Biological treatment method for low-quality tobacco leaves, tobacco flavor and application of tobacco flavor

Abstract

The invention provides a biological treatment method for low-quality tobacco leaves, a tobacco flavor and application of the tobacco flavor, and relates to the technical field of biology. The biological treatment method of the low-quality tobacco leaves comprises the following steps: inoculating engineering bacteria into a culture medium containing a low-quality tobacco leaf water extract for culturing to obtain fermentation liquor, and then extracting the fermentation liquor by using ethyl acetate to obtain an extract; an ARO8 gene, an ARO10 gene and a YjgB gene are expressed by the engineering bacteria. By means of the biological treatment method, the cinnabar tobacco extract capable of remarkably increasing the fresh and sweet aroma of cigarettes and improving the sweet taste and texture of the oral cavity can be obtained. The method can be used for producing fresh and sweet flavor type tobacco extract spice products, and high-value treatment of low-quality cinnabar tobacco leaves is realized.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a biological treatment method for low-quality tobacco leaves, tobacco flavorings, and their applications. Background Technology

[0002] Tobacco fragments, powder, and low-quality tobacco leaves generated during cigarette production are largely discarded because they cannot be directly used in cigarette manufacturing, causing significant economic losses to the cigarette industry. Currently, the method for treating waste tobacco dust or low-quality tobacco leaves is to extract tobacco flavorings from them. However, low-quality tobacco leaves typically have obvious quality defects, such as high irritation, weak aroma, strong off-flavors, and poor taste, resulting in poor industrial applicability and low economic benefits for the extracted flavoring products. Furthermore, the types, contents, and proportions of aroma substances contained in low-quality tobacco leaves of different varieties, grades, and origins vary considerably, leading to significant differences in the sensory quality and effects of the extracted tobacco flavorings. Therefore, there is an urgent need to develop high-value production and application technologies specifically tailored to different types of low-quality tobacco leaves.

[0003] Microbial fermentation is a green and efficient method for processing low-quality tobacco leaves. It can reduce macromolecular substances in tobacco leaves that negatively impact sensory quality while increasing aroma compounds. This process involves a series of steps, including screening suitable microbial strains, selecting culture media, and optimizing fermentation conditions and purification processes. Different strains, culture media, and fermentation process parameters significantly affect the product composition, especially the aroma compounds. Furthermore, more of a single aroma compound is not necessarily better; variations in its content and proportion can significantly impact the aroma harmony and taste comfort of cigarettes. Therefore, for specific low-quality tobacco leaves, how to screen suitable fermentation strains, determine the optimal culture media composition and production process parameters, and then combine and integrate these parameters to obtain tobacco flavorings with the best sensory quality has become a hot and challenging issue in the research field of microbial fermentation technology for processing low-quality tobacco leaves and its application in cigarette flavoring.

[0004] In the tobacco industry, tobacco extracts prepared by different methods have different functions, such as improving or enhancing the aroma of tobacco products, increasing oral comfort, enhancing smoothness, and giving cigarettes a unique aroma. Currently, sensory evaluation of flavoring samples by professional cigarette tasters, referring to the YC / T 415—2011 standard and the sensory deviation reference method, is an important standard for evaluating the sensory quality of tobacco flavorings and the usability of cigarette products. Cinnabar tobacco is a new specialty variety developed by the tobacco industry in recent years. Its leaves, after roasting, exhibit cinnabar patterns and a unique flavor, making it suitable for the development of specialty cigarette products. However, low-quality cinnabar tobacco leaves produced during cigarette production suffer from low aroma intensity and mediocre quality, making them difficult to utilize in the cigarette industry and resulting in a significant waste of resources. Therefore, there is an urgent need to develop high-value application technologies for low-quality cinnabar tobacco leaves.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The primary objective of this invention is to provide a biological treatment method for low-quality tobacco leaves to solve the aforementioned technical problems.

[0007] A second objective of this invention is to provide a tobacco flavoring.

[0008] A third objective of this invention is to provide the application of the above-mentioned tobacco flavoring in enhancing the flavor of tobacco products.

