Application of PvSAMDC2 gene in regulation and control of cadmium tolerance and salt tolerance of plants
By cloning and overexpressing the PvSAMDC2 gene of seashore paspalum, the problem of insufficient plant tolerance to cadmium stress was solved, and a transgenic material with enhanced cadmium tolerance was constructed. This resulted in a reduction of cadmium ion content and activation of the antioxidant system, thereby improving the plant's growth performance in cadmium-polluted environments.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-31
- Publication Date
- 2026-04-03
AI Technical Summary
Existing technologies are insufficient to effectively enhance plant tolerance to cadmium stress. Traditional breeding methods are inefficient and limited by germplasm resources. The functions of key stress-resistance genes in seashore paspalum are unknown, and there is a lack of safe and effective cadmium-tolerant gene resources in genetic engineering.
The PvSAMDC2 gene of seashore paspalum was cloned, and PvSAMDC2 was overexpressed in plants through genetic transformation technology. This process accumulated polyamines and activated the antioxidant defense system, reducing cadmium ion migration and transport. Transgenic materials were then constructed to improve cadmium tolerance and salt stress tolerance.
It significantly improves the survival rate and biomass of plants in cadmium-polluted environments, reduces cadmium ion content, activates the antioxidant system, protects cell membrane structure, provides transgenic lines with enhanced cadmium tolerance, and provides genetic resources for plant remediation and breeding.
Smart Images

Figure CN121780592A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, and particularly to... PvSAMDC2 Application of genes in regulating cadmium and salt tolerance in plants. Background Technology
[0002] With the rapid development of global industrialization and urbanization, heavy metal pollution has become a serious environmental problem. Among them, cadmium (Cd) is considered one of the most harmful heavy metal pollutants due to its high toxicity, strong mobility and bioaccumulation in organisms. It not only disrupts the balance of soil ecosystems, but also accumulates in plants and humans through the food chain, causing a series of health risks, including kidney damage, bone diseases and carcinogenic risks.
[0003] Cadmium ions in the soil are readily absorbed by plant roots and transported to the above-ground parts, causing various toxic effects on plant growth and development. These effects mainly include: inhibiting seed germination and root growth; damaging chloroplast structure, leading to decreased photosynthetic efficiency; interfering with the absorption and transport of essential mineral elements (such as potassium, calcium, and magnesium); and inducing intracellular reactive oxygen species (ROS) bursts, triggering oxidative stress and causing membrane lipid peroxidation, protein denaturation, and nucleic acid damage. These toxic effects ultimately manifest as a significant decrease in plant biomass, chlorosis and yellowing of leaves, and even the death of the entire plant, posing a serious threat to crop yield and quality, as well as ecological and environmental safety.
[0004] Currently, phytoremediation technologies for addressing cadmium pollution in soil and the breeding of cadmium-tolerant crop varieties are hot research topics. However, most crops and turfgrasses in nature are highly sensitive to cadmium stress and have low cadmium tolerance. Traditional breeding methods, which involve screening for cadmium-tolerant germplasm and then hybridizing, suffer from problems such as long cycles, low efficiency, and susceptibility to limitations in germplasm resources. Although genetic engineering provides a powerful tool for rapidly improving plant stress resistance, key gene resources that can significantly enhance the overall cadmium tolerance of plants and are safe for application remain scarce.
[0005] It is worth noting that seashore paspalum ( Paspalum vaginatum As a warm-season turfgrass with excellent stress resistance, it exhibits strong adaptability to stress environments such as salinity and drought, suggesting the possible existence of a unique resource pool of stress-resistant genes within it. However, although the genome of *Paspalum distichum* has been analyzed, its response mechanism under heavy metal cadmium stress, especially the function of key genes, remains unknown.
[0006] S-Adenosylmethionine decarboxylase (SAMDC) is a key rate-limiting enzyme in polyamine synthesis and is known to play an important role in plant responses to abiotic stresses such as drought and salinity. Although sporadic studies suggest that SAMDC genes may be involved in plant responses to heavy metal stress—for example, reports indicate that soybean SAMDC expression changes under cadmium stress—specific SAMDC genes (such as those found in seashore paspalum) discovered in stress-resistant species have not been identified as being involved in plant responses to heavy metal stress. PvSAMDC2 Whether it directly exerts a positive cadmium tolerance function in plants, and whether its overexpression can systematically enhance the plant's tolerance to cadmium stress and significantly reduce cadmium absorption, has not yet been confirmed by any research.
