Functional molecular marker of gene AhNAC2 for regulating and controlling oil content of peanut seed kernel and application of functional molecular marker

By developing a functional molecular marker for the peanut kernel oil content regulating gene AhNAC2 and utilizing competitive allele-specific PCR technology, the problem of unclear genetic regulation of peanut kernel oil synthesis was solved, resulting in efficient peanut breeding and a significant increase in kernel oil content.

CN121759633APending Publication Date: 2026-03-31HENAN ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

In the existing technology, the genetic regulation mechanism of peanut kernel oil synthesis is unclear, which leads to low efficiency of molecular marker-assisted selection breeding, and recombination between QTLs and markers is prone to occur, reducing genetic gain.

Method used

Functional molecular markers for AhNAC2, a gene regulating peanut kernel oil content, were developed. Competitive allele-specific PCR (KASP) primers were designed at SNP sites on peanut chromosome 8 for genotyping analysis to identify CA nonsense mutations in AhNAC2, achieving efficient marker-assisted selection.

Benefits of technology

This study achieved precise localization of peanut kernel oil content and efficient breeding, explained 11.41-20.97% of the phenotypic variation, significantly increased peanut kernel oil content, and verified the important value of this marker in breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759633A_ABST
    Figure CN121759633A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of molecular biology, and provides a functional molecular marker of a major gene AhNAC2 for regulating and controlling the oil content of peanut seed kernels and application of the functional molecular marker. The invention discloses a major site qSOCA08-1 for regulating and controlling the oil content of peanut seed kernels, and the phenotypic variation of 11.41-20.97% is explained. The qSOCA08-1 is finely positioned in a 352.2 kb physical interval between a No.8 chromosome marker Tif2. A08.38582892 and a No.8 chromosome marker Tif2. A08.38935104, and a candidate gene of the qSOCA08-1 is confirmed to be AhNAC2. The invention also discloses a method for identifying the qSOCA08-1. The 285th basic group of the coding sequence of the AhNAC2 shows C-A nonsense mutation between parents Jihuansweet No.1 and W191, and the early termination can cause the function loss of the AhNAC2. A competitive allele specific PCR molecular marker is developed on the basis of a C-A mutation SNP site, the association between the molecular marker and the oil content of the seed kernel is successfully verified in a peanut germplasm resource material and a Yuhua 15 * ST001 recombinant inbred line population, and the important value of the marker in marker-assisted selection breeding of the high oil content of the seed kernel of the peanut is verified.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the functional molecular markers and applications of AhNAC2, the major gene regulating the oil content of peanut kernels, and belongs to the field of molecular biology. Background Technology

[0002] Oil content in peanut kernels is one of the most important quality traits and a key objective for quality improvement. Although the pathways of oil metabolism in seeds of higher plants are relatively clear, the regulatory mechanisms of oil accumulation in peanut kernels are still poorly understood and lag far behind those in crops such as soybeans and rapeseed. Therefore, elucidating the genetic laws governing oil synthesis in peanut kernels is currently a hot research topic.

[0003] Marker-assisted selection (MAG) primarily involves the aggregation of favorable alleles or haplotypes and is an effective tool for improving the efficiency and accuracy of crop breeding. Extensive QTL mapping and genome-wide association analysis of peanut kernel oil content have provided a wealth of molecular markers for MAG breeding. These markers are either flanking markers of QTLs or developed based on predicted gene sequence differences, providing significant marker-trait associations to some extent. However, even when preliminary genetic distances to QTLs indicate close linkage, recombination can occur between markers and QTLs / genes, thus reducing the genetic gain of MAG. Therefore, the mapping and cloning of the major QTL for peanut kernel oil content and the identification of its causal sequence variations are crucial for developing functional molecular markers to improve breeding efficiency. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a functional molecular marker for the peanut kernel oil content regulating gene AhNAC2 and its application.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] The functional molecular marker for AhNAC2, a gene regulating peanut kernel oil content, is located at a SNP site of 45,741,511 bp on peanut chromosome 8. The sequence of the molecular marker is as follows:

[0007] CTAAGGCAACGTTTGGGGAGCAAGAGTGGTACTTCTTTAGCCCAAGGGACAGGAAGTATCCGAACGGTGCTCGGCCAAACAGGGCGGCAACTTCCGGGTA[C / A]TGGAAGGCAACCGGGACGGATAAGCCGGTGCTGACCTCCGGTGGGACCCAGAAGGTCGGCGTGAAGAAGGCTTTGGTCTTCTATGGAGGGAAGCCCCCCA.

