Application of molecular chaperone ycdY and mutant thereof in increasing yield of L-threonine

By modifying the molecular chaperone ycdY of Escherichia coli, increasing its expression level and activity, or mutating it to ycdYC8G, the production process of L-threonine was optimized, solving the problem of low production efficiency of Escherichia coli and achieving a significant increase in L-threonine yield and the production of various amino acids.

CN121780401APending Publication Date: 2026-04-03NINGXIA EPPEN BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-26
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing Escherichia coli strains have low efficiency in producing L-threonine, and it is necessary to increase the yield of strains to meet market demand.

Method used

By upregulating the expression level and/or activity of the molecular chaperone ycdY, expressing the molecular chaperone ycdYC8G, or mutating ycdY to ycdYC8G, the metabolic pathway of E. coli can be optimized to increase L-threonine production.

Benefits of technology

It significantly improved the L-threonine production capacity of Escherichia coli and enhanced the production capacity of various amino acids and other products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention discloses an application of a molecular chaperone ycdY and a mutant thereof in increasing the yield of L-threonine. Experiments prove that the L-threonine production capacity of escherichia coli can be remarkably improved by up-regulating the expression quantity of a molecular chaperone ycdY in escherichia coli, overexpressing a molecular chaperone ycdY mutant-molecular chaperone ycdYC8G or mutating the 8th cysteine residue from the N terminal in the amino acid sequence of the molecular chaperone ycdY into a glycine residue; the amino acid sequence of the molecular chaperone ycdY is as shown in SEQ ID No. 5, and the amino acid sequence of the molecular chaperone ycdYC8G is as shown in SEQ ID No. 9. The method has an important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of molecular chaperone ycdY and its mutants in increasing L-threonine production. Background Technology

[0002] L-Threonine is a limiting amino acid that promotes the development of mammalian mammary cells, improves the immune status of animals, and accelerates muscle tissue repair. It is widely used in the pharmaceutical, food, and feed industries. Currently, L-Threonine is mainly produced industrially through microbial fermentation. With the increasing market demand for L-Threonine, researchers are increasingly focusing on optimizing the fermentation performance of production strains and developing more economical and efficient fermentation processes to improve threonine production efficiency.

[0003] The application of *E. coli* in threonine production can be traced back to the late 20th and early 21st centuries. With advancements in biotechnology, scientists discovered that by modifying *E. coli* through metabolic engineering, L-threonine could be produced efficiently. The application of metabolic engineering technology has made *E. coli* the primary strain for industrial L-threonine production, characterized by its short growth cycle, high cell strength, and low equipment requirements.

[0004] In Escherichia coli, the synthesis of L-threonine begins with aspartic acid and is gradually converted to L-threonine through a series of enzymatic reactions. These reactions are controlled by a variety of enzymes, and changes in each step of the metabolic pathway affect the system's parameters and metabolic flux.

[0005] Molecular chaperone YcdY is a cofactor of proteins that transport across the cell membrane. It binds to specific or non-specific proteins, protecting them from proteolytic degradation in vivo. Its effect on L-threonine production has not yet been reported. Summary of the Invention

[0006] The purpose of this invention is to improve the L-threonine production of the strain.

[0007] This invention first protects an engineered bacterium, which may include Escherichia coli that has undergone one or more of the following modifications in vivo; A1) Upregulates the expression level and / or activity of the molecular chaperone ycdY; A2) Expression of molecular chaperone ycdY C8G ; A3) Mutate the molecular chaperone ycdY described in A1) into the molecular chaperone ycdY. C8G .

[0008] The aforementioned engineered bacteria are generally applicable to all Escherichia coli, with a preference for Escherichia coli capable of producing L-threonine; however, no further limitations are made here. Specifically, the Escherichia coli may be Escherichia coli capable of producing L-threonine (…). Escherichia coli YP0158 CGMCC No.25404. The *E. coli* mentioned may specifically be *E. coli* W3110. *E. coli* W3110 produces a low amount of L-threonine and is generally not used for L-threonine production.

[0009] In the above-mentioned engineered bacteria, the molecular chaperone ycdY can be C1, C2, or C3. C1) contains at least the amino acid sequence shown in SEQ ID No. 5; C2) A protein with 98% or more identity and the same function as C1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of C1). C3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2).

[0010] The phrase "having 98% or more of the sameness as C1" can specifically mean having 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% of the sameness as C1).

[0011] In the above-mentioned engineered bacteria, the molecular chaperone ycdY C8G It may include at least one of the following: B1) The protein obtained by mutating the cysteine ​​residue at position 8 in the amino acid sequence of the molecular chaperone ycdY; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in B1).

[0012] Among the aforementioned engineered bacteria, the preferred molecular chaperone is ycdY. C8G It may include a protein obtained by mutating the cysteine ​​residue at position 8 of the amino acid sequence of the molecular chaperone ycdY to a glycine residue.

[0013] Among the aforementioned engineered bacteria, the preferred molecular chaperone is ycdY. C8G It may contain an amino acid sequence as shown in SEQ ID No. 9.

[0014] The engineered bacteria mentioned above can specifically be Escherichia coli that has been modified in vivo using A1), A2) or A3) methods.

[0015] The engineered bacteria obtained by modifying E. coli in vivo using A1) can specifically be the recombinant bacteria W3110- mentioned in the examples.Ptrc-ycdY Or recombinant bacteria YPThr- Ptrc - ycdY .

[0016] The engineered bacteria obtained by modifying E. coli (A2) in vivo can specifically be the recombinant bacteria W3110- mentioned in the examples. Ptrc - ycdY C8G Or recombinant bacteria YPThr- Ptrc - ycdY C8G .

[0017] The engineered bacteria obtained by modifying E. coli in vivo using A3 can specifically be the recombinant bacteria W3110- mentioned in the examples. ycdY C8G Or recombinant bacteria YPThr- ycdY C8G .

[0018] In A2) above, the expression can be an overexpression.

[0019] This invention also protects the molecular chaperone ycdY C8G It may include at least one of the following: B1) The protein obtained by mutating the cysteine ​​residue at position 8 in the amino acid sequence of the molecular chaperone ycdY; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in B1).

[0020] The molecular chaperone ycdY described above can be C1), C2), or C3. C1) contains at least the amino acid sequence shown in SEQ ID No. 5; C2) A protein with 98% or more identity and the same function as C1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of C1). C3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2).

[0021] The phrase "having 98% or more of the sameness as C1" can specifically mean having 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% of the sameness as C1).

[0022] Any of the above-described molecular chaperones ycdY C8G It may include a protein obtained by mutating the cysteine ​​residue at position 8 of the amino acid sequence of the molecular chaperone ycdY to a glycine residue.

