simplicity, and low requirements for DNA purity. However, this method has the potential for false positives and false negatives due to differences in the reagents used for amplification and the operation of the experimenters. In addition, it is time-consuming when testing large batches of samples. Summary of the Invention

[0004] The purpose of this invention is to provide KASP primers for identifying the genotype of green-shelled chicken eggs and their applications.

[0005] The concept of this invention is as follows: KASP refers to Kompetitive Allele Specific PCR, which can perform precise biallelic genotyping of SNPs and InDels at specific loci. Compared with ordinary PCR, KASP technology has higher accuracy and conversion rate, lower cost, and simpler and faster result analysis. This invention is specifically designed for green-shelled egg genes. SLCO1B3 Inserted fragment EAV-HP (Chromosome 1, 67324642-67368902 bp) KASP primers were designed to improve the accuracy of selecting green-shelled egg allele genotypes, reduce reagent and labor costs, shorten operation time for large batches of samples, and not affect accuracy.

[0006] To achieve the objective of this invention, in a first aspect, this invention provides a KASP primer for identifying the genotype of green-shelled chicken eggs, comprising a forward primer 1 with a FAM fluorescent label, a forward primer 2 with a VIC fluorescent label, and a shared reverse primer, the nucleotide sequences of which are as follows (5′-3′): Forward primer 1: gaaggtgaccaagttcatgctGACGAGCGAACGGAGACTACATG (SEQ ID NO:1); Forward primer 2: gaaggtcggagtcaacggattAGCAGTTTTAATCTTGTCTCCTCC (SEQ ID NO:2); Shared reverse primer sequence: GTATTTTGGGACCTTCAACAGAGG (SEQ ID NO:3).

[0007] Secondly, the present invention provides detection reagents or kits containing the primers.

[0008] Thirdly, the present invention provides the application of the primers or the detection reagents or kits in the genotyping of chicken green-shelled eggs.

[0009] Fourthly, the present invention provides the application of the primers or the detection reagents or kits in identifying whether chickens lay green-shelled eggs.

[0010] Fifthly, the present invention provides a method for identifying the genotype of green-shelled chicken eggs, using the genomic DNA of the chicken to be tested as a template, and using the primers shown in SEQ ID NO:1-3 or the detection reagent or kit to perform PCR amplification and analyze the PCR amplification products.

[0011] Furthermore, the genotype of the chickens to be tested was determined based on the fluorescence signal of the PCR amplification products. The genotype corresponding to the amplification products that only detected FAM fluorescence was the O / O dominant homozygous type, the genotype corresponding to the amplification products that only detected VIC fluorescence was the O / O recessive homozygous type, and the genotype corresponding to the amplification products that detected both FAM and VIC fluorescence was the O / O heterozygous type.

[0012] Preferably, the PCR amplification conditions are: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s (-0.6℃ / cycle), 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 26 cycles.

[0013] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects: Using the primers provided by this invention for KASP genotyping eliminates the steps of preparing agarose gels and electrophoresis compared to the conventional PCR plus agarose gel electrophoresis genotyping process, thus reducing economic costs. In large-scale testing, it saves significant manpower and shortens testing time. Direct analysis based on instrument results reduces human error and improves the accuracy of genotyping results. Attached Figure Description

[0014] Figure 1 This is the KASP genotyping result of 118 samples in a preferred embodiment of the present invention. The left side shows 24 samples, and the right side shows 94 samples. Blue and red represent homozygous, green represents heterozygous, and black represents the negative control.

[0015] Figure 2 These are the results of routine PCR verification of 21 green-shelled heterozygous samples in this embodiment of the invention. The band at 422 bp represents the green-shelled band, and the band at 292 bp represents the white-shelled band.

[0016] Figure 3 The results are from routine PCR verification of 52 homozygous individuals with green shells in this embodiment of the invention.

[0017] Figure 4 These are the results of routine PCR verification of 45 white-shelled individuals in this embodiment of the invention. Detailed Implementation

[0018] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0019] Example 1

[0020] To include SLCO1B3 Using the chicken genome DNA as a template, primer pairs were designed for PCR amplification. The endpoint fluorescence signal was read, data were exported, and individual genotypes were analyzed. The specific method is as follows: (1) Design of specific primers

[0021] The green-shelled egg trait in chickens is caused by chromosome 1. SLCO1B3 The insertion sequence is caused by a 4.2 kb sequence at the 5' end of the gene. Therefore, specific primers designed for this insertion can be used for KASP detection to estimate an individual's genotype.

[0022] Based on the document "An EAV-HP Insertion in 59 Flanking Region of SLCO1B3Primers were designed using relevant sequences from "Causes Blue Eggshell in the Chicken" as a reference.

[0023] The primer sequences designed for the EAV-HP insert are as follows: Forward primers with FAM label: gaaggtgaccaagttcatgctGACGAGCGAACGGAGACTACATG

[0024] Forward primers with VIC label: gaaggtcggagtcaacggattAGCAGTTTTAATCTTGTCTCCTCC

[0025] Shared reverse primer: GTATTTTGGGACCTTCAACAGAGG

[0026] (2) Chicken sample collection

[0027] The experiment used 45 white Leghorn chickens (o / o) and 73 green-shelled laying hens (O / O or O / o) as subjects.