[0008] A KASP primer combination for amplifying the molecular marker site, comprising:

[0009] AhNAC2-A08-X: 5'-GGCGGCAACTTCCGGGTAC-3'

[0010] AhNAC2-A08-Y: 5'-GGCGGCAACTTCCGGGTAA-3'

[0011] AhNAC2-A08-C: 5'-CCAAAGCCTTCTCACGCCG-3'.

[0012] The application of the molecular markers in the identification of oil content in peanut kernels includes:

[0013] (1) Extract DNA from the peanut germplasm material to be identified and perform genotyping analysis on the SNP locus at 38,777,491 bp on chromosome 8 of the material to be identified using the SNPLine genotyping platform;

[0014] (2) In peanut germplasm resources or genetic populations, if the genotype of the SNP locus is A:A, then the kernel oil content of the peanut germplasm material to be identified is higher than that of the germplasm with the genotype C:C.

[0015] The application of the molecular marker method in molecular breeding of high oil content peanut kernels.

[0016] Beneficial effects of this invention:

[0017] This invention utilizes a recombinant inbred line population created by crossing the peanut variety Jihua Tian 1 (JHT1) with the high-generation line W191 to perform genetic mapping for the trait of kernel oil content. A major locus regulating peanut kernel oil content, qSOCA08-1, was detected, explaining 11.41-20.97% of the phenotypic variation. Based on the genotypes of 10 heterozygous recombinant plants generated from the self-pollination of the remaining heterozygous plants in the recombinant inbred line population and the phenotypes of 10 near-isogenic lines derived from them, qSOCA08-1 was finely mapped to a 352.2 kb physical region between chromosome 8 markers Tif2.A08.38582892 and Tif2.A08.38935104. This region contains 9 predicted genes. Based on the functional annotation, sequence differences, expression patterns, and functions of homologous genes in other plants of the nine genes, and after heterologous transgenic confirmation that Ah08g256000, which is predicted to encode the NAC transcription factor, is a candidate gene for qSOCA08-1, it was named AhNAC2 (Arachis hypogaea NAC2).

[0018] A CA nonsense mutation was found at base 285 of the AhNAC2 coding sequence between the parents Jihuatian 1 and W191, which prematurely terminates AhNAC2 and causes loss of function. Competitive allele-specific PCR (KASP) molecular markers were developed based on the CA mutation SNP site, and their association with kernel oil content was successfully verified in peanut germplasm resources and the Yuhua 15×ST001 recombinant inbred line population, confirming the important value of this marker in marker-assisted selection breeding for high kernel oil content peanuts. Attached Figure Description

[0019] Figure 1 Fine mapping of qSOCA08-1, the major site for oil content in peanut kernels;

[0020] Figure 2 Expression patterns of nine genes in the fine mapping region of the major effect site qSOCA08-1 for peanut kernel oil content;

[0021] Figure 3 Analysis of AhNAC2 gene sequence and expression pattern;

[0022] Figure 4 AhNAC2 stop-gain Effect of overexpression on oil content in Arabidopsis seeds;

[0023] Figure 5 A schematic diagram of the genotypic analysis of peanut germplasm materials using the AhNAC2 functional marker and its correlation with kernel oil content;

[0024] Figure 6 A schematic diagram of the genotypic analysis of the population of the Yuhua 15×ST001 recombinant inbred line using AhNAC2 functional markers and its association with the oil content of the kernel. Detailed Implementation

[0025] The specific embodiments of the present invention will be further described in detail below with reference to examples. Unless otherwise specified, the instruments and equipment involved in the examples are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the experimental methods involved are all conventional methods.

