InDel molecular marker library and application thereof
By utilizing the InDel molecular marker library and digital PCR system, the challenge of clinical pharmacokinetic analysis of non-gene-edited cell therapy drugs has been solved, enabling efficient and reliable biological analysis of cell therapy drugs and providing precise population differentiation and quantitative detection capabilities.
Patent Information
- Application Number
- CN202511779417.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-28
- Publication Date
- 2026-03-31
AI Technical Summary
Current technologies lack effective methods for analyzing the clinical pharmacokinetics of cell therapy drugs with no or limited gene editing, especially lacking specific detection targets to achieve quantitative analysis of biomarkers.
A digital PCR detection system is constructed by combining an InDel molecular marker library containing 30 InDel sites with MGB probes and primers to detect the pharmacokinetics of allogeneic cells and achieve absolute quantification through the detection of specific InDel sites.
It enables efficient and reliable pharmacokinetic analysis of clinical samples of cell therapy drugs with or without gene editing or with limited gene editing. It has high coverage and stable population discrimination ability, can accurately quantify the copy number of donor cells in recipients, and supports the bioanalysis of allogeneic cell therapy drugs.
Smart Images

Figure CN121760075A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioanalysis of pharmaceuticals, specifically relating to an InDel molecular marker library and its applications. Background Technology
[0002] In clinical applications, in vitro (cell) gene therapy products mainly involve immune cell gene therapy products, stem cell gene therapy products, and other cell gene therapy products. Immune cell gene therapy involves collecting the patient's own or allogeneic immune cells, culturing them in vitro, and then reinfusing them into the patient. These cells intervene and treat the disease by killing target cells, regulating the immune system, reducing immune tolerance, and activating the immune response. Based on the different immune cells used and their genetic engineering characteristics, immune cell gene therapy is mainly classified into CAR-T, CAR-NK, T-cell receptor-engineered T-cells (TCR-T), and CAR-DNT, among others.
[0003] Cell therapy exhibits distinct pharmaceutical characteristics compared to traditional drugs. Cellular drugs exhibit significant heterogeneity in terms of source, type, and in vitro modification. Furthermore, as "living" drugs, cell therapy products are more complex in terms of their therapeutic mechanisms, in vivo effects, and manufacturing processes, making them difficult to evaluate using traditional standards. Regarding pharmacokinetics (PK), unlike small molecule and antibody drugs with clearly defined components that can be assessed through absorption, distribution, metabolism, and excretion (ADME), PK studies for cell therapy primarily focus on the following characteristics: changes in the number of target cells after entering the body, monitoring cell viability / phenotypic differentiation, duration of action, function during the expected survival period, in vivo biodistribution, ectopic foci, tissue tropism / migration, expression / secretion of biomolecules, and interactions with host tissues.
[0004] Quantitative PCR (qPCR) is the most commonly used technique for detecting the copy number of a target gene. Currently, real-time quantitative PCR (qPCR) is widely used in the detection of copy numbers of transgenic genes such as CAR and TCR. Since immune cell gene therapy and stem cell gene therapy are products modified using genetic engineering technology, primer and probe detection systems can be designed based on the gene modification sequence to find the specific gene detection sequence for the cell therapy product and conduct clinical pharmacokinetic analysis. However, for cells and gene therapy (CGT) drugs with no gene editing or only a limited number of gene edits, such as DNT (Double Negative T) products (DNT cells do not require gene editing and naturally possess the characteristics of a universal cell therapy product), it will be difficult to find drug-specific detection targets as biomarkers for clinical pharmacokinetic analysis of these drugs.
[0005] Since the discovery of InDels, numerous studies have reported the use of InDels to construct multiplex amplification systems. According to published research, InDels have been applied to personal identification, paternity testing, ancestry deduction, and genotyping of special samples such as autopsy materials, human tumor tissue, bone fragments, and paraffin-embedded tissue. However, current InDel methods are only qualitative and genotyping, and cannot perform copy number quantification, thus limiting their application to the pharmacokinetic analysis of clinical samples for cell therapy drugs. Summary of the Invention
[0006] To address the lack of existing methods for analyzing the pharmacokinetics of clinical samples used in cell therapy drugs, this invention provides an InDel molecular marker library and its applications. Applications incorporating the InDel molecular marker library provided by this invention enable the analysis of pharmacokinetics in clinical samples of cell therapy drugs.
[0007] The present invention solves the above-mentioned technical problems through the following technical solutions.
[0008] The first aspect of this invention provides an InDel molecular marker library, which contains one or more of 30 InDel sites selected from human chromosomes; the location information and mutation types of the 30 InDel sites relative to the reference genome hg19 are as follows:
[0009]
[0010]
[0011] In some embodiments of the present invention, the InDel molecular marker library consists of the 30 InDel sites.