[0007] Therefore, key genes were cloned from *Paspalum notoginseng*, a unique stress-resistant resource. PvSAMDC2 The study also verified its function in conferring cadmium tolerance to plants, which has extremely important theoretical and practical significance for cultivating new cadmium-tolerant plant varieties through molecular breeding, ensuring safe agricultural production and ecological restoration in polluted soils. Summary of the Invention
[0008] The present invention aims to solve the above-mentioned problems. In a first aspect, it provides... PvSAMDC2 Application in any of the following: (1) Application in improving plant tolerance to cadmium stress; (2) Application in improving plant tolerance to salt stress; (3) Application in reducing cadmium accumulation in plants; (4) Application in constructing transgenic materials resistant to cadmium stress; (5) Application in cadmium stress-tolerant plant breeding; The PvSAMDC2 The CDS sequence is shown in SEQ ID NO. 1.
[0009] Secondly, it provides... PvSAMDC2 The expression carrier is used in any of the following applications: (1) Application in improving plant tolerance to cadmium stress; (2) Application in improving plant tolerance to salt stress; (3) Application in reducing cadmium accumulation in plants; (4) Application in constructing transgenic materials resistant to cadmium stress; (5) Application in cadmium stress-tolerant plant breeding; The PvSAMDC2 The CDS sequence is shown in SEQ ID NO. 1.
[0010] Thirdly, it provides the application of host bacteria containing recombinant vectors in any of the following: (1) Application in improving plant tolerance to cadmium stress; (2) Application in improving plant tolerance to salt stress; (3) Application in reducing cadmium accumulation in plants; (4) Application in constructing transgenic materials resistant to cadmium stress; (5) Application in cadmium stress-tolerant plant breeding; The recombinant vector is a genome-specific vector. PvSAMDC2 The carrier, the PvSAMDC2 The CDS sequence is shown in SEQ ID NO.1.
[0011] Furthermore, the plant mentioned in the above three applications is seashore paspalum.
[0012] Fourthly, based on the same invention, this invention also provides a method for improving plant tolerance to cadmium stress and / or salt stress, including cloning *Paspalum notatum* in plants. PvSAMDC2 Genes are overexpressed in plants through Agrobacterium-mediated genetic transformation. PvSAMDC2 By accumulating more free polyamines in the body, including spermine, spermidine, and putrescine, and increasing the activity of enzymes related to the antioxidant defense system, plants can improve their tolerance to cadmium stress and / or salt stress. PvSAMDC2 The CDS sequence is shown in SEQ ID NO. 1.
[0013] Fifthly, the present invention also provides a method for cultivating plants tolerant to cadmium stress and / or salt stress, comprising overexpressing in plants... PvSAMDC2 This improved chlorophyll content and photosynthesis in plants under cadmium stress, further reduced leaf yellowing, and increased survival rate, thus enabling the cultivation of cadmium- and / or salt-tolerant plants. PvSAMDC2 The CDS sequence is shown in SEQ ID NO. 1.
[0014] Sixthly, the present invention also provides a method for reducing cadmium accumulation in plants, comprising overexpressing cadmium in plants. PvSAMDC2 To reduce cadmium accumulation in the roots, stems, and leaves of plants; PvSAMDC2 The CDS sequence is shown in SEQ ID NO.1.
[0015] Furthermore, the plant mentioned in the above three applications is seashore paspalum.
[0016] The present invention has the following beneficial effects: This invention discloses and verifies for the first time the biosynthesis of seashore paspalum. PvSAMDC2 The key role of genes in regulating cadmium stress response. Overexpression of genes in *Paspalum notatum* using genetic transformation technology. PvSAMDC2 The gene enables transgenic plants to maintain significantly better growth and leaf quantity than wild-type plants under high concentrations of cadmium stress, effectively alleviating leaf wilting, yellowing, and drying caused by cadmium poisoning, and greatly improving the survival rate and biomass of plants in cadmium-polluted environments.
[0017] The transgenic seashore paspalum of this invention exhibits an active "rejection" mechanism. Under cadmium stress, compared with the wild type, the cadmium ion content in the roots, stems, leaves, and other tissues of the transgenic lines was significantly reduced. This finding indicates that... PvSAMDC2 The function of genes is not only to provide intrinsic tolerance, but also to reduce the migration and translocation of cadmium ions from the environment into plants at the source. This is of great value for breeding crops with low heavy metal accumulation for food safety or preventing the transmission of heavy metals through the food chain.
