High-yield collagenase bacterium and application thereof

Abstract

The invention provides a high-yield collagenase bacterium and application thereof, and relates to the technical field of microorganisms. Comprising a high-yield collagenase bacterium, the classification name of the high-yield collagenase bacterium is Bacillus subtilis F, the high-yield collagenase bacterium is preserved in China Center for Type Culture Collection on August 19, 2025, the preservation number of the high-yield collagenase bacterium is CCTCC No: M 20251854, and the preservation address of the high-yield collagenase bacterium is No. 299 on eight road, Wuchang District, Wuhan City, Hubei Province. The bacillus subtilis belongs to bacillus subtilis, has the characteristic of high yield of collagenase, and can grow in an inorganic salt culture medium taking chromium leather shavings as a unique carbon and nitrogen source, so that the chromium leather shavings are efficiently degraded, and the bacillus subtilis is applied to treatment of solid waste chromium leather shavings in leather factories; in addition, the strain has the characteristic of high temperature resistance, so that the strain has good expandability in practical application.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically, to a high collagenase-producing bacterium and its applications. Background Technology

[0002] my country generates 300,000 tons of chromium-containing solid waste annually during leather production. Its main component is chromium-containing leather shavings, which are produced from multiple trimming, leveling, and sanding processes during the tanning and cutting stages. The amount of chromium-containing leather solid waste is large, and its treatment and utilization are difficult. Moreover, it is included in the "National Hazardous Waste List". How to properly handle leather shavings is a key issue for achieving the sustainable development of the leather industry.

[0003] Traditional methods for treating chromium-containing solid waste include incineration, landfill, and hydrolysis. During incineration and landfill, trivalent chromium may convert to highly toxic hexavalent chromium, resulting in the waste of biomass resources and environmental pollution. Hydrolysis, which separates chromium from collagen in chromium leather shavings using acid, alkali, oxidation, enzymatic, or alternating acid-alkali methods, is relatively complex, and the chromium removal process leads to environmental pollution and increased treatment costs. Therefore, finding more efficient, cleaner, and cost-effective methods for treating chromium leather shavings is extremely important.

[0004] Collagenase is a class of enzymes that hydrolyze collagen, one of the most abundant structural proteins in living organisms, widely found in animal skin, bones, blood vessels, and other tissues. Collagenase has wide applications in medicine, food, and industry. In recent years, the degradation of chromium-bearing leather shavings by collagenase-producing microorganisms has become a green and environmentally friendly treatment method. By degrading the collagen structure in leather, this method effectively breaks down and removes organic matter from leather shavings, reducing solid waste and facilitating chromium recovery.

[0005] Based on the significant advantages of microbial technology, such as mild conditions, low energy consumption, low emissions, and high efficiency, the use of strains that can produce collagenase provides a green and sustainable path for treating chromium-containing leather solid waste generated in the leather industry. Summary of the Invention

[0006] The purpose of this invention is to provide a high-producing collagenase bacterium. This bacterium has the characteristic of producing high levels of collagenase and can grow in an inorganic salt culture medium with chromium leather scraps as the sole carbon and nitrogen source, thereby efficiently degrading chromium leather scraps. It can be applied to the treatment of solid waste chromium leather scraps in tanneries. In addition, this strain has the characteristic of high temperature resistance, so it has good scalability in practical applications.

[0007] The technical problem solved by this invention is achieved by the following technical solution.

[0008] On the one hand, embodiments of this application provide a high-producing collagenase bacterium, whose classification name is Bacillus subtillsF was deposited on August 19, 2025 at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No:M 20251854, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0009] Furthermore, the 16S DNA sequence of the aforementioned high collagenase-producing bacteria is shown in SEQ ID No. 1:

[0010] Secondly, the embodiments of this application provide the application of the above-mentioned high collagenase-producing bacteria in the degradation of chrome leather scraps; Furthermore, the aforementioned high-collagenase-producing bacteria exhibit high heat resistance, retaining enzyme activity at 42-57℃.

[0011] Thirdly, embodiments of this application provide a bacterial solution containing the aforementioned high-collagenase-producing bacteria.