[0009] To achieve the above objectives, the following technical solution is adopted: In a first aspect, the present invention provides a biological treatment method for low-quality tobacco leaves, comprising the following steps: The engineered bacteria were inoculated into a culture medium containing low-quality tobacco leaf water extract and cultured to obtain a fermentation broth. The fermentation broth was then extracted with ethyl acetate to obtain an extract. The engineered bacteria expression ARO8 Gene, ARO10 Genes and YjgB Genes; the stated ARO8 The nucleic acid sequence of the gene is shown in SEQ ID NO.1. ARO10 The nucleic acid sequence of the gene is shown in SEQ ID NO.2. YjgB The nucleic acid sequence of the gene is shown in SEQ ID NO.3.

[0010] As a further technical solution, the engineered bacteria include Escherichia coli.

[0011] As a further technical solution, the engineered bacteria carry an expression vector; The expression vector contains ARO8 Gene, ARO10 Genes and YjgB Gene; The expression vector includes pET28a.

[0012] As a further technical solution, the expression vector contains ARO8 Gene, ARO10 Genes and YjgB Gene expression cassettes; The method for preparing the expression cassette includes: using the Saccharomyces cerevisiae S288C genome as a template, and 28a-PE-F1 and 28a-PE-R1 as primers, PCR amplification is performed to obtain a cassette with homologous arms. ARO8 Gene; using the Saccharomyces cerevisiae S288C genome as a template, and 28a-PE-F2 and 28a-PE-R2 as primers, PCR amplification was performed to obtain genes with homologous arms. ARO10 Gene; using the *E. coli* BL21 genome as a template, and 28a-PE-F3 and 28a-PE-R3 as primers, PCR amplification was performed to obtain genes with homologous arms. YjgB Genes; will ARO8 , ARO10 and YjgB The gene was ligated end-to-end via fusion PCR to obtain the expression cassette. The nucleic acid sequence of 28a-PE-F1 is shown in SEQ ID NO.4; the nucleic acid sequence of 28a-PE-R1 is shown in SEQ ID NO.5; the nucleic acid sequence of 28a-PE-F2 is shown in SEQ ID NO.6; the nucleic acid sequence of 28a-PE-R2 is shown in SEQ ID NO.7; the nucleic acid sequence of 28a-PE-F3 is shown in SEQ ID NO.8; and the nucleic acid sequence of 28a-PE-R3 is shown in SEQ ID NO.9.

[0013] As a further technical solution, the inoculum size of the engineered bacteria is 0.5 vol%-10 vol%. The content of low-quality tobacco leaf water extract in the culture medium is 1 vol %-50 vol %.

[0014] As a further technical solution, the method for preparing the low-quality tobacco leaf water extract includes: mixing low-quality tobacco leaf powder with water, then performing water extraction under ultrasonic conditions, and obtaining the low-quality tobacco leaf water extract after solid-liquid separation.

[0015] As a further technical solution, the frequency of the ultrasound is 80-120 kHz and the duration is 20-30 min.

[0016] As a further technical solution, IPTG is added during the culture process to induce expression.

[0017] Secondly, the present invention provides a tobacco flavoring, which is obtained by the above-mentioned biological treatment method.

[0018] Thirdly, the present invention provides the application of the above-mentioned tobacco flavoring in enhancing the flavor of tobacco products.

[0019] Compared with the prior art, the present invention has the following beneficial effects: The biological treatment method for low-quality tobacco leaves provided by this invention can obtain cinnabar tobacco extract that can significantly increase the sweet aroma of cigarettes and improve oral sweetness and texture. This method can be used to produce sweet-aroma tobacco extract flavoring products, achieving high-value processing of low-quality cinnabar tobacco leaves. Attached Figure Description

[0020] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0021] Figure 1 : Graph of gas chromatography-mass spectrometry (GC-MS) detection results of low-quality cinnabar smoke extract; Figure 2 : GC-MS detection results of pET28a-PE fermentation products; Figure 3 : GC-MS detection results of products from different fermentation processes. Detailed Implementation