[0026] Example 1: Obtaining the major effective site qSOCA08-1 for oil content in peanut kernels

[0027] (1) Phenotypic identification of peanut kernel oil content in recombinant inbred line population

[0028] A recombinant inbred line population comprising 554 F8 generations of peanut varieties, specifically the peanut cultivar Jihua Tian 1 (JHT1) and the high-generation line W191, was used as experimental material. Planting and phenotypic surveys were conducted in Xinxiang City, Henan Province; Weifang City, Shandong Province; and Tangshan City, Hebei Province in 2024. After ripening, the peanuts were naturally sun-dried. Approximately 20 mature, plump kernels free from pests and diseases were selected from each line, and their oil content was determined.

[0029] (2) Preliminary localization of the major site qSOCA08-1 for oil content in peanut kernels

[0030] Based on the phenotypic data of kernel oil content in recombinant inbred lines under three environments, 40 lines with extremely high oil content and 40 lines with extremely low oil content were selected to construct extreme mixed pools for whole-genome sequencing. After comparison with the reference genome, a total of 249,826 homozygous and polymorphic SNPs and InDel loci were identified in the two parents. Four algorithms—Δ (SNP-index), G-statistic, Euclidean distance, and Fisher's exact test—were used to perform association analysis on the detected high-quality SNPs and InDel loci. A 99% confidence level was used as the screening threshold to obtain confidence intervals associated with kernel oil content.

[0031] The Δ (SNP-index) algorithm yielded one confidence interval on chromosome 8, located between 37.63 Mb and 51.53 Mb; the G-statistic algorithm yielded two confidence intervals on chromosome 8, located between 37.51 and 46.73 Mb and between 47.18 and 51.53 Mb, respectively; the Euclidean distance algorithm yielded one confidence interval on chromosome 8, located between 37.56 and 51.53 Mb; and Fisher's exact test yielded two confidence intervals on chromosome 8, located between 38.42 and 45.93 Mb and between 46.72 and 50.35 Mb, respectively.

[0032] Combining the results from four algorithms, the 37.51-51.53 Mb (14.02 Mb) region on chromosome 8 was ultimately identified as a potential QTL region. Molecular markers were designed based on homozygous polymorphic SNPs between parents within this region. Genotypic analysis was performed on the recombinant inbred line population, and linkage maps were constructed. Phenotypic data from three environments were then used to locate the QTL for kernel oil content. The major-effect locus qSOCA08-1 for kernel oil content was located between markers Tif2.A08.38582892 and Tif2.A08.39227100, explaining 11.41-20.97% of the phenotypic variation.

[0033] Example 2: Fine mapping and candidate gene analysis of qSOCA08-1, the major locus for oil content in peanut kernels.

[0034] (1) Phenotypic analysis of near-isogenic lines

[0035] To assess the genetic effects of qSOCA08-1 on peanut kernel oil content and other important agronomic traits, a residual heterozygous plant (RHL_160, heterozygous in the qSOCA08-1 region) was screened from the JW-RIL population and self-crossed to the F8 generation. Homozygous plants within the region without recombination were then selected to construct the near-isogenic line NIL_160. Peanut 40K SNP microarray analysis revealed that the NIL_160A line (with the same qSOCA08-1 region genotype as the low-oil-content parent) and the NIL_160B line (with the same qSOCA08-1 region genotype as the high-oil-content parent) shared 99.88% genetic background identity. Phenotypic investigation showed that qSOCA08-1 only regulates kernel oil content, without significantly affecting other important agronomic traits. This also confirmed the reliability of the NIL_160 construction and its potential for fine mapping of qSOCA08-1.

[0036] (2) Fine mapping and candidate gene analysis of qSOCA08-1, the major locus of oil content in kernel seeds.

[0037] To precisely locate qSOCA08-1, RHL_160 plants were self-crossed to the F8 generation. Using 12 SNP sites that differed between the parents in the qSOCA08-1 region, 10 heterozygous recombinant plants were screened in the remaining heterozygous region. Self-crossing was continued to the F9 generation, and non-recombinant homozygous plants in the region were screened to construct 10 near-isogenic lines.