[0018] This invention elucidates from a physiological and biochemical perspective... PvSAMDC2 The mechanism of cadmium tolerance in this gene. Overexpression of this gene significantly activates the antioxidant defense system in plants, specifically by significantly increasing the activities of peroxidase (POD), superoxide dismutase (SOD), and ascorbate peroxidase (APX), maintaining higher levels of ascorbic acid (ASA), while significantly reducing malondialdehyde (MDA) levels, which represent the degree of membrane lipid peroxidation damage. This indicates... PvSAMDC2 The gene reduces oxidative damage caused by cadmium stress by enhancing the cell's ability to scavenge reactive oxygen species and protecting the structural and functional integrity of the cell membrane.
[0019] This invention successfully constructed PvSAMDC2 By using gene overexpression vectors and an Agrobacterium-mediated genetic transformation system, a stable and efficient transgenic process for seashore paspalum was established, resulting in multiple genetically stable transgenic lines with enhanced cadmium tolerance. This technical approach demonstrates good reproducibility and significant effectiveness, providing a reliable technical pathway and gene resource for cadmium-tolerant breeding of turfgrass and other grasses.
[0020] Because the transgenic seashore paspalum of this invention possesses the unique advantages of strong cadmium tolerance and low cadmium absorption, it has dual application potential in the field of phytoremediation: it can be used for vegetation restoration and ecological stabilization of cadmium-contaminated soils, avoiding the risk of secondary pollution caused by excessive absorption of heavy metals; and it provides unprecedented genetic material for cultivating low-risk turfgrass varieties suitable for areas with moderate to mild pollution and possessing both ecological and landscape functions. Attached Figure Description
[0021] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only one embodiment of the present invention. For those skilled in the art, other embodiments can be derived from the provided drawings without creative effort.
[0022] Figure 1 : PvSAMDC2 Overexpression vectors and gene editing vectors, where A is... PvSAMDC2 The overexpression vector, B is PvSAMDC2 Gene editing vectors.
[0023] Figure 2 The genetic transformation process of seashore paspalum includes: A) screening of resistant callus tissue, B) differentiation of resistant regenerated seedlings, C) growth of single transgenic plants, and D) identification of transgenic seashore paspalum lines.
[0024] Figure 3 Seashore Paspalum Pvsamdc2 Identification of gene-edited strains, where A is the gene-editing vector. Pvsamdc2-1 Screening for resistant callus, B is... Pvsamdc2-1 Resistant regenerated plants, C is Pvsamdc2-2 Screening for resistant callus, D is Pvsamdc2-2 Resistant regenerated plants, E is the identification of gene-edited mutants, F is the sequencing map of the mutation target, yellow bases indicate gene editing sites, and red areas indicate mutation locations.
[0025] Figure 4 Overexpression PvSAMDC2 Analysis of cadmium tolerance in *Paspalum notatum*, where A represents plant growth before cadmium treatment, B represents plant growth after 2 weeks of cadmium treatment, C represents cadmium content in *Paspalum notatum* leaves, D represents cadmium content in *Paspalum notatum* stems, E represents cadmium content in *Paspalum notatum* roots, F represents putrescine content in *Paspalum notatum* leaves, G represents spermine content, and H represents spermidine content.
[0026] Figure 5 Compared to the wild type PvSAMDC2 Analysis of antioxidant-related physiological indicators of overexpression lines under cadmium stress: A is survival rate, B is leaf chlorosis rate, C is malondialdehyde content, D is chlorophyll content, E is net photosynthetic rate, F is soluble protein content, G is superoxide dismutase (SOD) activity, H is peroxidase (POD) activity, I is catalase (CAT) activity, J is ascorbate peroxidase (APX) activity, K is reduced glutathione (GSH) activity, and L is ascorbic acid (ASA) activity.
[0027] Figure 6The salt stress phenotype and polyamine content of transgenic and wild-type seashore paspalum, where A represents the plant growth status before salt treatment, B represents the plant growth status after 15 days of 0.7 mM salt treatment, C represents the plant growth status after 60 days of 0.7 mM salt treatment, D represents the survival rate after 15 days of 0.7 mM salt treatment, E represents the putrescine content in the leaves of seashore paspalum after treatment, F represents the spermine content, and G represents the spermidine content.
[0028] Figure 7 Overexpression under salt stress PvSDMAC2 Transgenic and wild-type strain Na + K + Content and K + / Na + Analysis, where A represents K in the root system. + Content, B is the Na content in the root system + Content, C represents K in the root system + / Na + The proportion, D, is the K content in the blade. + Content, E is the Na content in the leaves + Content, F is the K content in the leaves + / Na + Proportion. Detailed Implementation
[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. The following embodiments are only for illustrative purposes and are not intended to limit the scope of the present invention in any way. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the present invention are conventional methods. Unless otherwise specified, the materials and reagents used in the present invention are commercially available. Furthermore, other terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those skilled in the art.