[0012] Compared with the prior art, the embodiments of the present invention have at least the following advantages or beneficial effects: 1. This invention screens and identifies a high-producing collagenase bacterium that can directly degrade chromium leather scraps without producing Cr during the degradation process. 6+ It can be applied to the treatment of solid waste chromium leather scraps in tanneries; 2. The high-yield collagenase bacteria provided by this invention have high heat resistance and still have high enzyme activity at 42-57℃, which can accelerate the degradation of collagen; and this temperature range can effectively inhibit the growth of other bacteria, further enhancing the competitive advantage of the collagenase bacteria. Attached Figure Description

[0013] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 This is a colony morphology diagram of collagenase bacteria in an embodiment of the present invention; Figure 2 This is a phylogenetic diagram of collagenase bacteria in an embodiment of the present invention; Figure 3 This is a comparison diagram of the growth of collagenase bacteria in the embodiments of the present invention; Figure 4 This is a comparative diagram of the recycling and degradation of solid waste by collagenase bacteria in an embodiment of the present invention. Detailed Implementation

[0015] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0016] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to specific embodiments.

[0017] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0018] Example 1 This embodiment provides a high-collagenase-producing bacterium, which is obtained through the following steps: Obtaining, isolating, and purifying the bacterial strain: A certain amount of bacterial suspension was taken from the glycerol tube culture stored at -80℃ and inoculated onto the surface of a pre-prepared LB solid medium plate. Purification was performed by streaking, and the plate was incubated at 37℃. Then, well-dispersed, morphologically typical, single, isolated colonies at the edge of the plate were picked and streaked again. This step was repeated until only colonies with a single morphological characteristic were present on the plate. Finally, morphological identification of the colonies was performed, and the results are as follows: Figure 1 As shown in the image, on the plate, the colonies are round, milky white, and have smooth edges. Figure 1 As shown in -a, under an optical microscope, the strain appears as a long rod shape, such as... Figure 1 -b and Figure 1 -c is shown.

[0019] 2. Verification of strain growth and enzyme production capacity: Growth status: such as Figure 3 As shown, the strain can grow in a pH range of 5–9 and a temperature range of 25–52°C, indicating that it has good environmental adaptability and tolerance. Furthermore, subsequent experiments revealed that this strain grows well in various conventional bacterial culture media (such as LB and NB media).

[0020] Enzyme production capacity: The purified strain was seeded on LB solid medium containing gelatin and incubated at 37°C for 24 h. Adding acidic mercuric reagent to the plate resulted in the observation of a clear zone around the colonies. Inoculating the strain into NB medium and incubating at 37°C for 8 h yielded 5–8 × 10⁻⁶ enzymes. 8 A seed culture of CFU / mL was inoculated into the enzyme-producing fermentation medium at a 1% inoculum size and cultured at 37℃ and 200 r / min for 48 h. The enzyme activity of the fermentation broth was then measured. The results showed that the collagenase activity was 198.65 U / mL.

[0021] The enzyme-producing fermentation medium is formulated as follows: 2% glucose, 1% tryptone, 0.15% yeast extract, 0.005% CaCl2, 0.025% MgSO4·6H2O, 0.2% K2HPO4, 0.05% KH2PO4, and pH adjusted to 7.2±0.2.

[0022] 3. Strain preservation: Single colonies from the agar plate were transferred to NB medium and incubated for 12 h. After centrifugation, the colonies were resuspended in physiological saline and then mixed with 60% glycerol in equal proportions in cryovials. The cryovials were then numbered and stored at -80°C.

[0023] 4. The obtained high-collagenase-producing bacteria were analyzed to determine their species and genomic DNA. The steps included: ① The high-collagenase-producing bacterial strain was re-spread onto NB medium and incubated at 37°C for 12 hours. Single colonies were selected for DNA extraction. The DNA extraction steps included: Collect 1.0 × 10⁻⁶ units in a 2 ml centrifuge tube. 9 (1 ml bacterial culture OD) 600 For bacterial cultures of 1-1.5 g, centrifuge at 12,000 × g for 30 s and discard the supernatant. Resuspend the precipitate in 150 μl of Buffer S containing RNase A. Add 20 μl of lysozyme stock solution, mix well, and incubate at room temperature for 5 min. Add 30 μl of 0.25 M EDTA (pH 8.0), mix well, and incubate on ice for 5 min. Add 450 μl of Buffer GA, vortex for 15 s, and incubate at 65 °C for 10 min. Add 400 μl of Buffer GB and 1 ml of Buffer DV (pre-chilled at 4 °C), mix vigorously, and centrifuge at 12,000 × g for 2 min. Discard the upper phase as much as possible, retaining the interphase precipitate and lower phase. Add 1 ml of Buffer DV (pre-chilled at 4 °C), mix vigorously, and centrifuge at 12,000 × g for 2 min. Discard the upper phase and transfer the lower phase to a filter (placed in a 2 ml centrifuge tube). Centrifuge at 12,000 × g for 1 min. Discard the filter. Add 400 μl of Buffer BV to the filtrate and mix well. Place the preparation tube in a 2 ml centrifuge tube, transfer the mixture from step 8 into the preparation tube, and centrifuge at 12,000 ×g for 1 min. Discard the filtrate. Place the preparation tube back into the original 2 ml centrifuge tube, add 500 μl of Buffer W1, and centrifuge at 12,000 ×g for 1 min. Discard the filtrate. Place the preparation tube back into the original 2 ml centrifuge tube, add 700 μl of Buffer W2, and centrifuge at 12,000 ×g for 1 min. Wash again with 700 μl of Buffer W2 using the same method. Discard the filtrate. Place the preparation tube back into the original 2 ml centrifuge tube and centrifuge at 12,000 ×g for 1 min. Place the preparation tube in another clean 1.5 ml centrifuge tube, add 100-200 μl of Eluent or deionized water to the center of the silica membrane, and incubate at room temperature for 1 min. Elute the DNA by centrifuging at 12,000 ×g for 1 min.