[0028] (3) Extraction of genomic DNA from chicken blood samples

[0029] The specific steps for using the FlaPure Animal Tissue / Cell / Blood DNA Extraction Kit are as follows: Sample digestion: Take 20 μL of fresh or frozen anticoagulated blood sample and add Buffer GA1 to make up to 200 μL; Add 20 μL of Proteinas solution, mix well, then add 200 μL of Buffer GA2, vortex to mix thoroughly, and incubate in a 70 ℃ water bath for 10 min. Briefly centrifuge to remove water droplets from the inner wall of the tube cap. Add 200 μL of anhydrous ethanol, vortex to mix thoroughly, briefly centrifuge, and proceed to step 4 for column purification; After a brief centrifugation, add all the solution and flocculent precipitate obtained in step 3 into the adsorption column (place the adsorption column in the collection tube), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 500 μL GW1 to the adsorption column, centrifuge at 12000 rpm for 30s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; Add 600 μL GW2 to the adsorption column, centrifuge at 12000 rpm for 30s, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube; Repeat the steps; Centrifuge at 12000 rpm for 2 min, then open the lid and let it air dry at room temperature for several minutes; Place the adsorption column in a new centrifuge tube, add 50-200 μL of Buffer TE dropwise to the middle of the adsorption membrane, incubate at room temperature for 2-5 min, centrifuge at 12000 rpm for 2 min, collect the DNA solution, and store the DNA at -20℃.

[0030] (4) KASP genotyping

[0031] DNA sample concentration adjustment: Adjust the DNA concentration (5-50 ng) and dilute it into a 96-well plate; Mix working solution preparation

[0032] Prepare the working solution mix according to Table 1. After preparation, gently pipette five times until well mixed, and then centrifuge at 3000 rpm.

[0033] Table 1 KASP type reaction system

[0034] Note: DNA in the system should be diluted to a final concentration of 5-50 ng per reaction.

[0035] Working solution Mix dispensing: Dispense the prepared working solution Mix 2.57 µL into the corresponding 384-well plates according to the well plate layout table; DNA sample aliquoting: According to the well plate arrangement, take 2.5 µL of the DNA with adjusted concentration and aliquot it into the corresponding 384-well plate; NTC preparation: Add NTC reagent, 2.57 µL working solution, and 2.5 µL RNase-free water to the corresponding positions according to the well plate arrangement table; Sealing the 384-well plate: Use sealing film to seal the well plate, and use a scraper to tighten the edges of the well plate. Place the 384-well plate in a centrifuge at 4°C and centrifuge briefly at 1200 rpm to collect the sample to the bottom of the well; PCR amplification program (Table 2): Table 2 PCR Amplification Program

[0036] Data scanning and result export: After PCR, remove the well plate, perform data scanning, and export the genotyping results. Refer to the "ABI7900 HT Fast RealTime PCR system experimental operating procedures" for details.

[0037] (5) Experimental results

[0038] In this embodiment, 118 samples underwent genotyping, and a total of 52 homozygous green-shelled individuals (O / O), 21 heterozygous individuals (O / o), and 45 white-shelled individuals (o / o) were detected. The population genotyping results are as follows: Figure 1 As shown, the specific genotyping information of the samples is shown in Tables 3 to 5.

[0039] Table 3. KASP test results for all individual samples.

[0040] Table 4. Individual KASP test results for all tested samples

[0041] Table 5. KASP test results for all individual samples.

[0042] (6) Standard PCR verification

[0043] To confirm the accuracy of the constructed primers for KASP technology, further conventional PCR verification was conducted using the aforementioned 118 samples as experimental subjects. The results were completely consistent with the KASP genotyping results. Figure 2 , Figure 3 , Figure 4 ).

[0044] 1) Conventional PCR primer sequences

[0045] The primer sequences for the EAV-HP insert amplification fragment are as follows: Upstream primer: tgaccagcgtagataaacatg

[0046] Downstream primer: agttccgaacgcgatgtgac

[0047] The length of the amplified product is 422 bp; The primer sequences for non-insertion fragment amplification are as follows: Upstream primer: tgaccagcgtagataaacatg

[0048] Downstream primer: aggtaatgttcattagctac

[0049] The length of the amplified product is 292 bp.

[0050] 2) Standard PCR reaction system

[0051] 3) Standard PCR reaction conditions

[0052] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. KASP primers for identifying the genotype of green-shelled chicken eggs, characterized in that, It includes a forward primer 1 with FAM fluorescent label, a forward primer 2 with VIC fluorescent label, and a shared reverse primer, the nucleotide sequences of which are shown in SEQ ID NO:1-3, respectively.

2. A detection reagent or kit containing the primers described in claim 1.

3. The application of the primers of claim 1 or the detection reagents or kits of claim 2 in the genotyping of chicken green-shelled eggs.

4. The application of the primer of claim 1 or the detection reagent or kit of claim 2 in identifying whether chickens lay green-shelled eggs.

5. A method for identifying the genotype of green-shelled chicken eggs, characterized in that, Using the genomic DNA of the chicken to be tested as a template, PCR amplification was performed using the primers described in claim 1 or the detection reagents or kits described in claim 2, and the PCR amplification products were analyzed.

6. The method according to claim 5, characterized in that, The genotype of the chickens to be tested was determined based on the fluorescence signal of the PCR amplification products. The genotype corresponding to the amplification products that only detected FAM fluorescence was O / O dominant homozygous, the genotype corresponding to the amplification products that only detected VIC fluorescence was O / O recessive homozygous, and the genotype corresponding to the amplification products that detected both FAM and VIC fluorescence was O / O heterozygous.

7. The method according to claim 5 or 6, characterized in that, PCR amplification conditions were: 94℃ for 15 min; 94℃ for 20 s, 61-55℃ for 60 s (-0.6℃ / cycle), 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 26 cycles.

Citation Information

Cited By

  • Method for producing high-yield green shell eggs with uniform shell color

    CN122375551A