[0030] Example 1: Seashore Paspalum PvSAMDC2 Genetic transformation 1.1 Experimental Materials and Methods Plant material: Wild-type Sea Spray Total RNA extraction and reverse transcription into cDNA: Fresh and well-grown wild-type leaves of Paspalum distichum were sampled, and total RNA was extracted from the Paspalum distichum plant material using the FastPure® Universal Plant Total RNA Isolation Kit provided by Novizan Pharmaceutical Co., Ltd. The total RNA was reverse transcribed into cDNA using the PrimeScript™ II 1st StrandcDNA Synthesis Kit (RC411, Novizan).
[0031] Conventional PCR: Conventional PCR reactions were performed using 2×PhantaMax Master Mix (P520) high-fidelity enzyme and 2×Rapid TaqMaster Mix (P222) Taq enzyme. In the reaction system described below, the temperature in step 3 was determined based on the average TM value of the upstream and downstream primers, and the temperature in step 4 was determined based on the CDS length of the target gene (high-fidelity enzyme extension rate: 5 s / kb; Taq enzyme extension rate: 15 s / kb). The PCR reaction system consisted of: 10 μL high-fidelity enzyme, 1 μL upstream primer, 1 μL downstream primer, 1 μL template, and RNase-free ddH2O up to 20 μL.
[0032] PvSAMDC2 Gene sequence cloning: obtained through the Phytozome website PvSAMDC2 The coding sequence (CDS region) of the gene is shown in SEQ ID NO. 1. Using SnapGene software... PvSAMDC2 Cloning primers were designed based on the sequence information, and homologous arms were designed using the sequence information of the first 20 bp of the NcoI and BsTEII restriction sites on the overexpression vector pCAMBIA3301 (Table 1).
[0033]
[0034] Table 1: Primers for overexpression vectors
[0035] Using 2×PhantaMax Master Mix (P520) high-fidelity enzyme, and with *Paspalum notatum* cDNA as a template, conventional PCR was performed to clone the DNA. PvSAMDC2 Genes were sequenced. The PCR reaction procedure was as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds; 56℃ annealing for 5 seconds; 72℃ extension for 8 seconds; 72℃ final extension for 1 minute; stored at 4℃.
[0036] PCR product recovery: After electrophoresis, the target DNA fragment in the agarose gel was cut, the gel weight (g) was weighed using a balance, and the specific bands were purified and recovered using the FastPure® Gel DNA Extraction Mini Kit (DC301, Nanjing Novizan). The specific operation steps are as shown in the kit instructions.
[0037] 1.2 Construction of overexpression vectors 1.2.1 Overexpression vector digestion pCAMBIA3301 was selected as... PvSAMDC2 The overexpression vector was prepared using NcoI and BsTEII restriction endonucleases from NEW ENGLAND Biolabs as restriction sites. The PCR reaction was incubated at 37°C for 2 h. The digestion reaction mixture consisted of: 3 μL pCAMBIA3301 vector, 1 μL NcoI, 1 μL BsTEII, 10 μL buffer, and 35 μL dd H2O.
[0038] 1.2.2 Homologous recombination of overexpression vectors Add 50x Loading Buffer to the above enzyme digestion product, mix well, and then add to the lanes of a 1% agarose gel. Electrophoresis is performed at 110V and 400 mA for 40 min. The linearization of the overexpression vector is determined by observing and comparing its position with the undigested vector using a gel imaging system. The target band is cut, and the linearized vector is purified using a gel extraction kit. The linearized vector is then incubated with the target fragment at 50℃ for 15 min using the CloneExpress® Ultra One Step Cloning Kit from Nanjing Novizan Pharmaceutical Co., Ltd. The recombination reaction system is as follows: PvSAMDC2 -arm 1μL, pCAMBIA3301 linearization product 4μL, 2 x ClonExpress Mix 5μL.
[0039] 1.2.3 Transformation of Escherichia coli with overexpression vector The homologous recombination product obtained above was added to 100 μL of DH5α Escherichia coli competent cells, gently mixed, and placed on ice for 25 min. It was then transferred to a metal water bath and incubated at 42°C for 45 sec, followed by immediate placement on ice for 2 min. 700 μL of antibiotic-free LB broth was added to the bacterial culture, mixed, and incubated at 37°C on a shaker at 200 rpm for 1 h. The bacterial culture was then centrifuged at 5000 rpm for 60 sec in a high-speed mini-centrifuge to collect the cells. 600 μL of the supernatant was collected, and the cells were resuspended and evenly spread onto LB solid medium containing 50 μg / mL Kan antibiotic. The culture was incubated overnight in an inverted position at 37°C. Single valid clones were picked and sequenced to verify sequence accuracy.