[0024] ② Bacterial genome PCR amplification: Gently tap the eluted DNA to mix, briefly centrifuge to collect the droplets on the tube wall to the bottom, and perform PCR reaction on a PCR amplification instrument. Primer sequences 27F and 1492R are shown in SEQ ID No. 2 and SEQ ID No. 3, and the reaction conditions are as follows: SEQ ID No.2: AGAGTTTGATCCTGGCTCAG SEQ ID No.3: GGTTACCTTGTTACGACTT Table 1 Primer Design

[0025] Table 2 PCR Amplification Reaction System

[0026] After the reaction was complete, 3 μl of the PCR product was subjected to 1% agarose gel electrophoresis to confirm the PCR amplification fragment.

[0027] ③ Recovery of PCR products PCR products were recovered using the AxyPrep DNA Gel Extraction Kit. The specific procedures were performed according to the kit's instructions, as follows: Under UV light, cut the agarose gel containing the target DNA into a clean centrifuge tube and weigh it. Add 3 gel volumes of Buffer DE-A, mix well, and heat at 75°C until the gel block is completely melted. Add 0.5 volumes of Buffer DE-A of Buffer DE-B and mix well; when the isolated DNA fragment is less than 400 bp, add 1 gel volume of isopropanol. Transfer the mixture to a DNA preparation tube and centrifuge at 12,000 ×g for 1 min. Discard the filtrate. Place the preparation tube back into a 2 ml centrifuge tube, add 500 μl of Buffer W1, centrifuge at 12,000 ×g for 30 s, and discard the filtrate. Place the preparation tube back into a 2 ml centrifuge tube, add 700 μl of Buffer W2, centrifuge at 12,000 ×g for 30 s, and discard the filtrate. Repeat the same process with 700 μl of Buffer W2 and centrifuge at 12,000 ×g for 1 min. Place the preparation tube back into a 2 ml centrifuge tube and centrifuge at 12,000 × g for 1 min. Place the preparation tube into a clean 1.5 ml centrifuge tube (provided in the kit), add 25–30 μl of deionized water to the center of the membrane, and incubate at room temperature for 1 min. Centrifuge at 12,000 × g for 1 min to elute the DNA.

[0028] ④ Sequencing and Analysis The purified PCR products of each bacterial strain were used for DNA sequencing using an ABI3730-XL sequencer.

[0029] ⑤ Sequence analysis The obtained sequence results were compared with those obtained from the National Center for Biotechnology Information (NCBI) in the United States. Highly similar type strains were selected as reference strains to construct a phylogenetic tree. The 16S rRNA gene phylogenetic tree was constructed using MEGA software with a bootstrap value of 1000. The phylogenetic tree is shown below. Figure 2 Based on the comparison results and phylogenetic tree, strain F is classified as Bacillus subtilis (Bacillus subtilis). Bacillus subtilis The 16S rRNA sequence of this strain is shown in SEQ ID NO:1. This strain was deposited on August 19, 2025 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number CCTCC NO: M 20251854, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0030] Example 2 This embodiment, based on Example 1, further verifies the degradation effect of high collagenase-producing bacteria on chromium leather scraps, including the following steps: 1. Culture medium preparation and sterilization: Prepare seed culture medium and inorganic salt culture medium. Add 10-100 g / L of chromium leather scraps to the inorganic salt culture medium, and then put it into an autoclave to complete the sterilization operation to ensure that the culture medium is sterile and free of impurities.