[0012] A second aspect of the present invention provides a kit or chip for detecting the pharmacokinetics of allogeneic cells, the kit or chip comprising an InDel molecular marker library as described in the first aspect and / or reagents for detecting the InDel molecular marker library as described in the first aspect.
[0013] In some embodiments of the present invention, the reagent includes a probe for capturing the region where the InDel site is located.
[0014] In some preferred embodiments of the present invention, the nucleotide sequence of the capture region of the probe is shown in any one of SEQ ID NO:91-SEQ ID NO:120.
[0015] In some preferred embodiments of the present invention, the reagent comprises one or more probes selected from the following: nucleotide sequences such as SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: The probes shown in SEQ ID NO: 86 and SEQ ID NO: 89.
[0016] In some specific embodiments of the present invention, the reagent comprises nucleotide sequences such as SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: 86 and SEQ ID NO: The probe shown in 89.
[0017] In some embodiments of the present invention, the probe is an MGB probe, and the probe further comprises a fluorescent group, a quenching group and / or a small groove conjugate.
[0018] In some preferred embodiments of the present invention, the probe satisfies one or more of the following conditions:
[0019] (1) The 5' end of the nucleotide sequence of the probe contains a fluorescent group;
[0020] (2) The probe contains a quenching group and a minor groove conjugate at the 3' end of the nucleotide sequence;
[0021] (3) The fluorescent group is FAM, ROX, TET, TAMRA, CY3, CY5, NED, VIC or HEX;
[0022] (4) The quenching group is a non-luminescent quenching group, preferably TAMRA or BHQ;
[0023] (5) The minor groove conjugate is a dihydrocyclopyrrole tripeptide.
[0024] In some embodiments of the present invention, the reagent further comprises primers for amplifying the InDel site.
[0025] In some preferred embodiments of the present invention, the reagent comprises one or more primers selected from the following: nucleotide sequences such as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 4 ...47, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 88 and SEQ ID NO: Primer shown in Figure 90;
[0026] In some preferred embodiments of the present invention, the reagent comprises one or more primer pairs selected from the following: SEQ ID NO: 1 and SEQ ID NO: 3; SEQ ID NO: 4 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 9; SEQ ID NO: 10 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 15; SEQ ID NO: 16 and SEQ ID NO: 18; SEQ ID NO: 19 and SEQ ID NO: 21; SEQ ID NO: 22 and SEQ ID NO: 24; SEQ ID NO: 25 and SEQ ID NO: 27; SEQ ID NO: 28 and SEQ ID NO: 30; SEQ ID NO: 31 and SEQ ID NO: 33; SEQ ID NO: 34 and SEQ ID NO: 36; SEQ ID NO: 37 and SEQ ID NO: 39; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: SEQ ID NO: 43 and SEQ ID NO: 45; SEQ ID NO: 46 and SEQ ID NO: 48; SEQ ID NO: 49 and SEQ ID NO: 51; SEQ ID NO: 52 and SEQ ID NO: 54; SEQ ID NO: 55 and SEQ ID NO: 57; SEQ ID NO: 58 and SEQ ID NO: 60; SEQ ID NO: 61 and SEQ ID NO: 63; SEQ ID NO: 64 and SEQ ID NO: 66; SEQ ID NO: 67 and SEQ ID NO: 69; SEQ ID NO: 70 and SEQ ID NO: 72; SEQ ID NO: 73 and SEQ ID NO: 75; SEQ ID NO: 76 and SEQ ID NO: 78; SEQ ID NO: 79 and SEQ ID NO: 81; SEQ ID NO: 82 and SEQ ID NO: 84; SEQ ID NO: 85 and SEQ ID NO: 87; and, SEQ ID NO: 88 and SEQ ID NO: 45. ID NO: 90.