[0040] 1.2.4 Plasmid Extraction The plasmid was extracted from the correctly sequenced bacterial culture using the FastPure Plasmid Mini Kit-BOX 2 (DC201, Novizan) plasmid mini extraction kit, and finally obtained... PvSAMDC2 Expression vector plasmid. Specific operating procedures are as described in the kit instructions.
[0041] 1.2.5 Transformation of Agrobacterium with overexpression vector Add 800 ng of the plasmid with the correct sequence, appropriate concentration, and no contamination to 100 μL of EHA105 Agrobacterium competent cells. After mixing, incubate on ice for 5 min, then transfer to liquid nitrogen for rapid freezing for 5 min, then transfer to a metal water bath for incubation at 37°C for 5 min, and finally place in an ice bath for 5 min. Add 700 μL of antibiotic-free YEB liquid medium to the bacterial culture and activate it in a shaker at 28°C for 3 h. After removal, collect the bacterial cells by centrifugation at 6000 rpm for 60 sec, and resuspend the bacterial cells in 200 μL of supernatant. Spread the resuspended cells evenly on YEB solid medium containing 50 μg / mL Kan and 50 μg / mL Rif antibiotics, and incubate upside down in a 28°C incubator for 2-3 days. Select valid single clones for sequencing, and freeze the correctly sequenced bacterial cultures at -80°C.
[0042] 1.3 Construction of gene editing vectors 1.3.1 Selection of crRNA Using the CRISPR-P 2.0 website PvSAMDC2 Based on the coding sequence information, four 20 bp specific crRNAs with nearby PAM (NGG) sequences were designed online as target sites, as shown in Table 2: Table 2: crRNA Sequence
[0043] 1.3.2 Inserting Fragment Acquisition Using SnapGene software, primary primer sequences containing two of the target sequences and protective bases were designed based on the vector sequence information on the intermediate vector pCBC-MT2T3. Secondary primers containing BsaI restriction sites and protective bases were designed based on the former primer sequence information. The insert fragment was cloned using conventional PCR. The primers are shown in Table 3. Table 3: Primers for gene editing vectors
[0044] 1.3.3 Gene editing vector restriction enzyme digestion and ligation pBUE411 as PvSAMDC2 The gene editing vector was digested with restriction endonuclease BsaI at 37°C for 5 h. Simultaneously, the digested products were ligated using T4 DNA Ligase at 50°C for 5 min. The reaction system was as follows: PCR product 2 μL, pBUE411 2 μL, 10xNEB T4 Buffer 1.5 μL, 10x BSA 1.5 μL, BsaI 1 μL, T4 Ligase 1 μL, dd H2O 6 μL.
[0045] The steps for transforming Escherichia coli with gene editing vectors, plasmid extraction, and transforming Agrobacterium tumefaciens with gene editing vectors are the same as those in 1.2, which describes the construction of overexpression vectors.
[0046] 1.4 Genetic transformation of seashore paspalum This experiment employed Agrobacterium-mediated genetic transformation, using callus tissue from wild-type SaeSpey seashore paspalum as explants for genetic transformation. Figure 2 As shown in A~B, the specific operation steps are as follows: After washing the mature wild-type SaeSpey seeds five times, the washed seeds were transferred to 50 mL centrifuge tubes containing 15% sodium hypochlorite solution and sterilized for 10 min. The centrifuge tubes were then transferred to a clean bench, the sodium hypochlorite solution was discarded, and dd H2O was added to the centrifuge tubes to rinse at least five times. The tubes were then air-dried for later use.
[0047] Sterilized seashore paspalum seeds were transferred to MS solid medium and induced in the dark at 28°C. The medium was changed every 21 days. After callus tissue was induced, the medium was changed every 30 days. During this period, the young shoots produced during the induction process should be removed in time.
[0048] The qualified *Agrobacterium tumefaciens* EHA105 containing the target vector was multiplied in 40 mL of YEB liquid medium containing 50 μg / mL Kan and 50 μg / mL Rif antibiotics at 28°C and 200 rpm until the bacterial culture reached OD. 600 When the OD value reaches approximately 0.8, centrifuge the bacterial culture at room temperature for 10 minutes, discard the excess YEP liquid, add an appropriate amount of MS liquid culture medium to the collected bacteria, and transfer to a new sterile Erlenmeyer flask. Under the same conditions as above, shake the culture for 5-10 minutes to adjust the OD value of the bacterial culture. 600 The value is around 0.6.