[0022] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0023] In a first aspect, the present invention provides a biological treatment method for low-quality tobacco leaves, comprising the following steps: The engineered bacteria were inoculated into a culture medium containing low-quality tobacco leaf water extract and cultured to obtain a fermentation broth. The fermentation broth was then extracted with ethyl acetate to obtain an extract. The engineered bacteria expression ARO8 Gene, ARO10 Genes and YjgB Gene; The ARO8 The nucleic acid sequence of the gene is shown in SEQ ID NO.1: The ARO10 The nucleic acid sequence of the gene is shown in SEQ ID NO.2: The YjgB The nucleic acid sequence of the gene is shown in SEQ ID NO.3:

[0024] The biological treatment method for low-quality tobacco leaves provided by this invention can obtain cinnabar tobacco extract that can significantly increase the sweet aroma of cigarettes and improve oral sweetness and texture. This method can be used to produce sweet-aroma tobacco extract flavoring products, achieving high-value processing of low-quality cinnabar tobacco leaves.

[0025] It should be noted that "low-quality tobacco leaves" in this invention refers to tobacco leaves that have been stored for more than five years and / or broken tobacco leaves that cannot be used for cigarette production.

[0026] In some alternative embodiments, the engineered bacteria include, but are not limited to, Escherichia coli, or other engineered bacteria well known to those skilled in the art.

[0027] In some alternative embodiments, the engineered bacteria carry an expression vector; The expression vector contains ARO8 Gene, ARO10 Genes and YjgB Gene; The expression vector includes, but is not limited to, pET28a, or other expression vectors known to those skilled in the art.

[0028] In some alternative embodiments, the expression vector contains ARO8 Gene, ARO10 Genes and YjgB Gene expression cassettes; The method for preparing the expression cassette includes: using the Saccharomyces cerevisiae S288C genome as a template, and 28a-PE-F1 and 28a-PE-R1 as primers, PCR amplification is performed to obtain a cassette with homologous arms. ARO8 Gene; using the Saccharomyces cerevisiae S288C genome as a template, and 28a-PE-F2 and 28a-PE-R2 as primers, PCR amplification was performed to obtain genes with homologous arms. ARO10 Gene; using the *E. coli* BL21 genome as a template, and 28a-PE-F3 and 28a-PE-R3 as primers, PCR amplification was performed to obtain genes with homologous arms. YjgB Genes; will ARO8 , ARO10 and YjgB The gene was ligated end-to-end via fusion PCR to obtain the expression cassette. The nucleic acid sequence of the 28a-PE-F1 is shown in SEQ ID NO.4: ACTTTAAGAAGGAGATATACATGACTTTACCTGAATCAAA (SEQ ID NO. 4).

[0029] The nucleic acid sequence of the 28a-PE-R1 is shown in SEQ ID NO.5: TCAATTGTAACAGGTGCCATGTATATCTCCTTCCTATTTGGAAATACCAAATT (SEQ ID NO. 5).

[0030] The nucleic acid sequence of the 28a-PE-F2 is shown in SEQ ID NO.6: CAAATAGGAAGGAGATATACATGGCACCTGTTACAATTGA (SEQ ID NO. 6).

[0031] The nucleic acid sequence of the 28a-PE-R2 is shown in SEQ ID NO.7: TAGCTTTTTATCGACATGTATATCTCCTTCCTATTTTTTATTTCTTTTAA (SEQ ID NO. 7).

[0032] The nucleic acid sequence of the 28a-PE-F3 is shown in SEQ ID NO. 8: AAAATAGGAAGGAGATATACATGTCGATGATAAAAAGCTA (SEQ ID NO. 8).

[0033] The nucleic acid sequence of the 28a-PE-R3 is shown in SEQ ID NO.9: CACCAGTCATGCTAGCCATATCAAAAATCGGCTTTCAACA (SEQ ID NO. 9).

[0034] In some alternative embodiments, the inoculum size of the engineered bacteria may be, for example, but not limited to, 0.5 vol%, 1 vol%, 5 vol%, or 10 vol%. The content of low-quality tobacco leaf water extract in the culture medium is 1 vol %-50 vol %, for example, but not limited to 1 vol %, 25 vol % or 50 vol %.