[0023] Any of the above-described molecular chaperones ycdY C8G It may contain an amino acid sequence as shown in SEQ ID No. 9.

[0024] Specifically, the amino acid sequence of the molecular chaperone ycdY is shown in SEQ ID No. 5. The molecular chaperone ycdY C8G The amino acid sequence is shown in SEQ ID No. 9.

[0025] Encoding any of the above-described molecular chaperones ycdY C8G Nucleic acid molecules or expression cassettes, recombinant vectors and / or recombinant microorganisms containing said nucleic acid molecules are also within the scope of protection of this invention.

[0026] Any of the above-mentioned nucleic acid molecules may contain either D1 or D2. D1) A DNA molecule containing the coding sequence shown in SEQ ID No. 8; The nucleotide sequence defined by D2) has 75% or more identity with that defined by D1) and encodes the molecular chaperone ycdY. C8G DNA molecules.

[0027] The nucleic acid molecule mentioned above can specifically be D1 or D2.

[0028] Specifically, the nucleotide sequence of any of the above-described nucleic acid molecules may be as shown in SEQ ID No. 8.

[0029] The aforementioned identity refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or the amino acid sequences of two protein molecules in molecular evolution studies.

[0030] The recombinant microorganism containing the aforementioned nucleic acid molecule can specifically be the recombinant bacterium W3110 mentioned in the examples. Ptrc-ycdY Recombinant strain W3110- ycdY C8G Recombinant strain W3110- Ptrc - ycdY C8G Recombinant bacteria YPThr- Ptrc - ycdY, Recombinant bacteria YPThr- ycdY C8G Or recombinant bacteria YPThr- Ptrc - ycdY C8G .

[0031] Any of the above-mentioned recombinant bacteria W3110- Ptrc-ycdY It is the genome of Escherichia coli W3110 represented by SEQ ID No. 1adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3 from position 501 to 1129 from the 5' end, while keeping the other nucleotide sequences of the Escherichia coli W3110 genome unchanged, resulting in recombinant Escherichia coli.

[0032] Any of the above-mentioned recombinant bacteria W3110- ycdY C8G It is the genome of Escherichia coli W3110 ycdY Gene mutation ycdY C8G The recombinant E. coli was obtained by extracting the gene while keeping other nucleotide sequences of the E. coli W3110 genome unchanged. Recombinant strain W3110- ycdY C8G The genome contains ycdY C8G Genes that do not contain wild-type genes. ycdY Gene.

[0033] Any of the above-mentioned recombinant bacteria W3110- Ptrc - ycdY C8G It is the genome of Escherichia coli W3110 represented by SEQ ID No. 1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10, positions 501-1129 from the 5' end, while keeping the other nucleotide sequences of the *E. coli* W3110 genome unchanged, resulting in recombinant *E. coli*. Recombinant strain W3110- Ptrc - ycdY C8G The genome contains wild-type ycdY Genes and overexpression ycdY C8G Genes (from) Ptrc (Startup sub-boot).

[0034] Any of the above-mentioned recombinant bacteria YPThr- Ptrc-ycdY It is Escherichia coli ( Escherichia coli The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3, positions 501-1129 from the 5' end, while maintaining Escherichia coli (E. coli). Escherichia coli The recombinant *E. coli* strain YP0158 (CGMCC No. 25404) was obtained with the other nucleotide sequences of its genome unchanged. The recombinant strain YPThr- Ptrc-ycdY The genome contains wild-type ycdY Genes and overexpression ycdY Genes (from) Ptrc(Bootbox startup) Two copies.

[0035] Any of the above-mentioned recombinant bacteria YPThr- ycdY C8G It is Escherichia coli ( Escherichia coli YP0158 CGMCC No.25404 genome ycdY Gene mutation ycdY C8G Genes and maintain Escherichia coli ( Escherichia coli The recombinant E. coli with YP0158 CGMCC No.25404 and other nucleotide sequences of the genome remained unchanged was obtained. ycdY C8G The nucleotide sequence of the gene is shown in SEQ ID No. 8, and the amino acid sequence encoding the molecular chaperone ycdY is shown in SEQ ID No. 9. C8G . ycdY C8G Genes are ycdY The mutation at nucleotide position 22 of the gene, T, is replaced by G, which in turn causes the molecular chaperone ycdY to mutate from cysteine ​​to glycine at position 8 from the N-terminus.

[0036] Any of the above-mentioned recombinant bacteria YPThr- Ptrc - ycdY C8G It is Escherichia coli ( Escherichia coli The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10, positions 501-1129 from the 5' end, while maintaining Escherichia coli (E. coli). Escherichia coli The recombinant *E. coli* strain YP0158 (CGMCC No. 25404) was obtained with the other nucleotide sequences of its genome unchanged. The recombinant strain YPThr- Ptrc - ycdY C8G The genome contains wild-type ycdY Genes and overexpression ycdY C8G Genes (from) Ptrc (Startup sub-boot).

[0037] The present invention also protects a method for preparing engineered bacteria for producing L-threonine, which may include the following steps: using Escherichia coli as the starting bacteria, performing any one or more of the following modifications to obtain the engineered bacteria for producing L-threonine; F1) Upregulates the expression level and / or activity of any of the above-mentioned molecular chaperones ycdY; F2) expresses any of the molecular chaperones ycdY described above. C8G; F3) Mutate any of the above-mentioned molecular chaperones ycdY to any of the above-mentioned molecular chaperones ycdY. C8G .

[0038] In the above method, the upregulation of the expression level and / or activity of any of the molecular chaperones ycdY is achieved by knocking in or introducing the encoding gene of the molecular chaperone ycdY into Escherichia coli.

[0039] In the above method, the expression of any of the above-described molecular chaperones ycdY C8G This is achieved by knocking in or introducing the molecular chaperone ycdY into E. coli. C8G This is achieved through the coding genes.

[0040] In the above method, the step of mutating any of the aforementioned molecular chaperones ycdY to any of the aforementioned molecular chaperones ycdY C8G This was achieved by mutating nucleotide T to G at position 22 of the gene encoding the molecular chaperone ycdY, whose amino acid sequence is shown in SEQ ID No. 5.

[0041] The above method is generally applicable to all Escherichia coli, preferably Escherichia coli that can produce L-threonine, but no further limitations are made here.

[0042] In the above method, the *Escherichia coli* can specifically be *Escherichia coli* capable of producing L-threonine (…). Escherichia coli YP0158 CGMCC No.25404.

[0043] In the above method, the *Escherichia coli* can specifically be *Escherichia coli* W3110. *Escherichia coli* W3110 produces a low amount of L-threonine and is generally not used for L-threonine production.