[0049] Healthy embryogenic callus tissues with firm texture, plump granules, and bright yellow color were selected from the induced callus tissues. These were then divided into individuals approximately 2-3 mm in size using forceps and transferred to sterile Erlenmeyer flasks. The prepared bacterial solution was added until the callus tissues were completely submerged. The flasks were gently shaken to ensure the bacterial solution fully adhered to the callus surface. 100-200 μmol of acetylsyleugenone was added to the mixture. The Erlenmeyer flask containing the mixture was then transferred to an ice-water mixture and sonicated for 10 min. Following this, the mixture was vacuum-treated for 20 min. The treated bacterial solution was aspirated using a pipette, and most of the remaining bacterial solution was removed from the callus tissues using sterile filter paper, avoiding complete drying. The infected callus tissues were then transferred to MS induction medium and incubated at 28°C in the dark for 72 h. After washing the co-cultured callus five times with dd H2O containing rifampicin, all the bacterial solution remaining on the callus was removed with sterile filter paper, and then the remaining bacterial solution was dried on the filter paper. Callus tissue was evenly spread onto MS induction medium containing glufosinate-ammonium (PPT) and cefotaxime (cefo), and cultured at 28°C for 16 h / 8 h (light / dark). After 30 days, the callus tissue was transferred to M1G regeneration medium containing glufosinate-ammonium and cefotaxime, and cultured at 28°C for 16 h / 8 h (light / dark). The medium was changed every 30 days. When green granules appeared on the callus tissue, it was transferred to M1G regeneration medium without antibiotics. The medium was changed every 30 days. When the callus tissue began to differentiate into shoots and roots, the seedlings were transferred to tissue bottles containing 1 / 2 MS root-strengthening medium. After the root system was sufficiently developed, the plants were transferred to soil for cultivation.
[0050] 1.5 Identification of Seashore Paspalum Overexpression Lines 1.5.1 Extraction of DNA from resistant plants Take 0.1 g of fresh, well-grown leaves of *Paspalum notatum* (seashore paspalum) and transfer them to a 1.5 mL centrifuge tube containing one 4 mm diameter steel ball and two 2 mm diameter steel balls. Immediately freeze the tube in liquid nitrogen and then grind it twice (50 Hz, 60 sec / time) in a tissue homogenizer until powdered. Extract genomic DNA from the *Paspalum notatum* plant material using the FastPure® Plant DNA Isolation Mini Kit provided by Novizan Pharmaceuticals (Nanjing). Follow the kit instructions for specific procedures.
[0051] 1.5.2 Overexpression of Paspalum notatum spp. PvSAMDC2 Identification of positive plants Using SnapGene software based on the pCAMBIA3301 overexpression vector and... PvSAMDC2 Primers were designed to verify the sequence information. The sequences are as follows: F (5'-3'): CGGTGGCAATGCTTATGTGATTGG; R (5'-3'):GCAAGACCGGCAACAGGATTC; The study used 2× Rapid Taq Master Mix (product number P222) Taq enzyme provided by Novizan. Using genomic DNA extracted from plants as a template, overexpressing Taq enzymes were effectively identified and screened through conventional PCR reactions. PvSAMDC2 Transgenic strains of genes.
[0052] 1.6 Identification of gene-edited strains of Paspalum notatum on the coast 1.6.1 Extraction of Plant DNA Genomic DNA was rapidly extracted from mutant plants to be tested using the SDS small-volume DNA extraction method.
[0053] 1.6.2 Positive identification of gene editing in seashore paspalum Primers were designed and validated using SnapGene software based on the sequence information of the Cas9 protein in the pBUE411 gene editing vector. The sequences are as follows: F (5'-3'): GCCAGCTGCTGACAAGAAGT; R (5'-3'):TCCTTGGAGAGCTGCAGCTT; Using 2× Rapid Taq Master Mix (product number P222) Taq enzyme provided by Novizan, and with genomic DNA extracted from plants as a template, transgenic lines that have successfully undergone genetic transformation of gene-editing vectors were effectively identified and screened through conventional PCR reactions.
[0054] 1.6.3 PvSAMDC2 Gene sequence cloning, PCR product purification, TOPO cloning, single colony selection, PCR verification and sequencing.