[0027] In some specific embodiments of the present invention, the reagent comprises primer pairs selected from the following: SEQ ID NO: 1 and SEQ ID NO: 3; SEQ ID NO: 4 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 9; SEQ ID NO: 10 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 15; SEQ ID NO: 16 and SEQ ID NO: 18; SEQ ID NO: 19 and SEQ ID NO: 21; SEQ ID NO: 22 and SEQ ID NO: 24; SEQ ID NO: 25 and SEQ ID NO: 27; SEQ ID NO: 28 and SEQ ID NO: 30; SEQ ID NO: 31 and SEQ ID NO: 33; SEQ ID NO: 34 and SEQ ID NO: 36; SEQ ID NO: 37 and SEQ ID NO: 39; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO: 44; SEQ ID NO: 45 and SEQ ID NO: 46; SEQ ID NO: 4 ...49; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO: 49; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO: 49; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO: 49; SEQ ID NO: 40 and SEQ ID 45; SEQ ID NO: 46 and SEQ ID NO: 48; SEQ ID NO: 49 and SEQ ID NO: 51; SEQ ID NO: 52 and SEQ ID NO: 54; SEQ ID NO: 55 and SEQ ID NO: 57; SEQ ID NO: 58 and SEQ ID NO: 60; SEQ ID NO: 61 and SEQ ID NO: 63; SEQ ID NO: 64 and SEQ ID NO: 66; SEQ ID NO: 67 and SEQ ID NO: 69; SEQ ID NO: 70 and SEQ ID NO: 72; SEQ ID NO: 73 and SEQ ID NO: 75; SEQ ID NO: 76 and SEQ ID NO: 78; SEQ ID NO: 79 and SEQ ID NO: 81; SEQ ID NO: 82 and SEQ ID NO: 84; SEQ ID NO: 85 and SEQ ID NO: 87; and, SEQ ID NO: 88 and SEQ ID NO: 90.
[0028] In some embodiments of the present invention, the kit further includes a polymerase chain reaction (PCR) amplification reagent composition.
[0029] In some embodiments of the present invention, the kit further includes reagents for extracting genomic DNA from samples.
[0030] A third aspect of the present invention provides a method for detecting the pharmacokinetics of allogeneic cell therapy, the method comprising the step of detecting InDel sites in a sample to be tested; the InDel sites are defined in the InDel molecular marker library described in the first aspect.
[0031] In some embodiments of the present invention, the method is not for diagnostic purposes.
[0032] In some embodiments of the present invention, the detection is performed using a kit or chip as described in the second aspect.
[0033] In some embodiments of the present invention, the sample to be tested is the genomic DNA of the subject after drug administration.
[0034] In some preferred embodiments of the present invention, the genomic DNA is derived from peripheral blood.
[0035] In some preferred embodiments of the present invention, the detection is PCR detection or NGS-based detection.
[0036] In some preferred embodiments of the present invention, the detection system for the PCR detection comprises: 300-600 nM primers as defined in the kit or chip described in the second aspect, and / or, 250-300 nM probes as defined in the kit or chip described in the second aspect.
[0037] In some further preferred embodiments of the present invention, the detection system for the PCR detection comprises: primers of 380-420 nM, such as 380, 390, 400, 410 or 420 nM, said primers as defined in the kit or chip described in the second aspect; and / or, probes of 250-280 nM, such as 250, 260, 270 or 280 nM, said probe composition as defined in the kit or chip described in the second aspect.
[0038] In some specific embodiments of the present invention, the detection system for the PCR detection includes: 400 nM primers, said primers as defined in the kit or chip described in the second aspect, and / or, 250 nM probes, said probe composition as defined in the kit or chip described in the second aspect.
[0039] In some embodiments of the present invention, the method further includes pre-screening of InDel sites, the pre-screening comprising one or more of the following steps:
[0040] (i) Extract genomic DNA 1 of the cell therapy drug and / or genomic DNA 2 of the subject before administration;
[0041] (ii) Detect the InDel molecular marker library as described in the first aspect in genomic DNA 1 and genomic DNA 2, respectively;
[0042] (iii) The InDel site that is positive in genomic DNA 1 and negative in genomic DNA 2 is used as the InDel site for detection.
[0043] In this invention, "genomic DNA 1" refers to genomic DNA extracted from cell therapy drugs (including genetically modified cells, cell derivatives, or their lysis products). "Genomic DNA 2" refers to genomic DNA extracted from peripheral blood, tissue, or other suitable samples of a subject (patient or experimental animal) before drug administration. The numbers "genomic DNA 1" and "genomic DNA 2" are used only for differentiation.
[0044] In some preferred embodiments of the present invention, the method further includes selecting a detection reagent based on the InDel site obtained in (iii).
[0045] In some embodiments of the present invention, the detection system of the InDel molecular marker library as described in the first aspect is used to form a digital PCR panel, which serves as a screening plate to screen for at least one InDel molecular marker that distinguishes genomic DNA 1 of a cell therapy drug and / or genomic DNA 2 of a subject before drug administration.
[0046] In some preferred embodiments of the present invention, the detection reagent is a reagent defined in the kit or chip as described in the second aspect.
[0047] In some embodiments of the present invention, the detection is performed using a kit or chip as described in the second aspect; and / or, the genomic DNA 1 and / or the genomic DNA 2 are derived from peripheral blood.
[0048] The fourth aspect of the present invention provides the use of the InDel molecular marker library as described in the first aspect in the preparation of products for detecting the pharmacokinetics of allogeneic cell therapy.