[0044] In the above method, any one or more of the following modifications can specifically be modifications F1), F2), or F3).

[0045] In F2), the expression can be overexpression.

[0046] The engineered bacteria obtained through F1 modification can specifically be the recombinant bacteria W3110- mentioned in the examples. Ptrc-ycdY Or recombinant bacteria YPThr- Ptrc - ycdY .

[0047] The engineered bacteria obtained through F2 modification can specifically be the recombinant bacteria W3110- mentioned in the examples. Ptrc - ycdY C8G Or recombinant bacteria YPThr- Ptrc - ycdYC8G .

[0048] The engineered bacteria obtained through F3 modification can specifically be the recombinant bacteria W3110- mentioned in the examples. ycdY C8G Or recombinant bacteria YPThr- ycdY C8G .

[0049] Any of the above-described molecular chaperones ycdY C8G The coding gene (i.e. ycdY C8G The nucleotide sequence of the gene may be as shown in SEQ ID No. 8.

[0050] The gene encoding any of the aforementioned molecular chaperones ycdY (i.e. ycdY The nucleotide sequence of the gene is shown in SEQ ID No. 4.

[0051] In the above method, the mutation of nucleotide T to G at position 22 of the gene encoding the molecular chaperone ycdY, whose amino acid sequence is shown in SEQ ID No. 5, is specifically performed using the CRISPR-Cas9 gene editing method. The gRNA sequence of the CRISPR-Cas9 gene edit is shown in SEQ ID No. 6.

[0052] This invention also protects a method for producing L-threonine, comprising the following steps: fermenting and culturing any of the engineered bacteria described above or engineered bacteria prepared by any of the methods described above, collecting the fermentation product, and obtaining L-threonine therefrom.

[0053] In the above method, the solutes and their concentrations in the fermentation medium used during fermentation can be glucose 35-45 g / L, (NH4)2SO4 10-14 g / L, KH2PO4 0.6-1.0 g / L, MgSO4•7H2O 0.6-1.0 g / L, FeSO4•7H2O 0.005-0.015 g / L, MnSO4•H2O 0.005-0.015 g / L, FM902 yeast powder 1.0-2.0 g / L, and calcium carbonate 0.4-0.6 g / L. The solvent can be water, and the pH value can be adjusted to pH 6.8-7.2 using sodium hydroxide.

[0054] In the above method, the solute and concentration of the fermentation medium used during fermentation can be glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast powder 1-5 g / L and NaCl 1-2.5 g / L, the solvent can be water, and the pH value can be 7.0-7.2.

[0055] This invention also protects any of the engineered bacteria or any of the molecular chaperones described above, ycdY. C8GOr any of the above-described encodings of the molecular chaperone ycdY C8G Nucleic acid molecules or those containing any of the above-described encodings of the molecular chaperone ycdY C8G The following uses are permitted for the expression cassettes of nucleic acid molecules, recombinant vectors and / or recombinant microorganisms or engineered bacteria prepared by any of the methods described above: E1) Production of L-threonine; E2) Prepare products for the production of L-threonine; E3) increases L-threonine production; E4) is used to prepare products for increasing L-threonine production.

[0056] Experiments have shown that upregulating the expression level of the molecular chaperone ycdY in E. coli and overexpressing ycdY can... C8G Alternatively, point mutation of the molecular chaperone ycdY (specifically, mutating the cysteine ​​residue at position 8 from the N-terminus of ycdY's amino acid sequence to a glycine residue) can significantly improve the L-threonine production capacity of *E. coli*. Furthermore, upregulating the expression level of ycdY in *E. coli*, overexpressing ycdYC8G, or performing point mutation of ycdY (specifically, mutating the cysteine ​​residue at position 8 from the N-terminus of ycdY's amino acid sequence to a glycine residue) can also significantly improve the production capacity of various products in *E. coli*. These products may include glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, citrulline, etc. This invention has significant application value. Attached Figure Description

[0057] Figure 1 This is a map of plasmid pGRB.

[0058] Figure 2 This is a map of plasmid pREDCas9. Detailed Implementation

[0059] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0060] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0061] Example 1: Recombinant bacteria YPThr- Ptrc - ycdY and recombinant strain W3110- Ptrc-ycdY Construction I. Recombinant strain YPThr- Ptrc - ycdY Construction Using the CRISPR-Cas9 gene editing method to edit E. coli ycdY Gene overexpression in L-threonine-producing strains—Escherichia coli ( Escherichia coli YP0158 CGMCC No.25404 adhE Site, to obtain recombinant bacteria YPThr- Ptrc-ycdY .

[0062] 1. Plasmid adhE- Building pGRB Constructing plasmids The purpose of pGRB is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein. It then uses base pairing and PAM to recognize the target gene site, resulting in a double-strand break in the target DNA. (See pGRB plasmid diagram). adhE- This is an Addgene product, catalog number #71539. The plasmid pGRB uses pUC18 as its backbone and includes the promoter J23119, the gRNA-Cas9 binding region sequence, and a terminator sequence. It is ampicillin resistant (working concentration: 100 mg / L) and cultured at 37°C.

[0063] Plasmids are constructed by recombination of DNA fragments containing target sequences with linearized vector fragments. pGRB. The specific steps are as follows: (1) Target sequence and primer design The target sequence (PAM:5'-NGG-3') was designed using CRISPR RGEN Tools, and the forward primer gRNA-F1 and reverse primer gRNA-R1 for amplifying the sgRNA fragment were artificially designed and synthesized based on the target sequence, as detailed below: Forward primer gRNA-F1: 5'-tgacagctagctcagtcctaggtataatactagt Figure 1 adhE-gttttagagctagaaatagcaagttaaaataagg-3' (underscores are...) Target sequence).

[0064] Reverse primer gRNA-R1: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ggaaactcacttcga agagc ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (underscores are...) adhE Target sequence).

[0065] (2) Preparation of DNA fragments containing target sequences ① Preparation of the annealing reaction system. The annealing reaction system consists of 10 μL of aqueous solution of forward primer gRNA-F1 (concentration of 10 μmol / L) and 10 μL of aqueous solution of reverse primer gRNA-R1 (concentration of 10 μmol / L).

[0066] ② Anneal the annealing reaction system to obtain a DNA fragment containing the target sequence.

[0067] Reaction conditions: pre-denaturation at 95℃ for 5 min; annealing at 50℃ for 1 min.

[0068] (3) Preparation of linearized cloning vectors The linearization of the vector was achieved using reverse PCR amplification. Specifically, using plasmid pGRB as a template, PCR amplification was performed using PrimeSTAR HS enzyme (Takara) and primer pairs (composed of pGRB-F: 5'-actagtattatacctaggactgagc-3' and pGRB-R: 5'-gttttagagctagaaatagcaagtt-3') to obtain the linearized cloning vector.