[0031] The seed culture medium was NB medium, and the inorganic salt culture medium formula was as follows: NH4NO3 0.1%, NaCl 0.1%, CaCl2 0.005%, MgSO4·6H2O 0.025%, K2HPO4 0.2%, KH2PO4 0.05%, pH adjusted to 7.2±0.2.

[0032] 2. Activation of the strain: High-collagenase-producing bacteria were retrieved from cryopreservation tubes and revitalized by streak plating on LB agar plates. The plates were incubated at 37 °C for 1 day. Healthy strains were then picked and cultured in LB liquid medium at 37 °C, 150 rpm, and shaken for 8 hours. The culture was then transferred to sterile 50 mL centrifuge tubes and centrifuged at 8000 rpm for 6 minutes. The supernatant was discarded, and the cells were resuspended in sterile water and adjusted to OD200. 600 =0.8~1.0.

[0033] 3. Solid waste recycling and degradation: A high collagenase-producing bacterial strain was set up as the inoculation group, and the control group was inoculated with sterile water. Each group was repeated 3 times, for a total of 6 groups.

[0034] The experimental group was inoculated into the fermentation system at a 1% inoculum rate. The fermentation system was observed regularly. After the solid waste in the system had completed degradation, new solid waste was added to continue the degradation process. This process was repeated until the fermentation system reached the upper limit of solid waste degradation. The control group (CK group) used sterile water treatment as a reference. The amount of leather shavings added to the experimental group was 20 g / L. The results after 16 days of operation are as follows: Figure 4 As shown: 4. Evaluation of chrome leather shavings degradation effect under a temperature gradient of 42–57℃: Six culture conditions were set up: 30℃, 37℃, 42℃, 47℃, 52℃ and 57℃; the control group was inoculated with sterile water instead of bacterial solution. Three biological replicates were set up for each group, for a total of 18 groups.

[0035] The experimental groups were inoculated into the fermentation system at a 1% inoculum size and cultured on a constant-temperature shaker (150 rpm) at the corresponding temperature. Dry weight loss was calculated after 3 days of culture. Aseptic operation and consistent light and aeration conditions were maintained throughout the culture process. The experimental results are shown in Table 3. Table 3 Degradation rate (%) at different temperatures

[0036] As shown in Table 3, the high collagenase-producing bacteria exhibited the highest degradation rate in the temperature range of 37-42℃, but could still degrade at 57℃, indicating that the high collagenase-producing bacteria still had activity at a high temperature of 57℃.

[0037] 5. Chromium release from the supernatant during degradation: The chromium content in the supernatant was monitored by taking samples at regular intervals. The total chromium content was determined by inductively coupled plasma optical emission spectrometry (ICP-OES), and Cr(VI) was determined by the diphenylcarbazide colorimetric method. The results are shown in Table 4. Table 4. Changes in Cr content in the supernatant during degradation.

[0038] A Cr(VI) value of 0 indicates that hexavalent chromium was not detected. It can be seen that the total chromium content in the supernatant showed a continuous decreasing trend over time, further demonstrating that high-collagenase-producing bacteria can significantly reduce the chromium content in wastewater.

[0039] In summary, the embodiments of the present invention provide a high-collagenase-producing bacterium and its application. A high-collagenase-producing bacterium was screened and identified, which can directly degrade chromium leather scraps without producing Cr during the degradation process. 6+ It can be applied to the treatment of solid waste chromium leather scraps in tanneries; The high-producing collagenase bacteria provided by this invention have high heat resistance and still have high enzyme activity at 42-57℃, which can accelerate the degradation of collagen; and this temperature range can effectively inhibit the growth of other bacteria, further enhancing the competitive advantage of the collagenase bacteria.

[0040] The embodiments described above are some, but not all, embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

Claims

1. A high-collagenase-producing bacterium, characterized in that, Category name Bacillus subtills F was deposited on August 19, 2025 at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC No:M 20251854, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. The high collagenase-producing bacteria according to claim 1, characterized in that, Its 16sDNA is shown in SEQ ID No.

1.

3. The application of the high collagenase-producing bacteria as described in claim 2 in the degradation of chrome leather scraps.

4. The application according to claim 3, characterized in that, The high-collagenase-producing bacteria have high heat resistance and retain enzyme activity at 42-57℃.

5. A bacterial solution, characterized in that, It contains a high collagenase-producing bacterium as described in claim 1.

Images