[0049] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.
[0050] This invention aims to provide an InDel molecular marker library and its applications. The InDel molecular marker library can be used for bioanalysis of pharmacokinetic (PK) data in clinical samples of allogeneic cell therapy drugs, particularly suitable for non-gene-edited cell therapy drugs. A multiplex InDel detection system based on digital PCR technology is constructed. The method is based on a digital PCR platform, using a detection panel containing the InDel molecular marker library (locus distributions across 22 chromosomes, supporting multi-locus design on the same chromosome). Using specific InDel detection primers and MGB probes, the copy number of InDel target sites in a sample can be absolutely quantified without standards (sensitivity as low as 5 copies / reaction). Population sampling simulation validation (301 / 501 individuals, repeated 20 times, constructing a "1 donor + 300 / 500 recipient" model) shows that the median coverage of the 30 InDel loci for recipients of different sizes approaches 1.0, and the data dispersion intervals are highly convergent, demonstrating that the method provided by this invention combines high coverage and discriminative stability across populations of different sizes.
[0051] In clinical applications, each subject can select at least one InDel detection system from this panel as a biomarker for donor cells (cell therapy drugs), quantifying the copy number of donor cells in the recipient, and realizing pharmacokinetic analysis of allogeneic cell therapy drug clinical samples. This invention provides a universal, efficient, and cross-population stable detection method for the bioanalysis of pharmacokinetics in allogeneic cell therapy drug clinical samples.
[0052] The reagents and raw materials used in this invention are all commercially available.
[0053] The significant advantages of this invention are as follows: The InDel molecular marker library provided by this invention can be applied to the bioanalysis of pharmacokinetic data in clinical samples of allogeneic cell therapy drugs. It can absolutely quantify the copy number of the InDel target in the sample without the need for standards, offering high population coverage and sensitivity as low as 5 copies / reaction. It provides an effective, reliable, and universal analytical method for the clinical pharmacokinetic analysis of cells without gene editing or with only a limited number of gene edits, and for cell and gene therapy (CGT) drugs, providing core molecular marker support for precise individual identification. Attached Figure Description
[0054] Figure 1 This is a comparative diagram showing the distribution of the coverage of the 30 InDel loci of the present invention in 300 and 500 individuals.
[0055] Figure 2Comparison of detection effects before and after optimization of Chr10 (268) probe (top is unoptimized, bottom is optimized). From left to right, the linearized plasmid of the reference sequence (double-duplicate well) and the linearized plasmid of deletion mutation (double-duplicate well) are shown.
[0056] Figure 3 Comparison of detection effects before and after optimization of Chr12 (638) probe (top is unoptimized, bottom is optimized). From left to right, the linearized plasmid of the reference sequence (double-duplicate well) and the linearized plasmid of deletion mutation (double-duplicate well) are shown.
[0057] Figure 4 Comparison of detection results before and after optimization of the Chr17 (953) probe (top: unoptimized, bottom: optimized). From left to right, the linearized plasmid of the reference sequence (double-duplicate well) and the linearized plasmid of deletion mutation (double-duplicate well) are shown. Detailed Implementation
[0058] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.
[0059] This invention discloses a method for analyzing the pharmacokinetics of clinical samples for cell therapy drugs, as shown in the following embodiments.
[0060] Example 1: Construction of a ddPCR detection system containing 30 InDels multiplex amplification units
[0061] 1. InDel target screening and primer / probe design
[0062] InDel loci were selected based on publicly available information from 2,504 samples in Phase III of the 1,000 Genomes Project (1KGP).
[0063] The information on the 30 InDel target sites and their corresponding fluorescent labeling information provided by this invention is shown in Table 1:
[0064] Table 1 InDel target and fluorescent labeling information
[0065]
[0066] Primers were designed using Primer3 Plus, with product lengths ranging from 80 to 200 bp. Primer specificity was checked using the BLAST tool. MGB probes were manually designed based on the InDel site, and IDT was used to evaluate the dimer and hairpin structures of the primers and probes. The primer and probe sequences are shown in Table 2.
[0067] Table 2 Primer and probe sequences
[0068]
[0069]
[0070]
[0071] 2. ddPCR premix
[0072] The ddPCR premix was prepared as shown in Table 3:
[0073] Table 3 Composition of ddPCR premix
[0074]
[0075] The total ddPCR amplification volume was 22 μL. The reaction system included InDel detection primers and probes (Sangon Biotech, Shanghai, China), with a working primer concentration of 400 nM and a working probe concentration of 250 nM. 11 μL of ddPCR Supermix for Probes (NodUTP) (Bio-Rad Laboratories, USA) was added, and the volume was brought up to 16.5 μL with nuclease-free water. 5.5 μL of genomic DNA was also included.