[0069] The reaction procedure was as follows: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension (this enzyme activity extends by about 1 kb per min) for 60 s, 30 cycles; 72℃ extension for another 10 min; 4℃ maintenance.

[0070] (4) Recombination reaction ① Preparation of the recombinant system. The recombinant system consisted of 20 μL and was composed of 4 μL 5×CEⅡ Buffer, 1 μL linearized cloning vector, 1 μL DNA fragment containing the target sequence, 2 μL LExnase Ⅱ and 12 μL ddH2O.

[0071] Exnase II and 5×CE II Buffer are both components of the ClonExpress® II One Step Cloning Kit (Novizan, C112).

[0072] ② The recombinant system is recombined to obtain a reaction solution.

[0073] The recombination conditions were: 37℃, 30 min.

[0074] (5) Plasmid transformation Add the reaction solution obtained in step (4) to 100 mL of E. coli DH5α competent cells, mix gently, incubate on ice for 20 min, heat shock at 42℃ for 45-90 s, immediately incubate on ice for 2-3 min, add 900 μL of SOC medium, and revive at 37℃ for 1 h. Then centrifuge at 8000 rpm for 2 min, discard part of the supernatant, and resuspend the bacterial cells in about 200 μL. Spread the resuspended cells onto LB agar plates containing 100 mg / L ampicillin, invert the plates, and incubate overnight at 37℃ to obtain resistant colonies.

[0075] (6) Cloning identification The resistant colonies obtained in step (5) were inoculated into LB liquid medium containing 100 mg / L ampicillin, cultured overnight at 37°C, and then plasmids were extracted and identified by enzyme digestion. Plasmids identified as correctly inserted were named plasmids. gctcttcgaagtgag pGRB.

[0076] plasmid tttcc pGRB can transcribe gRNA with nucleotide sequences as shown in SEQ ID No. 2, thereby forming a complex with the Cas9 protein, and achieving double-strand breaks in the target DNA by recognizing the target gene site through base pairing and PAM.

[0077] Sequencing revealed plasmids adhE pGRB is a recombinant plasmid obtained by replacing the DNA fragment between the DNA fragment K (5'-gctcagtcctaggtataatactagt-3') and the DNA fragment M (5'-gttttagagctagaaatagcaagt-3') in plasmid pGRB with the DNA fragment W (5'-GGAAACTCACTTCGAAGAGC-3'), while keeping other nucleotide sequences unchanged.

[0078] 2. adhE- - Fabrication of the integrated frame adhE- - The integration box is composed of upstream homologous arms - adhE- - Downstream homologous arm composition, for usePtrc Site integration ycdY The integration frame of the gene. The specific steps are as follows: (1) The following primers were designed and synthesized artificially: Primers Ptrc -up-F:5'-agcgggtaacgcgggttag-3'; Primers ycdY -up-R: 5'-CCGCTCACAATTCCACACATTATACGAGCCCGGATGATTAATTGTCAAgaatatctgccagcgtcctac-3'; Primers Ptrc -F: 5'-ATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCatgaacgagttttctatcctc-3'; Primers ycdY- -R: 5'-caccaacaaagcggctgatatttattcttcagaatcttcttc-3'; Primers -down-F: 5'-gaagaagattctgaagaataaatatcagccgctttgttggtg-3'; Primers adhE -down-R: 5'-agcagatgatttactaaaaaagtttaacattatcagg-3'.

[0079] Primers containing "-F" in their names are upstream primers, and primers containing "-R" in their names are downstream primers.

[0080] (2) Escherichia coli (Escherichia coli) ycdY Using the genomic DNA of YP0158 CGMCC No.25404 as a template, primers were used respectively. Ptrc-ycdY -up-F and primers Ptrc-ycdY Primer pair A, composed of -up-R, and primers Ptrc-ycdY Ptrc-ycdY -down-F and primers Ptrc-ycdY Primer pair B consisting of -down-R and primers Ptrc-ycdY -F and primers Escherichia coli Ptrc-ycdY PCR amplification was performed using primers consisting of -R, yielding the upstream homologous arm, downstream homologous arm, and... Ptrc-ycdY .

[0081] The reaction system consisted of 50 μL of each sample, with 2 μL of template (i.e., Escherichia coli)Ptrc- The mixture consisted of genomic DNA from YP0158CGMCC No.25404, 1 μL of upstream primer aqueous solution (10 μmol / L), 1 μL of downstream primer aqueous solution (10 μmol / L), 4 μL of dNTP mixture (10 mmol / L), 10 μL of 5× Buffer, 0.5 μL of RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL) and 31.5 μL of ddH2O.

[0082] (3) Overlap PCR ①Preparation of the overlap PCR reaction system. The overlap PCR reaction system is 50 μL, consisting of 2 μL of template (composed of the upstream homologous arm, the downstream homologous arm, and...). (mixed), 1μL primer ycdY -up-F aqueous solution (10 μmol / L), 1 μL primer Ptrc-ycdY The solution consisted of a down-R aqueous solution (10 μmol / L), 4 μL dNTP mixture (10 mmol / L), 10 μL 5× Buffer, 0.5 μL RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL), and 31.5 μL ddH2O.

[0083] ② Perform overlap PCR on the overlap PCR reaction system to obtain homologous recombination. Ptrc-ycdY - Ptrc- Integration box.

[0084] Overlap PCR reaction conditions: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension (this enzyme activity extends by about 1 kb per min) for 30 s, 30 cycles; 72℃ for further extension for 10 min; 4℃ maintenance.

[0085] - ycdY The nucleotide sequence of the integration frame is shown in SEQ ID No. 3. From the 5' end, positions 1-500 of SEQ ID No. 3 represent the nucleotide sequence of the upstream homologous arm, and positions 501-574 represent... Ptrc-ycdY The nucleotide sequence of the promoter, positions 575-1129 are... Escherichia coli The nucleotide sequence of the gene, positions 1130-1629 are the nucleotide sequences of the downstream homologous arms.

[0086] Ptrc-ycdY The nucleotide sequence of the gene is shown in SEQ ID No. 4, and the amino acid sequence encoding the molecular chaperone ycdY is shown in SEQ ID No. 5.

[0087] 3. Preparation of Escherichia coli competent cells containing plasmid pREDCas9 The plasmid pREDCas9 is a product of Addgene, catalog number #71541. A graph of plasmid pREDCas9 can be found here. Ptrc-ycdY The plasmid pREDCas9 carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system. It is incubated with zirconia resistance (working concentration: 100 mg / L) at 32°C.