[0035] In some optional embodiments, the method for preparing the low-quality tobacco leaf water extract includes: mixing low-quality tobacco leaf powder with water, then performing water extraction under ultrasonic conditions, and obtaining the low-quality tobacco leaf water extract after solid-liquid separation.

[0036] In some alternative implementations, the frequency of the ultrasound may be, for example, but not limited to, 80 kHz, 100 kHz, or 120 kHz; The ultrasound duration can be, for example, but is not limited to, 20 min, 25 min, or 30 min.

[0037] In some alternative embodiments, the water extraction has a material-to-liquid ratio of 0.1 g / mL.

[0038] In some alternative implementations, IPTG is added during the culture process to induce expression.

[0039] In some alternative implementations, when cultured to OD 600 When the expression level reaches between 0.6 and 0.8, add IPTG to induce expression for 16-72 h.

[0040] In some alternative embodiments, the low-quality tobacco leaves include low-quality cinnabar tobacco leaves.

[0041] Secondly, the present invention provides a tobacco flavoring, which is obtained by the above-mentioned biological treatment method.

[0042] The tobacco flavoring provided by this invention can significantly increase the sweet aroma of cigarettes and enhance the sweetness and texture in the mouth.

[0043] Thirdly, the present invention provides the application of the above-mentioned tobacco flavoring in enhancing the flavor of tobacco products.

[0044] The tobacco flavoring provided by this invention can significantly increase the sweet aroma of cigarettes, enhance oral sweetness and texture, and therefore can be used in tobacco products.

[0045] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0046] Example 1 This implementation case was obtained through PCR amplification. ARO8 , ARO10 and YjgB Gene 。 Using the Saccharomyces cerevisiae S288C genome as a template, homologous arms were obtained using primers 28a-PE-F1:ACTTTAAGAAGGAGATATACATGACTTTACCTGAATCAAA and 28a-PE-R1:TCAATTGTAACAGGTGCCATGTATATCTCCTTCCTATTTGGAAATACCAAATT. ARO8The gene, 1503 bp in length, encodes 501 amino acid residues. Using the Saccharomyces cerevisiae S288C genome as a template, and through designed primers 28a-PE-F2: CAAATAGGAAGGAGATATACATGGCACCTGTTACAATTGA and 28a-PE-R2: TAGCTTTTTATCATCGACATGTATATCTCCTTCCTATTTTTTATTTCTTTTAA, a gene with homologous arms was obtained. ARO10 The gene, 1908 bp in length, encodes 636 amino acid residues. Using the *E. coli* BL21 genome as a template, primers 28a-PE-F3 (AAAATAGGAAGGAGATATACATGTCGATGATAAAAAGCTA) and 28a-PE-R3 (CACCAGTCATGCTAGCCATATCAAAAATCGGCTTTCAACA) were designed to obtain a gene with homologous arms. YjgB The gene is 1020 bp in length and encodes 340 amino acid residues. ARO8、ARO10 and YjgB The genes were added simultaneously as templates to the PCR system. Fusion was performed for 20 cycles without primers, followed by 15 cycles with 28a-PE-F1 and 28a-PE-R3 primers to complete the fusion PCR of the three genes. The fusion fragments were then compared with those obtained from the PCR process. Nco I and Where? The linearized pET28a plasmid obtained by double enzyme digestion was ligated and transformed into Escherichia coli BL21(DE3) host. The transformed cells were plated on kanamycin-resistant plates, yielding numerous single colonies containing the recombinant plasmid pET28a-PE. Recombinant strain PE was identified through antibiotic selection and sequencing.

[0047] Example 2 In this implementation case, low-quality cinnabar tobacco leaves were ground into powder using a pulverizer. 2 g of the powder was weighed using an electronic balance, added to 20 ml of deionized water, and mixed thoroughly in a 50 ml centrifuge tube. The mixture was then placed in an ultrasonic instrument and sonicated at 80-120 kHz for 25 min. The sonicated solution was filtered through four layers of gauze in a clean bench into a new sterile container. The resulting solution was the cinnabar tobacco leaf extract, denoted as "ZS".