[0038] In the F9 generation of RHL_160_28, there was no significant difference in kernel oil content between plants with the same remaining heterozygous region as the maternal genotype and those with the same paternal genotype, indicating that the candidate gene for qSOCA08-1 is located between markers Tif2.A08.38166923 and Tif2.A08.41533397. Similarly, in the F9 generation of RHL_160_7, RHL160_13, RHL_160_20, RHL_160_38, and RHL_160_43, there was no significant difference in kernel oil content between plants with the same remaining heterozygous region as the maternal genotype and those with the same paternal genotype, indicating that the candidate gene for qSOCA08-1 is located between markers Tif2.A08.37089392 and Tif2.A08.41533397. The kernel oil content of RHL_160_29 and RHL_160_30 F9 generation plants with the same genotype as the maternal parent and those with the same genotype as the paternal parent differed significantly, indicating that the candidate gene of qSOCA08-1 is located between markers Tif2.A08.37089392 and Tif2.A08.38935104; the kernel oil content of RHL_160_8 and RHL_160_17 F9 generation plants with the same genotype as the maternal parent and those with the same genotype as the paternal parent differed significantly, indicating that the candidate gene of qSOCA08-1 is located between markers Tif2.A08.38582892 and Tif2.A08.41533397. In summary, based on the genotypes of the 10 heterozygous recombinant single plants and the phenotypes of the 10 nearly isogenic lines derived from them, it is shown that the candidate gene of qSOCA08-1 is located within a 352.2 kb physical interval between markers Tif2.A08.38582892 and Tif2.A08.38935104. Figure 1 A).

[0039] According to the annotations of the peanut cultivar reference genome version Arahy.Tifrunner.gnm2.ann2.PVFB, nine predicted genes are contained within the 352.2 kb physical region. Figure 1 B). To identify potential candidate genes, whole-genome sequencing data from parents JHT1 and W191 were used to compare the sequence differences of nine predicted genes within the fine-mapping region and their promoters (2000 bp upstream of the transcription start site). Their expression patterns were analyzed using the Peanut Genome Resource (http: / / peanutgr.fafu.edu.cn / index.php) public database. Figure 2The promoter regions of five genes, Ah08g254900, Ah08g255000, Ah08g255500, Ah08g256300, and Ah08g256400, show sequence differences; the UTR regions of two genes, Ah08g255500 and Ah08g256000, show sequence differences; the coding region of Ah08g255200 contains SNPs leading to missense mutations; the coding region of Ah08g256000 contains SNPs leading to nonsense mutations; and the intron regions of Ah08g254900 show sequence differences. Expression pattern analysis revealed that Ah08g254900 was highly expressed in leaves and flowers; Ah08g255000, Ah08g255200, Ah08g255500, Ah08g256300, and Ah08g256400 were all stably and highly expressed in other tissues, except for lower expression levels in the late embryonic development stage; Ah08g256000 was highly expressed at different developmental stages of the seed coat and in the early embryonic development stage.

[0040] Based on the functional annotations, sequence differences, expression patterns, and functions of homologous genes in other plants, Ah08g256000, which encodes the NAC transcription factor, is predicted to be a candidate gene for the major site qSOCA08-1 of kernel oil content, and is named Arachis hypogaea NAC2 (AhNAC2).

[0041] Figure 1 To finely map the major locus of peanut kernel oil content qSOCA08-1, A: using the genotype of F8 heterozygous recombinant single plants of RHL_160 and the phenotype of their derived F9 near-isogenic lines, qSOCA08-1 was mapped to a 352.2 kb physical interval between Tif2.A08.38582892 and Tif2.A08.38935104; B: the 352.2 kb physical interval contains nine predicted genes.

[0042] Figure 2 The expression patterns of nine genes in the fine mapping region of qSOCA08-1, the major effect site for peanut kernel oil content, were determined.