[0088] (1) Transformation of plasmid pREDCas9 The plasmid pREDCas9 was electroporated into the L-threonine-producing strain, *Escherichia coli*. Ptrc-ycdY- In competent cells of YP0158 CGMCC No.25404, after cell resuscitation and culture, the cells were plated on LB agar plates containing zizomycin and incubated overnight at 32°C. Single colonies growing on the plates were subjected to colony PCR using identification primers (specifically 5'-gcagtggcggttttcatggc-3' and 5'-ccttggtgatctcgcctttcacg-3') to screen for positive recombinants (positive recombinants yielded a 943bp DNA fragment during colony PCR), i.e., Escherichia coli containing plasmid pREDCas9.

[0089] (2) Preparation of competent Escherichia coli cells containing plasmid pREDCas9 The *Escherichia coli* containing plasmid pREDCas9 obtained in step (1) was inoculated into LB medium and cultured at 32°C to obtain OD. 600nm The bacterial culture solution 1 was prepared with a concentration of 0.1–0.2 mM. IPTG was then added to the bacterial culture solution 1 to achieve a final concentration of 0.1 mM, and the culture was continued at 32°C to obtain the OD. 600nm The bacterial culture solution 2 was prepared at a concentration of 0.6–0.7 g / mL. The purpose of adding IPTG was to induce the expression of the recombinase on plasmid pREDCas9. Competent cells were prepared from bacterial culture solution 2, ultimately yielding Escherichia coli competent cells containing plasmid pREDCas9. The culture medium and preparation process for competent cells followed standard operating procedures.

[0090] 4. Plasmids pGRB and Ptrc - ycdY Conversion of integration box The plasmid constructed in step 1 Ptrc pGRB and the preparation in step 2 ycdY - PtrcThe integrated frame was simultaneously electroporated into competent *Escherichia coli* cells containing plasmid pREDCas9 prepared in step 3. The electroporated and revived bacterial cells were plated onto LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Single colonies grown on the plates were then analyzed using primers. ycdY -up-F and primers ycdY The primer pair consisting of -R and primers A1 and Figure 2 and primers Escherichia coli Colony PCR was performed using primer pair A2 (comprising down-R primers) to screen for positive recombinant 1 (when performing colony PCR on positive recombinant 1, primer pair A1 can obtain a DNA fragment of 1150 bp, and primer pair A2 can obtain a DNA fragment of 1102 bp) and the bacteria were preserved.

[0091] 5. Plasmid elimination (1) Plasmid adhE- -pGRB elimination The positive recombinant 1 obtained in step 4 was placed in LB liquid medium containing 0.2% arabinose and cultured overnight. After appropriate dilution, it was spread onto LB solid plates containing zirconia-resistant bacteria and cultured overnight at 32°C. Single colonies were picked and streaked one-to-one onto LB solid plates containing ampicillin (i.e., ampicillin-resistant plates) and LB solid plates containing zirconia-resistant bacteria (i.e., zirconia-resistant plates). Single colonies that did not grow on ampicillin-resistant plates but grew on zirconia-resistant plates were selected and preserved to obtain positive recombinant 2.

[0092] (2) Elimination of plasmid pREDCas9 Positive recombinant 2 was transferred to antibiotic-free LB liquid medium and incubated overnight at 42°C. After appropriate dilution, it was spread onto antibiotic-free LB solid plates and incubated overnight at 37°C. Single colonies were picked and streaked one-to-one onto zirconia-resistant plates and LB solid plates respectively. Single colonies that did not grow on zirconia-resistant plates but grew on LB solid plates were selected for preservation to obtain positive recombinant 3.

[0093] The obtained positive recombinant 3 was sequenced. Sequencing results showed that positive recombinant 3 was a recombinant of *Escherichia coli* (Escherichia coli). The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 Ptrc The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3, positions 501-1129 from the 5' end, while maintaining Escherichia coli (E. coli). ycdY The recombinant *E. coli* strain YP0158 (CGMCC No. 25404) was obtained with the other nucleotide sequences of its genome unchanged. The positive recombinant 3 was named recombinant strain YPThr- adhE- - .

[0094] Recombinant bacteria YPThr- Ptrc The genome contains wild-type ycdY Genes and overexpression Ptrc-ycdY Genes (from) Ptrc-ycdY (Bootbox startup) Two copies.

[0095] II. Recombinant strain W3110- Ptrc-ycdY-F Construction Following step one, Escherichia coli ( Ptrc-ycdY- Replace YP0158 CGMCC No.25404 with Escherichia coli W3110, keeping all other steps unchanged, to obtain recombinant strain W3110- .

[0096] Recombinant strain W3110- adhE Escherichia coli adhE Escherichia coli Ptrc ycdY Ptrc-ycdY ycdY ycdY Ptrc Ptrc-ycdY Escherichia coli Ptrc-ycdY Ptrc-ycdY Sequencing was performed. Sequencing results showed that the recombinant strain W3110- Ptrc-ycdY It is the genome of Escherichia coli W3110 represented by SEQ ID No. 1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3 from position 501 to 1129 from the 5' end, while keeping the other nucleotide sequences of the Escherichia coli W3110 genome unchanged, resulting in recombinant Escherichia coli.

[0097] Recombinant strain W3110- Ptrc-ycdY The genome contains wild-type ycdY Genes and overexpression ycdY Genes (from) Ptrc (Bootbox startup) Two copies.

[0098] Example 2, Recombinant bacteria YPThr- ycdY C8G and recombinant strain W3110- ycdY C8G Construction I. Recombinant strain YPThr- ycdY C8G Construction Using the CRISPR-Cas9 gene editing method, Escherichia coli ( Escherichia coli YP0158CGMCC No.25404 genome ycdY The nucleotide at position 22 of the gene is mutated from T to G, which will change the wild-type gene. ycdY Gene mutation ycdY C8G Genes were used to obtain recombinant bacteria YPThr- ycdY C8G .

[0099] 1. Plasmid ycdY- Building pGRB Following the method in step 1 of Example 1, replace the forward primer gRNA-F1 with the forward primer gRNA-F2: 5'-tgacagctagctcagtcctaggtataatactagt cgttgactgatcttccagcc gttttagagctagaaatagcaagttaaaataagg-3' (underscores are...) ycdY gRNA sequence), reverse primer gRNA-R1 replaced with reverse primer gRNA-R2: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ggctggaagatcagtcaacg ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (underscores are...) ycdY (gRNA sequence), all other steps remain unchanged, to obtain the plasmid. ycdY- pGRB.