[0076] 3. Digital PCR panel layout, amplification, and reading
[0077] Prepare digital PCR panel screening plates according to the following layout (Table 4), and add the corresponding ddPCR premixed solutions prepared according to Table 3:
[0078] Table 4 PCR panel screening plate layout
[0079]
[0080] Note: Columns 1-8 are experimental columns; columns 9-12 are blank columns; PCR panel detection names are distinguished by the last three digits of the chromosome.
[0081] Genomic DNA was extracted from peripheral blood of individuals 1 and 2 (using EDTA-K2 anticoagulant, stored at -80℃) using a universal genomic DNA extraction kit with magnetic beads (Tiangen, Beijing, China). No more than 1 μg of genomic DNA from individuals 1 and 2 was added according to the following layout (Table 5). The PCR panel layout is shown in Table 5.
[0082] Table 5 PCR panel screening plate layout
[0083]
[0084] Genomic DNA can be diluted with nuclease-free water to a concentration not exceeding 0.2 ng / μL. Add 5.5 μL to the plate and heat-seal. After addition, vortex and centrifuge to generate droplets. Once droplet generation is complete, heat-seal the plate again and place it in a PCR amplification instrument. Amplify the plate according to the pre-set reaction program (95°C for 10 min; 94°C for 30 sec, 60°C for 1 min, 40 cycles, 98°C for 10 min, hold at 4°C). Place the 96-well plate in a droplet reader, set the fluorescence acquisition channel according to the layout, and then analyze the ddPCR results.
[0085] 4. Analysis method for digital PCR panel screening results:
[0086] Based on the results of the digital PCR panel screening, a positive ddPCR sample is represented by "1", and a negative ddPCR sample is represented by "0". Individual 1 represents the test sample, and Individual 2 represents the subject sample. When the test sample is positive and the subject sample is negative, the corresponding INDEL system can be used for pharmacokinetic analysis of the sample from Subject Individual 2. IF functions such as IF(A1=1, IF(A4=1, "No", "OK"), "NO"), IF(A2=1, IF(A5=1,"No", "OK"), "NO"), etc., can be used to make the judgment. "OK" indicates that the INDEL system can be used for pharmacokinetic analysis of the sample from Subject Individual 2. Table 6 shows the results of the digital PCR panel screening shown in Table 5, where columns 1-3 are the PCR results for Individual 1, and columns 4-6 are the PCR results for Individual 2.
[0087] Table 6 Results of PCR panel screening
[0088]
[0089] As shown in the table above, for individual 2, Chr1-770, Chr7-330, Chr10-268, Chr16-021, Chr19-770, and Chr21-553 can all be used as biomarkers for the test sample from individual 1 for subsequent bioanalysis of clinical samples.
[0090] Example 2: Optimization of probe and primer design
[0091] Taking the three InDel sites chr10 (268), chr12 (638), and chr17 (953) as examples, the technical difficulties and optimization effects overcome by the present invention in probe / primer design can be specifically demonstrated.
[0092] Reference sequence linear plasmids (used for Indel differentiation experiments) are linear plasmids carrying the complete wild-type gene sequence, without the target InDel mutant fragment, and serve as one of the templates for the amplification reaction. This plasmid is compatible with primers designed for the reference sequence, but because the probe targets the mutant sequence, it cannot initiate specific amplification. It is used to verify the effectiveness of distinguishing between wild-type and mutant sequences. Mutant linearized plasmids (used for Indel differentiation experiments) are plasmids that have been digested with enzymes to achieve a linear structure. They carry the target InDel mutant sequence and serve as the core template for the amplification reaction. This plasmid is compatible with both reference sequence primers and is complementary to probes targeting the mutant sequence, enabling efficient initiation of specific amplification and clearly indicating the presence of the mutant sequence.
[0093] like Figure 2 As shown in the ddPCR (digital droplet polymerase chain reaction) graph, the purple horizontal lines labeled "4843" and "4099" represent amplitude threshold lines. Their key significance lies in distinguishing between negative and positive droplet populations: droplets with amplitudes below this line (e.g., gray or black areas) have not undergone effective amplification of the target mutation sequence and are classified as negative; droplets with amplitudes above this line (e.g., densely distributed blue areas) have undergone specific amplification of the target mutation sequence and are classified as positive. These threshold lines are critical values determined through experimental verification and data analysis, used to clearly distinguish the amplitude differences between the two populations and are a crucial basis for determining the presence of the target indel mutation in the sample. For the chr10 (268) site (CTGT mutated to C), the initially designed mutant MGB probe (sequence TAGGCCACTGCTAACAACAGT, SEQ ID NO:121) was too long and produced a significant non-specific signal when binding to the reference sequence, interfering with genotype determination. By shortening the probe length, the optimized MGB probe (sequence CCACTGCTAACAACAG, SEQ ID NO: 35) showed a significant reduction in non-specific signal on the reference sequence, laying the foundation for subsequent differentiation.