[0043] (3) Analysis of AhNAC2 gene sequence and expression pattern

[0044] AhNAC2 is 3281 bp in length (Arahy.Tifrunner.gnm2.Arahy.08:38774855..38778135), containing three exons and two introns. Sequence analysis showed that, compared with the parental JHT1, a 1 bp insertion / deletion was detected in the 3' UTR region of AhNAC2 in W191 (Arahy.Tifrunner.gnm2.Arahy.08:

[0045] 38774860); the 285th base of the AhNAC2 coding sequence in W191 (Arahy.Tifrunner.gnm2).

[0046] Arahy.08:38777491 underwent a CA nonsense mutation, resulting in premature termination at amino acid position 95. Figure 3 A).

[0047] Peanut seeds were collected at 35, 45, 55, 65, and 75 days post-flowering (DAF) and separated into seed coat and embryo. Total RNA was extracted and reverse transcribed to obtain cDNA. The AhNAC2 transcription level in the seed coat and embryo at the five developmental stages was analyzed by real-time quantitative reverse transcription PCR. Figure 3 B). The reaction system consisted of 20 µl: 1 µl cDNA, 10 µl ChamQ Universal SYBR qPCRMaster Mix, 0.5 µl each of forward and reverse primers (10 µmol / L), and 8 µl RNase-free ddH2O. The reaction was pre-denatured at 95 °C for 30 s; denatured at 95 °C for 10 s, annealed at 60 °C for 30 s, for 40 cycles; then denatured at 95 °C for 15 s, annealed at 60 °C for 60 s, and denatured again at 95 °C for 15 s, and the melting curve was collected. Peanut AhADH3 (5'-GACGCTTGGCGAGATCAACA-3' (SEQ ID NO.5) and 5'-AACCGGACAACCACCACATG-3' (SEQ ID NO.6)) was used as an internal reference gene. Real-time quantitative reverse transcription PCR primers for AhNAC2 (5'-GAGGAACCAACAACAGCAATCC-3' (SEQ ID NO.7) and 5'-GAGTGATGATAGAGTCCTCTTGGTG-3' (SEQ ID NO.8)) were used to calculate the relative gene expression levels using the 2ΔCT method, and the differential significance was analyzed.

[0048] During kernel development, AhNAC2 is highly expressed in the seed coat but almost not in the embryo, suggesting that AhNAC2 may regulate seed oil content by affecting the transport of carbon sources from the seed coat to the embryo. The premature termination of the AhNAC2 coding sequence is most likely a causal sequence variation of the major site qSOCA08-1 for kernel oil content.

[0049] Figure 3For the analysis of AhNAC2 gene sequence and expression pattern, A: a CA nonsense mutation occurred at the 285th base of the AhNAC2 coding sequence, resulting in premature termination at the 95th amino acid; B: real-time quantitative reverse transcription PCR was used to determine the transcription level of AhNAC2 in seed coats and embryos collected at 35, 45, 55, 65 and 75 days after flowering.

[0050] (4) AhNAC2 stop-gain Overexpression increased the oil content of Arabidopsis seeds.

[0051] To further clarify the biological function of AhNAC2 in regulating seed lipid synthesis, an AhNAC2 overexpression culture was created in Arabidopsis Col-0. stop-gain The transgenic lines were obtained. T2 generation seeds were seeded on 1 / 2 MS medium containing Basta antibiotic. The number of positive and negative seedlings was counted. Based on Mendelian genetics, three single-copy AhNAC2 lines were screened. stop-gain Overexpressing Arabidopsis thaliana lines was used. Generations were continued until the T3 generation, and homozygous single plants were selected for transplantation to obtain AhNAC2. stop-gain Overexpression homozygous lines.

[0052] The AhNAC2 content in three T3 generation homozygous lines (OE-3, OE-13, and OE-22) was analyzed by real-time quantitative reverse transcription PCR. stop-gain transcription level ( Figure 4 A). Total RNA was extracted from wild-type Col-0 seedlings and overexpression homozygous lines OE-3, OE-13, and OE-22 two weeks after germination. The RNA was reverse transcribed into cDNA for real-time quantitative reverse transcription PCR analysis. The reaction system and amplification procedure were the same as those described in the section on AhNAC2 transcriptional level analysis in peanut seed coat and embryo.