[0100] plasmid ycdY- pGRB can transcribe gRNA with nucleotide sequences as shown in SEQ ID No. 6, thereby forming a complex with the Cas9 protein, and recognizing the target gene (i.e., through base pairing and PAM) ycdY (Gene) target sites to achieve the desired DNA double-strand break.

[0101] 2. ycdY C8G Fabrication of the integrated frame For ycdY C8G Point mutation ycdY C8G The integration frame consists of an upstream and a downstream homologous arm. The specific steps are as follows: (1) According to ycdY C8G Based on the upstream and downstream homologous arm sequences of the gene, the following primers were designed and synthesized: Primers ycdY -F:5'-ggtgaaattgactgcagcgg-3'; Primers ycdY C8G -R:5'-ccagcacacgacCgaggatagaaaactc-3'; Primers ycdY C8G -F:5'-gagttttctatcctcGgtcgtgtgctgg-3'; Primers ycdY -R:5'-ccgttgcagttatgagtgacgtag-3'.

[0102] (2) Escherichia coli (Escherichia coli) Escherichia coli Using the genomic DNA of YP0158 CGMCC No.25404 as a template, primers were used respectively. ycdY -F and primers ycdY C8G Primer pair 1 and primers consisting of -R ycdY C8G -F and primers ycdY PCR amplification was performed using primer pair 2 composed of -R, resulting in an upstream homologous arm of 555bp and a downstream homologous arm of 580bp.

[0103] The reaction system is the same as step 2 in Example 1.

[0104] (3) Overlap PCR ①Preparation of the overlapping PCR reaction system. The overlapping PCR reaction system is 50 μL, consisting of 2 μL template (a mixture of the upstream and downstream homologous arms obtained in step (2)) and 1 μL primer. ycdY -F aqueous solution (10 μmol / L), 1 μL primer ycdY The mixture consisted of 10 μmol / L aqueous solution of R, 4 μL dNTP mixture (10 mmol / L), 10 μL 5× Buffer, 0.5 μL RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL) and 31.5 μL ddH2O.

[0105] ② Perform overlap PCR on the overlap PCR reaction system to obtain homologous recombination. ycdY C8G Integration box.

[0106] ycdY C8G The nucleotide sequence of the integration frame is shown in SEQ ID No. 7. Starting from the 5' end, positions 1-555 of SEQ ID No. 7 are the nucleotide sequences of the upstream homologous arm, positions 528-1107 are the nucleotide sequences of the downstream homologous arm, and there is a 28 bp overlap sequence in between.

[0107] 3. Preparation of Escherichia coli competent cells containing plasmid pREDCas9 Same as step 3 in Example 1.

[0108] 4. Plasmids ycdY- pGRB and ycdY C8G Conversion of integration box The plasmid constructed in step 1 ycdY- pGRB and the preparation in step 2 ycdY C8G The integration frame was simultaneously electroporated into competent *Escherichia coli* cells containing plasmid pREDCas9 prepared in step 3. The electroporated and revived bacterial cells were plated onto LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Single colonies grown on the plates were sequenced to screen for cells containing pREDCas9. ycdY C8G Genetic ycdY C8G Positive mutant 1.

[0109] 5. Plasmid elimination (1) Plasmid adhE -pGRB elimination Following the method in step 5 of Example 1, replace positive recombinant 1 with the one obtained in step 4. ycdY C8G Positive mutant 1, with all other steps unchanged, yielded ycdY C8G Positive mutant 2.

[0110] (2) Elimination of plasmid pREDCas9 Following the method in step 5 (2) of Example 1, replace positive recombinant 2 with ycdY C8G Positive mutant 2, with all other steps unchanged, yielded ycdY C8G Positive mutant 3.

[0111] The above obtained ycdY C8G Positive mutant 3 was sequenced. Sequencing results showed that... ycdY C8G Positive mutant 3 is Escherichia coli (Escherichia coli) Escherichia coli YP0158 CGMCC No.25404 genome ycdY Gene mutation ycdY C8G Genes and maintain Escherichia coli ( Escherichia coli The recombinant *E. coli* strain YP0158 CGMCC No.25404 was obtained with the other nucleotide sequences of its genome unchanged. ycdY C8G Positive mutant 3 was named recombinant bacteria YPThr- ycdY C8G .

[0112] ycdY C8GThe nucleotide sequence of the gene is shown in SEQ ID No. 8, and the amino acid sequence encoding the molecular chaperone ycdY is shown in SEQ ID No. 9. C8G . ycdY C8G Genes are ycdY The mutation at nucleotide position 22 of the gene, T, is replaced by G, which in turn causes the molecular chaperone ycdY to mutate from cysteine ​​to glycine at position 8 from the N-terminus.

[0113] This invention uses the CRISPR-Cas9 gene editing method to edit Escherichia coli (Escherichia coli) Escherichia coli The wild-type genome of YP0158 CGMCC No.25404 ycdY Gene mutation ycdY C8G Genes were used to obtain recombinant bacteria YPThr- ycdY C8G .

[0114] Recombinant bacteria YPThr- ycdY C8G The genome contains ycdY C8G Genes that do not contain wild-type genes. ycdY Gene.

[0115] II. Recombinant strain W3110- ycdY C8G Construction Following step one, Escherichia coli ( Escherichia coli Replace YP0158 CGMCC No.25404 with Escherichia coli W3110, keeping all other steps unchanged, to obtain recombinant strain W3110- ycdY C8G .

[0116] Recombinant strain W3110- ycdY C8G It is the genome of Escherichia coli W3110 ycdY Gene mutation ycdY C8G The genes were extracted while keeping the other nucleotide sequences of the E. coli W3110 genome unchanged, resulting in recombinant E. coli.

[0117] Recombinant strain W3110- ycdY C8G The genome contains ycdY C8G Genes that do not contain wild-type genes. ycdY Gene.

[0118] Example 3, Recombinant bacteria YPThr- Ptrc - ycdY C8G and recombinant strain W3110- Ptrc - ycdY C8G Construction I. Recombinant strain YPThr- Ptrc - ycdY C8G Construction Using CRISPR-Cas9 gene editing method to ycdY C8G Gene overexpression in L-threonine-producing strains—Escherichia coli ( Escherichia coli YP0158 CGMCC No.25404 adhE Site, to obtain recombinant bacteria YPThr- Ptrc - ycdY C8G .