[0048] Example 3 In this implementation, the recombinant strain pET28a-PE was transferred to kanamycin-resistant LB broth and cultured overnight at 37°C and 220 rpm in a shaker. A 1% inoculum was then added to 10 ml of LB broth to expand the culture until the bacterial culture reached OD. 600When the pH value is 0.6–0.8, 1 mM IPTG is added, and the fermentation product is obtained by induction in a shaker at 16°C and 110 rpm for 48 h. 2 ml of ethyl acetate is added to the fermentation broth, and the mixture is vortexed for 3 min. The mixture is then centrifuged at 5000 rpm for 5 min to obtain the upper ethyl acetate phase. This phase is transferred to a new EP tube, dried using a nitrogen blower, and then reconstituted with 2 ml of anhydrous ethanol by sonication until homogeneous. This phase is denoted as "PE".

[0049] Example 4 In this implementation case, the recombinant strain pET28a-PE was transferred to kanamycin-resistant LB liquid medium and cultured overnight at 37°C and 220 rpm in a shaker. A 1% inoculum was then added to 10 ml of LB medium containing 10% "ZS" to expand the culture to OD. 600 When the pH value is 0.6–0.8, 1 mM IPTG is added, and the mixture is induced for 48 h in a shaker at 16°C and 110 rpm to obtain the fermentation product. 2 ml of ethyl acetate is added to the fermentation broth, and the mixture is extracted by vortexing for 3 min. The ethyl acetate phase is then obtained by centrifugation at 5000 rpm for 5 min. This phase is transferred to a new EP tube, dried using a nitrogen blower, and then reconstituted with 2 ml of anhydrous ethanol by sonication until homogeneous. This is labeled "10% ZS-PE". A 1% inoculum is then inoculated into 10 ml of LB medium containing 1% "ZS" for expansion culture and induction. The product obtained by extraction and reconstitution using the above method is labeled "1% ZS-PE".

[0050] Example 5 In this implementation, the recombinant strain pET28a-PE was transferred to kanamycin-resistant LB broth and cultured overnight at 37°C and 220 rpm in a shaker. A 1% inoculum was then added to 10 ml of LB broth to expand the culture until the bacterial culture reached OD. 600 When the pH value is 0.6–0.8, 1 mM IPTG and 5 mM phenylalanine (Phe) are added, and the fermentation product is obtained by induction in a shaker at 16°C and 110 rpm for 48 h. 10% ZS is added and mixed thoroughly, then extracted with 2 ml ethyl acetate by vortexing for 3 min, followed by centrifugation at 5000 rpm for 5 min to obtain the upper ethyl acetate phase. This phase is transferred to a new EP tube, dried with nitrogen, and then reconstituted with 2 ml anhydrous ethanol by sonication until homogeneous. This is labeled "PE-Phe-10%ZS".

[0051] Example 6 In this implementation case, the tobacco flavorings ZS, PE, 10%ZS-PE, 1%ZS-PE, and PE-Phe-10%ZS obtained in Examples 2-5 were detected by gas chromatography-mass spectrometry (GC-MS). The product peaks were compared with the NIST-14 library for qualitative analysis. The results are shown below. Figure 1-Figure 3 The results show that ZS samples contain the aroma compound neophytadiene, while PE samples contain the aroma compounds phenylethanol and indole. The 10%ZS-PE, 1%ZS-PE, and PE-Phe-10%ZS samples obtained by different fermentation processes have different types and proportions of aroma compounds. Therefore, sensory evaluation was conducted to screen for biological treatment methods for low-quality tobacco leaves that have the effect of improving quality and aroma.