[0094] like Figure 3 (The amplitude threshold lines are labeled “3007” and “2806” respectively.) As shown, for the chr12 (638) site (TTCA mutated to T), the initial mutant MGB probe (GTATTTCATTTCCTAGTGTGGC, SEQ ID NO: 122) not only had poor specificity, but also easily formed primer dimers and hairpin structures due to the sequence characteristics of the mutation site after attempting to shorten the length. By redesigning the probe after reverse complementation of the original target sequence (GAAAGTATTTCATTTCCT, SEQ ID NO: 123), the interference of dimers and hairpins was effectively eliminated, and the non-specific signal was significantly reduced.
[0095] like Figure 4 (The amplitude threshold lines are all labeled "9843") As shown, for the chr17 (953) site (CCA mutated to C), the initially designed primers were unable to complete effective PCR amplification because the target sequence contained multiple repetitive sequences and the primers themselves contained continuous complementary regions. By shortening the product fragment length and readjusting the primer binding region to avoid repetitive sequences and complementary regions, the optimized primers successfully amplified the target fragment, and finally achieved accurate differentiation between wild type and mutant type.
[0096] The design and optimization process of the above three sites proves that the InDel molecular marker library of the present invention needs to overcome the inherent defects of the sequence through targeted technical means, and effective detection can not be achieved by random selection, which fully reflects the creativity and practicality of the technical solution.
[0097] Example 3: Sensitivity, Intra-batch Precision, and Accuracy Study
[0098] To determine the quantitative range and sensitivity of the digital PCR InDel detection system, a chromosome 1 detection system was selected, using human genomic DNA as a standard to investigate its quantitative range and sensitivity. Specifically, the standard used was genomic DNA extracted from peripheral blood of healthy individuals: purity A260 / A280 1.8–2.0, no degradation, concentration calibrated (the concentration can be used to accurately quantify the human genome using a formula), and the genotypes for 30 InDel loci were known, serving as both a quantitative benchmark and a positive control. Since the samples to be tested were all human genomic DNA, essentially identical to the standard, after uniform pretreatment, there would be no significant difference in quantitative range, sensitivity, and accuracy.
[0099] Human genome standards were diluted to a theoretical concentration of 2 × 10⁻⁶. 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL, 2×10 0 copies / μL, 1.2×10 0 Five concentration points (copies / μL) were used as the standard curve; ULOQ (upper limit of quantitation) of 2×10⁻⁶ was set for each point. 4 copies / μL, HQC (high concentration quality control) 1.6×10 4 copies / μL, MQC (medium concentration quality control) 2×10 2 copies / μL, LQC (low concentration quality control) 2×10 0 copies / μL, LLOQ (lower limit of quantitation) 1.2×10 0The copies / μL represent five concentration levels used for precision and accuracy assessment. Five independent analytical batches were used, each containing one set of standard curve concentration points and three sets of parallel samples. Each set contained five validation samples at different concentrations (LLOQ, LQC, ULOQ, MQC, and HQC). Each sample was measured in duplicate, prepared according to the Chr1 detection system in Example 1, and subjected to ddPCR under the amplification conditions described in Example 1.
[0100] The results of the standard curve and quantification range are shown in Table 7.
[0101] Table 7. Results of Standard Curve and Quantitative Range
[0102]
[0103] The results of intra-batch precision and accuracy are shown in Table 8.
[0104] Table 8. Intra-batch precision and accuracy results
[0105]
[0106] The results of batch precision and accuracy are shown in Table 9.
[0107] Table 9. Results of inter-batch precision and accuracy
[0108]
[0109] Based on the above results, the quantitative limit of this digital PCR InDel detection system can be as low as 1.2 copies / μL, demonstrating good intra- and inter-batch precision and accuracy.
[0110] The detection performance (sensitivity, intra-assay precision, and accuracy) of this invention relies primarily on "probe design standards + a fixed reaction system," rather than specific InDel sites. If the probe meets the following criteria: BLAST-verified specificity (no cross-hybridization); Tm value-matched system (fully compatible with the enzyme activity and annealing temperature of the reaction system of this invention, ensuring stable amplification efficiency and not affecting the quantitative range); and consistent fluorescent / quenching groups (uniform signal), then considerable stability can be achieved.
[0111] The detection system of this invention is a "standardized method". The InDel site is only a detection target. As long as the probe is adapted to the standard of this system, the sensitivity, intra-batch precision and accuracy performance will not change due to different sites.