[0119] 1. Ptrc - ycdY C8G Fabrication of the integrated frame For adhE Site integration ycdY C8G The integration frame of genes — Ptrc - ycdY C8G The integration box is composed of upstream homologous arms - Ptrc - ycdY C8G - The downstream homologous arm is formed. The specific steps are as follows: (1) The following primers were designed and synthesized artificially: Primers Ptrc-ycdY -up-F:5'-agcgggtaacgcgggttag-3'; Primers Ptrc-ycdY -up-R: 5'-CCGCTCACAATTCCACACATTATACGAGCCCGGATGATTAATTGTCAAgaatatctgccagcgtcctac-3'; Primers Ptrc-ycdY C8G -F: 5'-ATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCatgaacgagttttctatcctcG-3'; Primers Ptrc-ycdY -R: 5'-caccaacaaagcggctgatatttattcttcagaatcttcttc-3'; Primers Ptrc-ycdY -down-F: 5'-gaagaagattctgaagaataaatatcagccgctttgttggtg-3'; Primers Ptrc-ycdY -down-R: 5'-agcagatgatttactaaaaaagtttaacattatcagg-3'.

[0120] Primers containing "-F" in their names are upstream primers, and primers containing "-R" in their names are downstream primers.

[0121] (2) Escherichia coli (Escherichia coli) Escherichia coli Using the genomic DNA of YP0158 CGMCC No.25404 as a template, primers were used respectively. Ptrc-ycdY -up-F and primers Ptrc-ycdY Primer pair A, composed of -up-R, and primers Ptrc- ycdY -down-F and primers Ptrc-ycdY Primer pair B consisting of -down-R and primers Ptrc-ycdY C8G -F and primers Ptrc- ycdY PCR amplification was performed using primers consisting of -R, yielding the upstream homologous arm, downstream homologous arm, and... Ptrc-ycdY C8G .

[0122] The reaction system is the same as step 2 in Example 1.

[0123] (3) Overlap PCR ①Preparation of the overlap PCR reaction system. The overlap PCR reaction system is 50 μL, consisting of 2 μL of template (composed of the upstream homologous arm, the downstream homologous arm, and...). Ptrc-ycdY C8G (mixed), 1μL primer Ptrc-ycdY -up-F aqueous solution (10 μmol / L), 1 μL primer Ptrc-ycdY- The solution consisted of a down-R aqueous solution (10 μmol / L), 4 μL dNTP mixture (10 mmol / L), 10 μL 5× Buffer, 0.5 μL RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL), and 31.5 μL ddH2O.

[0124] ② Perform overlap PCR on the overlap PCR reaction system to obtain homologous recombination. Ptrc - ycdY C8G Integration box.

[0125] Ptrc - ycdY The nucleotide sequence of the integration frame is shown in SEQ ID No. 10. From the 5' end, positions 1-500 of SEQ ID No. 10 represent the nucleotide sequence of the upstream homologous arm, and positions 501-574 represent... Ptrc The nucleotide sequence of the promoter, positions 575-1129 are... ycdY C8G The nucleotide sequence of the gene, positions 1130-1629 are the nucleotide sequences of the downstream homologous arms.

[0126] 2. Preparation of Escherichia coli competent cells containing plasmid pREDCas9 Same as step 3 in Example 1.

[0127] 3. Plasmids adhE- pGRB and Ptrc - ycdY C8G Conversion of integration box The plasmid constructed in Example 1, step 1 adhE- pGRB and the preparation in step 1 Ptrc - ycdY The integrated frame was simultaneously electroporated into competent *Escherichia coli* cells containing plasmid pREDCas9 prepared in step 2. The electroporated and revived bacterial cells were plated onto LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Single colonies grown on the plates were then analyzed using primers. Ptrc-ycdY -up-F and primers Ptrc-ycdY- Primer pair a and primer R are composed of R. Ptrc-ycdY C8G -F and primers Ptrc-ycdY- Colony PCR was performed using primer pair b (composed of down-R primers) to screen for positive recombinants a (when performing colony PCR on positive recombinants a, primer pair a can obtain a DNA fragment of 1150 bp, while primer pair b can obtain a DNA fragment of 1102 bp) and the bacteria were preserved.

[0128] 4. Plasmid elimination (1) Plasmid adhE -pGRB elimination Following the method in step 5 of Example 1, positive recombinant 1 is replaced with positive recombinant a obtained in step 3, while other steps remain unchanged, to obtain positive recombinant b.

[0129] (2) Elimination of plasmid pREDCas9 Following the method in step 5 (2) of Example 1, positive recombinant 2 is replaced with positive recombinant b, and all other steps remain unchanged to obtain positive recombinant c.

[0130] The obtained positive recombinant c was sequenced. Sequencing results showed that positive recombinant c is a recombinant of *Escherichia coli* (Escherichia coli). Escherichia coli The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10, positions 501-1129 from the 5' end, while maintaining Escherichia coli (E. coli). Escherichia coli The recombinant E. coli with YP0158 CGMCC No.25404 and other nucleotide sequences of the genome remained unchanged was obtained.

[0131] The positive recombinant c was named recombinant bacteria YPThr- Ptrc - ycdY C8G .

[0132] Recombinant bacteria YPThr- Ptrc - ycdY C8G The genome contains wild-type ycdY Genes and overexpression ycdY C8G Genes (from) Ptrc (Startup sub-boot).

[0133] II. Recombinant strain W3110- Ptrc - ycdY C8G Construction Following step one, Escherichia coli ( Escherichia coli Replace YP0158 CGMCC No.25404 with Escherichia coli W3110, keeping all other steps unchanged, to obtain recombinant strain W3110- Ptrc - ycdY C8G .

[0134] Recombinant strain W3110- Ptrc - ycdY C8G Sequencing was performed. Sequencing results showed that the recombinant strain W3110- Ptrc - ycdY C8G It is the genome of Escherichia coli W3110 represented by SEQ ID No. 1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10 from position 501 to 1129 from the 5' end, while keeping the other nucleotide sequences of the Escherichia coli W3110 genome unchanged, resulting in recombinant Escherichia coli.

[0135] Recombinant strain W3110- Ptrc - ycdY C8G The genome contains wild-type ycdY Genes and overexpression ycdY C8G Genes (from) Ptrc (Startup sub-boot).

[0136] Example 4: Production of L-threonine by fermentation using strains constructed in Examples 1-3 The tested strains were Escherichia coli (Escherichia coli) Escherichia coli YP0158 CGMCC No.25404, Escherichia coli W3110, Recombinant strain W3110- Ptrc-ycdY Recombinant strain W3110- ycdY C8G Recombinant strain W3110- Ptrc - ycdY C8G Recombinant bacteria YPThr- Ptrc - ycdY、 Recombinant bacteria YPThr- ycdY C8G and recombinant bacteria YPThr- Ptrc - ycdY C8G .

[0137] The test strain was streaked onto an agar slant and incubated at 37°C for 12 h. Then, a loopful of the agar slant seed culture was scraped and inoculated into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium. The flask was sealed with nine layers of gauze and incubated at 37°C and 200 rpm for 7-10 h. After that, 1 mL of the culture was inoculated into a 50 mL shake flask fermentation medium and fermented at 37°C and 200 rpm for 36 h to obtain the fermentation broth. Finally, the yield of L-threonine in the fermentation broth was determined by HPLC.