[0055] 2 Results and Analysis 2.1 PvSAMDC2 Construction of gene editing vectors PvSAMDC2 Overexpression vectors such as Figure 1 -A is shown; PvSAMDC2 Gene editing vectors such as Figure 1 As shown in -B, PvSAMDC2 The gene-editing vector is 16976 bp in length, with prokaryotic resistance to kanamycin and eukaryotic resistance to glufosinate.
[0056] 2.2 Genetic transformation of seashore paspalum Using an Agrobacterium-mediated genetic transformation system, wild-type Sea Spray seeds were selected as explants for the experiment. The constructed explants were then... PvSAMDC2 Overexpression vectors and gene-editing vectors were transferred into callus tissue of Paspalum notatum. After all the infected callus tissue had differentiated, ( Figure 2 -B) and ( Figure 3 B, D), and then transferred the resistant regenerated plants into the premixed soil substrate.
[0057] 2.3 Seashore Paspalum PvSAMDC2 Obtaining overexpression materials Resistant callus tissue obtained through Agrobacterium-mediated genetic transformation was cultured for 4-6 months in differentiation medium containing cefotaxime sodium and glufosinate resistance, resulting in 55 resistant regenerated plants. Using DNA from these resistant regenerated plants and wild-type lines as templates, PCR was performed to identify positive lines. Lines that could amplify the target band but failed to amplify it in the wild-type were considered transgenic lines. Figure 2 -D), the results showed that a total of 56 positive seedlings were screened out.
[0058] 2.4 Seashore Paspalum PvSAMDC2 Obtaining gene-editing materials The above-mentioned callus tissue of Paspalum notoginseng was processed using Agrobacterium-mediated transformation to contain... PvSAMDC2 Gene editing vectors that knock out the target site were genetically transformed into callus tissue, and resistant regenerated plants were obtained through glufosinate selection. Genomic DNA was extracted from the lines to be tested and used as a template. PCR verification was performed using primers encoding the Cas9 protein gene sequence. Lines that produced the target band were identified as transgenic positive plants. Figure 3-E). Currently, a total of 50 resistant regenerated plants have been obtained, 30 of which are transgenic plants. DNA was extracted from the transgenic positive plants and used as a template for... PvSAMDC2 The sequence was amplified by PCR and sequenced, and compared with the original sequence. The results showed that there was a seashore paspalum strain. PvSAMDC2 The sequence has a missing thymine (T) base at its target location. Figure 3 -F) indicates that this strain PvSAMDC2 The genome was successfully edited.
[0059] In summary, this experiment successfully constructed... PvSAMDC2 Gene editing vectors were used to deliver gene editing data via Agrobacterium-mediated transformation. PvSAMDC2 Overexpression vectors and gene-editing vectors were genetically transformed into callus tissue of *Paspalum notoginseng*. Identification confirmed the acquisition of positive overexpression lines and gene-edited mutant lines, paving the way for further validation. PvSAMDC2 This study provides experimental material for understanding the mechanisms by which seashore paspalum regulates plant defense and adaptation to various stresses.
[0060] Example 2: Seashore Paspalum PvSAMDC2 Cadmium resistance functional verification analysis 1. Experimental Materials and Methods 1.1 Experimental Materials: This experiment selected wild-type Sea Spray and materials containing... PvSAMDC2 Transgenic lines overexpressing the target gene were used as experimental materials.
[0061] 1.2 Test Methods 1.2.1 Planting and Treatment of Plant Materials This study selected 3 PvSAMDC2 Gene overexpression lines (numbered OE4, OE5, and OE8) and a wild-type control line WT were used as experimental materials. Vegetative propagation of each line was carried out via rhizome and stolons, and the cuttings were cultivated in a pre-mixed soil substrate. Each line underwent three replicate propagation. Experimental conditions were set at a temperature of 25±2℃, relative humidity maintained at 60-70%, and a periodic light-dark cycle of 16 hours of light followed by 8 hours of darkness (light intensity 800 μmol·m²). ^-2 ·s ^-1 Water the plant every 3-4 days.
[0062] Before cadmium treatment, all pre-treated plant lines were irrigated for 7 days. Subsequently, each line was treated with a 125 mM / L cadmium chloride solution. During treatment, when the leaves of the wild-type plant lines showed yellowing or even began to wither, samples were immediately collected, and various physiological and biochemical indicators were measured. When significant differences in traits were observed among different lines, photographs were taken and recorded.
[0063] 1.2.2 Determination of Ion Content Take fully expanded leaves, wash and drain them, then blanch them at 105℃ for 15 min, dry them at 80℃ to constant weight, and grind them. Microwave digest for 20 min, cool, transfer the digest to a volumetric flask, wash 2-3 times with double-distilled water, and make up to 10 mL. Determine Cd using a Hitachi Z-8000 atomic absorption spectrophotometer. 2+ Na + and K + The content of.