[0053] Using Arabidopsis thaliana AtACTIN7 (5'-CCTCAGCACCTTCCAACAGATG-3' (SEQ ID NO.9) and 5'-AACTCACCACCACGAACCAGAT-3' (SEQ ID NO.10)) as internal reference genes, AhNAC2 was calculated. stop-gain The relative expression level of AhNAC2. Total fatty acid content in seeds and AhNAC2. stop-gain The relative expression levels of AhNAC2 in OE-22 were positively correlated: compared with Col-0, AhNAC2 expression levels in OE-22 were significantly higher. stop-gain The relative expression level was the lowest, and the total fatty acid content in seeds did not change significantly; AhNAC2 in OE-3 stop-gain The relative expression level was moderate, and the total fatty acid content in seeds was significantly increased by 3.09%; AhNAC2 in OE-13 stop-gain The relative expression level was the highest, and the total fatty acid content in the seeds was significantly increased by 9.28% ( Figure 4 A and Figure 4 B). This indicates that AhNAC2 stop-gain Overexpression of [a specific substance] promoted the biosynthesis of oil in Arabidopsis seeds.

[0054] Fatty acid composition analysis showed that, compared with Col-0, the percentages of each fatty acid in OE-22, OE-3, and OE-13 did not change significantly. Figure 4 C), combined with the pattern that AhNAC2 is highly expressed only in the seed coat of peanut kernels but not in the embryo ( Figure 3 (B) It is speculated that AhNAC2 may regulate seed oil content by affecting the amount of carbon source transported from the seed coat to the embryo.

[0055] Figure 4 AhNAC2 stop-gain The effect of overexpression on the oil content of Arabidopsis seeds, where A: analysis of AhNAC2 in transgenic lines by real-time quantitative reverse transcription PCR. stop-gain A: Transcription level; B: Total fatty acid content in seeds of Col-0 and transgenic lines; C: Fatty acid composition in seeds of Col-0 and transgenic lines. *, P < 0.05; **, P < 0.01.

[0056] Example 3: Development and Validation of AhNAC2 Functional Molecular Markers

[0057] (1) Development of functional molecular markers for AhNAC2

[0058] A CA nonsense mutation occurred at base 285 of the AhNAC2 coding sequence between parents. This SNP site is located at 38,777,491 bp on peanut chromosome 8 (reference genome Tifrunner V2.0). The sequence 100 bp before and after this site is SEQ ID NO.1: CTAAGGCAACGTTTGGGGAGCAAGAGTGGTACTTCTTTAGCCCAAGGGACAGGAAGTATCCGAA CGGTGCTCGGCCAAACAGGGCGGCAACTTCCGGGTA [C / A] TGGAAGGCAACCGGGACGGATAAGCCGGTGCTGAC CTCCGGTGGGACCCAGAAGGTCGGCGTGAAGAAGGCTTTGGTCTTCTATGGAGGGAAGCCCCCCA .

[0059] KASP markers were designed based on this SNP site between parents, including three primer sequences:

[0060] AhNAC2-A08-X: 5'-GGCGGCAACTTCCGGGTAC-3' (SEQ ID NO. 2);

[0061] AhNAC2-A08-Y: 5'-GGCGGCAACTTCCGGGTAA-3' (SEQ ID NO.3);

[0062] AhNAC2-A08-C: 5'-CCAAAGCCTTCTCACGCCG-3' (SEQ ID NO. 4).

[0063] KASP primer mixing solution: Prepare stock solutions of each of the three primers at a concentration of 100 μmol / L. The KASP primer mixture is prepared as follows: X:Y:C:water = 60 μL:60 μL:150 μL:230 μL.

[0064] PCR reaction system: 1 μL: 1 μL genomic DNA (~10 ng / μL), after drying, add 1 μL of 1×Master Mix and KASP primer mixture. The primer volume is about 1.4% of the total reaction system.