[0138] The HPLC chromatographic conditions were as follows: Method: 2,4-dinitrofluorobenzene (DNFB) pre-column derivatization liquid chromatography; Mobile phase: 55% acetonitrile-water solution (phase B), 5.44 g / L KH2PO4 solution (pH 7.20) (phase D); Flow rate: 1.0 mL / min; Detection wavelength: 360 nm.

[0139] Fermentation data were processed using Excel. Three batch biological replicates were set up for each strain, and significance tests were used (t-test method, p<0.05 indicates significant difference, p<0.01 indicates extremely significant difference).

[0140] The solutes and their concentrations in the slant culture medium are peptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L, and agar 15-20 g / L. The solvent is water, and the pH value is 7.0-7.2.

[0141] The solutes and their concentrations in the seed culture medium are glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast extract 1-5 g / L and NaCl 1-2.5 g / L, with water as the solvent and a pH of 7.0-7.2.

[0142] The solutes and their concentrations in the shake-flask fermentation medium were: glucose 40 g / L, (NH4)2SO4 12 g / L, KH2PO4 0.8 g / L, MgSO4•7H2O 0.8 g / L, FeSO4•7H2O 0.01 g / L, MnSO4•H2O 0.01 g / L, FM902 yeast extract 1.5 g / L, and calcium carbonate 0.5 g / L. The solvent was water, and the pH was adjusted to 7.0 with sodium hydroxide.

[0143] The test results are shown in Table 1. P Values ​​<0.01 indicate highly significant differences. The results show that, regardless of the specific strain of *Escherichia coli* producing high levels of L-threonine (…),… Escherichia coli YP0158 CGMCC No. 25404 is still the type strain Escherichia coli W3110, overexpressing ycdY Genes, will ycdY Gene mutation ycdY C8G Gene or overexpression ycdY C8G All genes can increase L-threonine production, with highly significant differences.

[0144] Table 1. L-Threoamino acid production of the strains

[0145] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An engineered bacterium, including *Escherichia coli* that has undergone any one or more of the following modifications in vivo; A1) Upregulates the expression level and / or activity of the molecular chaperone ycdY; A2) Expression of molecular chaperone ycdY C8G ; A3) Mutate the molecular chaperone ycdY described in A1) into the molecular chaperone ycdY. C8G ; The molecular chaperone ycdY is C1, C2, or C3. C1) contains at least the amino acid sequence shown in SEQ ID No. 5; C2) A protein with 98% or more identity and the same function as C1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of C1). C3) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2); The molecular chaperone ycdY C8G It includes at least one of the following: B1) The protein obtained by mutating the cysteine ​​residue at position 8 in the amino acid sequence of the molecular chaperone ycdY; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in B1); Preferably, the molecular chaperone ycdY C8G The protein is obtained by mutating the cysteine ​​residue at position 8 of the amino acid sequence of the molecular chaperone ycdY to a glycine residue. Preferably, the molecular chaperone ycdY C8G It contains the amino acid sequence shown in SEQ ID No.

9.

2. Molecular chaperone ycdY C8G It includes at least one of the following: B1) The protein obtained by mutating the cysteine ​​residue at position 8 in the amino acid sequence of the molecular chaperone ycdY; B2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in B1); The molecular chaperone ycdY is C1, C2, or C3. C1) contains at least the amino acid sequence shown in SEQ ID No. 5; C2) A protein with 98% or more identity and the same function as C1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of C1). C3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of C1) or C2).

3. The molecular chaperone YcdY according to claim 2 C8G Its features are: The molecular chaperone ycdY C8G The protein comprises a protein obtained by mutating the cysteine ​​residue at position 8 of the amino acid sequence of the molecular chaperone ycdY to a glycine residue.

4. The molecular chaperone YcdY according to claim 2 or 3 C8G Its features are: The molecular chaperone ycdY C8G It contains the amino acid sequence shown in SEQ ID No.

9.

5. Encoding the molecular chaperone ycdY according to any one of claims 2 to 4 C8G Nucleic acid molecules or expression cassettes, recombinant vectors and / or recombinant microorganisms containing said nucleic acid molecules.

6. The nucleic acid molecule according to claim 4, characterized in that: The nucleic acid molecule contains either D1 or D2). D1) A DNA molecule containing the coding sequence shown in SEQ ID No. 8; The nucleotide sequence defined by D2) has 75% or more identity with that defined by D1) and encodes the molecular chaperone ycdY. C8G DNA molecules.

7. A method for preparing engineered bacteria for producing L-threonine, comprising the following steps: using Escherichia coli as the starting bacterium, performing any one or more of the following modifications to obtain the engineered bacteria for producing L-threonine; F1) Upregulate the expression level and / or activity of the molecular chaperone ycdY described in claim 2; F2) Expresses the molecular chaperone ycdY as described in any of claims 2 to 4 C8G ; F3) Mutate the molecular chaperone ycdY of claim 2 to any of the molecular chaperones ycdY of claims 2 to 4. C8G .

8. The method according to claim 7, characterized in that: The upregulation of the expression level and / or activity of the molecular chaperone ycdY in claim 2 is achieved by knocking in or introducing the gene encoding the molecular chaperone ycdY into Escherichia coli. The expression of the molecular chaperone ycdY according to any one of claims 2 to 4 C8G This is achieved by knocking in or introducing the molecular chaperone ycdY into E. coli. C8G This is achieved through the encoding gene; The molecular chaperone ycdY of claim 2 is mutated to any of the molecular chaperone ycdY of claims 2 to 4. C8G This was achieved by mutating nucleotide T to G at position 22 of the gene encoding the molecular chaperone ycdY, whose amino acid sequence is shown in SEQ ID No.

5.

9. A method for producing L-threonine, comprising the following steps: fermenting and culturing the engineered bacteria of claim 1 or the engineered bacteria prepared by the method of claim 7 or 8, collecting the fermentation product, and obtaining L-threonine therefrom.

10. The engineered bacteria of claim 1 or the molecular chaperone ycdY of any one of claims 2 to 4 C8G Or any of the following uses of the nucleic acid molecule of claim 5 or 6, or an expression cassette, recombinant vector and / or recombinant microorganism containing the nucleic acid molecule of claim 5 or 6, or engineered bacteria prepared by the method of claim 7 or 8: E1) Production of L-threonine; E2) Prepare products for the production of L-threonine; E3) increases L-threonine production; E4) is used to prepare products for increasing L-threonine production.