[0052] Example 7 In this implementation case, the tobacco flavorings ZS, PE, 10%ZS-PE, 1%ZS-PE, and PE-Phe-10%ZS obtained in Examples 2-5 were added to blank cigarettes at a dosage of 1 / 10,000. Referring to the YC / T 415—2011 standard and the sensory deviation reference method (State Tobacco Monopoly Administration. Sensory Evaluation Methods for Tobacco Products: YC / T 415—2011 [S]. Beijing: China Standards Press, 2012.), seven professionals conducted a sensory quality evaluation of eight indicators: aroma quality, aroma quantity, off-flavors, harmony, delicacy, mellowness, irritation, and residue. The sensory evaluation of the samples was obtained based on the scores (Table 1). Among them, 10%ZS-PE can enhance the sweet aroma, oral sweetness, and texture of low-quality cinnabar cigarettes, thus improving their quality and aroma.

[0053] Table 1

[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A biological treatment method for low-quality tobacco leaves, characterized in that, Includes the following steps: The engineered bacteria were inoculated into a culture medium containing low-quality tobacco leaf water extract and cultured to obtain a fermentation broth. The fermentation broth was then extracted with ethyl acetate to obtain an extract. The engineered bacteria expression ARO8 Gene, ARO10 Genes and YjgB Gene; The ARO8 The nucleic acid sequence of the gene is shown in SEQ ID NO.

1. ARO10 The nucleic acid sequence of the gene is shown in SEQ ID NO.

2. YjgB The nucleic acid sequence of the gene is shown in SEQ ID NO.

3.

2. The biological treatment method according to claim 1, characterized in that, The engineered bacteria include Escherichia coli.

3. The biological treatment method according to claim 1, characterized in that, The engineered bacteria carry an expression vector; The expression vector contains ARO8 Gene, ARO10 Genes and YjgB Gene; The expression vector includes pET28a.

4. The biological treatment method according to claim 3, characterized in that, The expression vector contains ARO8 Gene, ARO10 Genes and YjgB Gene expression cassettes; The method for preparing the expression cassette includes: using the Saccharomyces cerevisiae S288C genome as a template, and 28a-PE-F1 and 28a-PE-R1 as primers, PCR amplification is performed to obtain a cassette with homologous arms. ARO8 Gene; using the Saccharomyces cerevisiae S288C genome as a template, and 28a-PE-F2 and 28a-PE-R2 as primers, PCR amplification was performed to obtain genes with homologous arms. ARO10 Gene; using the *E. coli* BL21 genome as a template, and 28a-PE-F3 and 28a-PE-R3 as primers, PCR amplification was performed to obtain genes with homologous arms. YjgB Genes; will ARO8 , ARO10 and YjgB The gene was ligated end-to-end via fusion PCR to obtain the expression cassette. The nucleic acid sequence of 28a-PE-F1 is shown in SEQ ID NO.4; the nucleic acid sequence of 28a-PE-R1 is shown in SEQ ID NO.5; the nucleic acid sequence of 28a-PE-F2 is shown in SEQ ID NO.6; the nucleic acid sequence of 28a-PE-R2 is shown in SEQ ID NO.7; the nucleic acid sequence of 28a-PE-F3 is shown in SEQ ID NO.8; and the nucleic acid sequence of 28a-PE-R3 is shown in SEQ ID NO.

9.

5. The biological treatment method according to claim 1, characterized in that, The inoculum size of the engineered bacteria is 0.5 vol% - 10 vol%. The content of low-quality tobacco leaf water extract in the culture medium is 1 vol %-50 vol %.

6. The biological treatment method according to claim 1, characterized in that, The method for preparing the low-quality tobacco leaf water extract includes: mixing low-quality tobacco leaf powder with water, then performing water extraction under ultrasonic conditions, and obtaining the low-quality tobacco leaf water extract after solid-liquid separation.

7. The biological treatment method according to claim 6, characterized in that, The frequency of the ultrasound is 80-120 kHz, and the duration is 20-30 min.

8. The biological treatment method according to claim 1, characterized in that, IPTG was added during the culture process to induce expression.

9. A tobacco flavoring, characterized in that, It is obtained by the biological treatment method described in any one of claims 1-8.

10. The use of the tobacco flavoring according to claim 9 in enhancing the flavor of tobacco products.

Images