[0112] Example 4 Coverage Detection
[0113] For 30 InDel loci screened using digital PCR panels, the population of the 1000 Genomes Project (1KGP phase 3) was used as the target population. A replicate sampling strategy was employed: 301 or 501 individuals were randomly selected each time (repeated 20 times), one of whom was designated as the donor, and the remaining 300 or 500 as the recipients. The discriminative coverage of these 30 InDel loci for the recipients was calculated. Box plots are shown below. Figure 1 As shown, the horizontal axis is grouped into 30_300 (30 InDel sites, 300 receptors) and 30_500 (30 InDel sites, 500 receptors), and the vertical axis represents coverage. The thickest horizontal line in the box represents the median coverage, and the scatter plot and box characterize the data distribution characteristics.
[0114] Group 30-300: The median discrimination coverage was 1, indicating that in a half-repeated sampling experiment, the selected 30 InDel sites could completely distinguish the donor from all recipients; 50% of the results were concentrated in the range of 99.5%-100%, with a narrow fluctuation range and high reliability; the upper and lower limits extended to 99.2%-100%, and there were no outliers, indicating stable and nearly complete discrimination power.
[0115] Group 30-500: The median discrimination coverage was 1 (i.e., 100%), indicating that in half of the trials, the selected 30 InDel sites could completely distinguish between donors and all recipients; 50% of the results were concentrated in the range of 99.4%-100%, with a narrow fluctuation range, indicating reliable results; the upper and lower limits extended to 99.0%-100%, with only a very small number of outliers and no significant reduction in coverage, maintaining efficient and stable complete discrimination ability even when the recipient scale was expanded to 500 people.
[0116] In summary, the 30 loci provided by this invention can achieve 100% median coverage for a recipient population of 300-500 people, with small fluctuations and strong repeatability, fully demonstrating that it has efficient, stable and nearly complete differentiation technology effect, which can meet the needs of accurate donor-recipient differentiation in practical applications.
[0117] Based on the above analysis, the 30 InDel loci obtained through screening were analyzed using a repeated sampling method (301 / 501 individuals were selected, iterated 20 times, and divided into 1 donor + 300 / 500 recipient groups). The median coverage of both the 300 and 500 recipient groups was close to 1.0, and the data dispersion intervals were highly convergent. This result confirms that the specific InDel molecular marker library composed of 30 InDel loci provided by this invention achieves both high coverage for population differentiation and stability across different recipient population sizes, providing core molecular marker support for accurate individual identification.
[0118] The sequence of the region detected by the MGB probe containing InDel in this invention is shown in Table 10.
[0119] Table 10 Sequence List
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126] .
Claims
1. An InDel molecular marker library, characterized in that, The InDel molecular marker library contains 30 InDel sites selected from human chromosomes; the location information and mutation types of these 30 InDel sites relative to the reference genome hg19 are as follows: 。 2. The InDel molecular marker library as described in claim 1, characterized in that, The InDel molecular marker library consists of the 30 InDel sites.
3. A reagent kit or chip for detecting the pharmacokinetics of allogeneic cells, characterized in that, The kit or chip contains the InDel molecular marker library as described in claim 1 or 2 and / or reagents for detecting the InDel molecular marker library as described in claim 1 or 2.
4. The reagent kit or chip as described in claim 3, characterized in that, The reagent includes a probe for capturing the region where the InDel site is located; Preferably, the nucleotide sequence of the capture region of the probe is as shown in any one of SEQ ID NO: 91-SEQ ID NO:
120.
5. The reagent kit or chip as described in claim 3 or 4, characterized in that, The reagent comprises one or more probes selected from the following: nucleotide sequences such as SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: 86 and SEQ ID NO: The probe shown in Figure 89; Preferably, the reagent comprises nucleotide sequences such as SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 32, SEQ ID NO: 35, SEQ ID NO: 38, SEQ ID NO: 41, SEQ ID NO: 44, SEQ ID NO: 47, SEQ ID NO: 50, SEQ ID NO: 53, SEQ ID NO: 56, SEQ ID NO: 59, SEQ ID NO: 62, SEQ ID NO: 65, SEQ ID NO: 68, SEQ ID NO: 71, SEQ ID NO: 74, SEQ ID NO: 77, SEQ ID NO: 80, SEQ ID NO: 83, SEQ ID NO: 86 and SEQ ID NO: The probe shown in 89.