[0065] The PCR amplification program was as follows: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 61℃-55℃ extension for 1 min, 10 cycles; 94℃ denaturation for 20 s, 55℃ extension for 1 min, 26 cycles; stored at 10℃.

[0066] (2) Association between functional markers of AhNAC2 and kernel oil content in natural peanut populations

[0067] DNA was extracted from 353 peanut germplasm resources. Using AhNAC2 functional molecular markers, genotyping was performed on SNP loci at 38,777,491 bp on chromosome 8 of the 353 germplasm resources via the SNPLine platform. Figure 5 A). Among 353 germplasm resources, 222 germplasms showed a C:C genotype for the AhNAC2 functional marker, with an average kernel oil content of 51.11%; 120 germplasms showed an A:A genotype, with an average kernel oil content of 51.82%. Compared to the C:C genotype germplasm, the A:A genotype germplasm showed a significantly higher kernel oil content of 1.37% ( Figure 5 B).

[0068] Figure 5 A is a schematic diagram illustrating the genotypic analysis of peanut germplasm materials using the AhNAC2 functional marker. Figure 5 B represents the functional marker of AhNAC2 and its association with the genotype and kernel oil content of peanut germplasm resources.

[0069] (3) Verification of the functional molecular marker AhNAC2 in the population of Yuhua 15×ST001 peanut recombinant inbred line

[0070] DNA was extracted from each line in the Yuhua 15×ST001 peanut recombinant inbred line population. Using AhNAC2 functional markers, genotyping was performed on SNP loci at 38,777,491 bp on chromosome 8 of each line using the SNPLine platform. Figure 6 A). Among the 226 lines, 100 lines had a C:C genotype for the AhNAC2 functional marker, with an average kernel oil content of 53.25%; 113 lines had an A:A genotype, with an average kernel oil content of 54.52%. Compared to the C:C genotype lines, the A:A genotype lines had a significantly higher kernel oil content of 2.38% ( Figure 6 B).

[0071] Figure 6 A schematic diagram illustrating the genotypic analysis of the Yuhua 15×ST001 peanut recombinant inbred line population using the AhNAC2 functional marker A. Figure 6 B is a functional marker of AhNAC2 that relates the genotype of the Yuhua 15×ST001 peanut recombinant inbred line population to the oil content of the kernel.

Claims

1. A functional molecular marker of peanut kernel oil content regulation gene AhNAC2, characterized in that, The molecular marker is located at the SNP site of 45,741,511 bp of chromosome 8 of peanut, and the sequence of the molecular marker is: CTAAGGCAACGTTTGGGGAGCAAGAGTGGTACTTCTTTAGCCCAAGGGACAGGAAGTATCCGAACGGTGCTCGGCCAAACAGGGCGGCAACTTCCGGGTA[C / A]TGGAAGGCAACCGGGACGGATAAGCCGGTGCTGACCTCCGGTGGGACCCAGAAGGTCGGCGTGAAGAAGGCTTTGGTCTTCTATGGAGGGAAGCCCCCCA.

2. A KASP primer combination for amplifying the molecular marker locus of claim 1, wherein, The KASP primer combination comprises: AhNAC2-A08-X: 5'-GGCGGCAACTTCCGGGTAC-3' AhNAC2-A08-Y: 5'-GGCGGCAACTTCCGGGTAA-3' AhNAC2-A08-C: 5'-CCAAAGCCTTCTTCACGCCG-3'.

3. The use of the molecular marker according to claim 1 for identifying oil content in peanut kernels, characterized in that, Comprise: (1) Extract the DNA of the peanut germplasm material to be identified, and analyze the genotype of the SNP site at 38,777,491 bp of chromosome 8 of the material to be identified by the SNPLine genotype analysis platform; (2) In peanut germplasm resources or genetic populations, if the genotype of the SNP site is A:A, then the oil content of the seed kernel of the peanut germplasm material to be identified is higher than that of the germplasm with genotype C:C.

4. The application of the molecular marker method of claim 1 in the molecular breeding of high oil content of peanut seed kernel.