6. The reagent kit or chip as described in claim 4 or 5, characterized in that, The probe is an MGB probe, and the probe also contains a fluorescent group, a quenching group and / or a small groove conjugate; Preferably, the probe satisfies one or more of the following conditions: (1) The 5' end of the nucleotide sequence of the probe contains a fluorescent group; (2) The probe contains a quenching group and a minor groove conjugate at the 3' end of the nucleotide sequence; (3) The fluorescent group is FAM, ROX, TET, TAMRA, CY3, CY5, NED, VIC or HEX; (4) The quenching group is a non-luminescent quenching group, preferably TAMRA or BHQ; (5) The minor groove conjugate is a dihydrocyclopyrrole tripeptide.
7. The reagent kit or chip according to any one of claims 4-6, characterized in that, The reagent also contains primers for amplifying the InDel site; Preferably, the reagent comprises one or more primers selected from the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 4 ...47, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO NO: 45, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 88 and SEQ ID NO: Primer shown in Figure 90; More preferably, the reagent comprises one or more primer pairs selected from the following: SEQ ID NO: 1 and SEQ ID NO: 3; SEQ ID NO: 4 and SEQ ID NO: 6; SEQ ID NO: 7 and SEQ ID NO: 9; SEQ ID NO: 10 and SEQ ID NO: 12; SEQ ID NO: 13 and SEQ ID NO: 15; SEQ ID NO: 16 and SEQ ID NO: 18; SEQ ID NO: 19 and SEQ ID NO: 21; SEQ ID NO: 22 and SEQ ID NO: 24; SEQ ID NO: 25 and SEQ ID NO: 27; SEQ ID NO: 28 and SEQ ID NO: 30; SEQ ID NO: 31 and SEQ ID NO: 33; SEQ ID NO: 34 and SEQ ID NO: 36; SEQ ID NO: 37 and SEQ ID NO: 39; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO: 39; SEQ ID NO: 40 and SEQ ID NO: 42; SEQ ID NO: 43 and SEQ ID NO:
39. SEQ ID NO: 45; SEQ ID NO: 46 and SEQ ID NO: 48; SEQ ID NO: 49 and SEQ ID NO: 51; SEQ ID NO: 52 and SEQ ID NO: 54; SEQ ID NO: 55 and SEQ ID NO: 57; SEQ ID NO: 58 and SEQ ID NO: 60; SEQ ID NO: 61 and SEQ ID NO: 63; SEQ ID NO: 64 and SEQ ID NO: 66; SEQ ID NO: 67 and SEQ ID NO: 69; SEQ ID NO: 70 and SEQ ID NO: 72; SEQ ID NO: 73 and SEQ ID NO: 75; SEQ ID NO: 76 and SEQ ID NO: 78; SEQ ID NO: 79 and SEQ ID NO: 81; SEQ ID NO: 82 and SEQ ID NO: 84; SEQ ID NO: 85 and SEQ ID NO: 87; and, SEQ ID NO: 88 and SEQ ID NO:
90.
8. The reagent kit or chip according to any one of claims 3-7, characterized in that, The kit also includes a polymerase chain reaction (PCR) amplification reagent composition; and / or, the kit also includes reagents for extracting genomic DNA from samples.
9. A method for detecting the pharmacokinetics of allogeneic cell therapy, characterized in that, The method includes the step of detecting InDel sites in the sample to be tested; the InDel sites are defined in the InDel molecular marker library as described in claim 1 or 2; Preferably, the method is not for diagnostic purposes.
10. The method as described in claim 9, characterized in that, The detection is performed using a kit or chip as described in any one of claims 3-8; and / or, the sample to be tested is the genomic DNA of the subject after drug administration; Preferably, the genomic DNA is derived from peripheral blood; and / or, the detection is a PCR detection or a NGS-based detection. More preferably, the PCR detection system comprises: 300-600 nM primers, as defined in the kit or chip of claim 7, and / or, 250-300 nM probes, as defined in the kit or chip of any one of claims 3-8.
11. The method as described in claim 9 or 10, characterized in that, The method further includes pre-screening of InDel sites, which comprises one or more of the following steps: (i) Extract genomic DNA 1 of the cell therapy drug and / or genomic DNA 2 of the subject before administration; (ii) Detect the InDel molecular marker library as described in claim 1 or 2 in genomic DNA 1 and genomic DNA 2, respectively; (iii) The InDel sites that are positive in genomic DNA 1 but negative in genomic DNA 2 are used as the InDel sites for detection; Preferably, the method further includes selecting a detection reagent based on the InDel site obtained in (iii), preferably a reagent defined in the kit or chip as described in any one of claims 3-8; More preferably, the detection is performed using a kit or chip as described in any one of claims 3-8; and / or, the genomic DNA 1 and / or the genomic DNA 2 are derived from peripheral blood.
12. The use of the InDel molecular marker library as described in claim 1 or 2 in the preparation of products for detecting the pharmacokinetics of allogeneic cell therapies.