[0064] 1.2.3 Soluble protein content Take 0.2g of fresh leaves, freeze in liquid nitrogen, and grind into powder. Add 1.5 mL of pre-cooled 50 mM phosphate buffer, and centrifuge at 10,000 rpm for 15 minutes at 4°C. Plot a standard curve using bovine serum albumin (BSA) using the Coomassie Brilliant Blue G-250 method. Take 0.1 mL of the supernatant, react it with 2.9 mL of Coomassie Brilliant Blue reagent for 2 minutes, and measure the absorbance at 595 nm. Calculate the protein concentration in the extract based on the standard curve and convert it to the soluble protein content per unit fresh weight sample.
[0065] 1.2.4 Malondialdehyde (MDA) content Take 0.3g of fresh leaves and freeze-mill them in liquid nitrogen. Add 4mL of 5% thiobarbituric acid (TBA) solution for extraction, centrifuge and collect the supernatant (volume V). Take 1mL (V1) of the supernatant, add an equal volume of 0.67% TBA solution, react in a 100℃ water bath for 30 minutes, cool on ice, and centrifuge again.
[0066] Take the final supernatant and use a spectrophotometer to measure the absorbance values A1, A2, and A3 at wavelengths of 450 nm, 532 nm, and 600 nm, respectively.
[0067] Calculation of malondialdehyde (MDA) content: MDA concentration C in the test solution: 6.45 * (A2 - A3) - 0.56 * A1 MDA content of sample: (C*V2*V) / (fresh weight of sample*V1*1000) 1.2.5 Determination of peroxidase Guaiacin colorimetric method: POD catalyzes the oxidation of guaiacin by H2O2 to produce brown tetra-o-methoxyphenol, which has a maximum absorption peak at 470 nm. Enzyme activity is quantified by the rate of change in absorbance. Extraction and determination are performed using a kit.
[0068] 1.2.6 Assay of Superoxide Dismutase Activity According to the nitroblue tetrazolium (NBT) photoreduction method, SOD can inhibit the reduction of NBT to blue formazan by superoxide anion free radicals under light. The enzyme activity was quantified by the inhibition rate, and the absorbance was measured at 560 nm. Extraction and determination were performed using a kit.
[0069] 1.2.7 Assay for catalase activity Since H2O2 has a strong absorption effect on ultraviolet light at a wavelength of 240 nm, and CAT can catalyze the decomposition of H2O2 into H2O and O2, the addition of CAT to the reaction system will cause the absorbance (A240) of the reaction solution to decrease with the reaction time. The activity of CAT can be calculated based on the rate of change of A240, and the kit is used for extraction and determination.
[0070] 1.2.8 Ascorbic acid oxidase (APX) activity assay Fresh leaves were ground with liquid nitrogen, and the supernatant was prepared using pre-cooled extraction buffer according to the kit instructions. APX uses ascorbic acid (AsA) as a substrate, catalyzing the oxidation of AsA to dehydroascorbic acid by H2O2. AsA has a characteristic absorption peak at 290 nm, and enzyme activity was quantified by the rate of absorbance decrease. Enzyme solution was added to the reaction system, and the rate of decrease in absorbance of the reaction solution at 290 nm wavelength over time was monitored. Based on the absorbance change, the enzyme activity per unit time, per unit protein mass, or per unit fresh weight of sample was calculated using the formula.
[0071] 1.2.9 Determination of Ascorbic Acid Content (AsA) Ascorbic acid (AsA) content was determined using a kit method. Fresh leaves were ground and centrifuged using the pre-cooled extraction buffer provided in the kit to obtain the supernatant. A portion of the supernatant was collected and added to the reaction reagents in the kit. After appropriate incubation, the absorbance at a specific wavelength was measured using a spectrophotometer. The AsA content (expressed as fresh weight) in the sample was calculated according to the standard curve or the formula in the kit.
[0072] 1.2.10 Determination of Reduced Glutathione (GSH) Content The DTNB colorimetric method was used to determine that the thiol group (-SH) of GSH can react with DTNB (5,5'-dithiobis-2-nitrobenzoic acid) to generate yellow 5-thio-2-nitrobenzoic acid (TNB), which has a maximum absorption peak at 412 nm. The quantification was performed by absorbance.
[0073] 1.2.10 Determination of Polyamine Content The determination of polyamines (PAs) mainly includes three steps: extraction, derivatization, and UPLC analysis. 0.2 g of fresh leaves were homogenized in liquid nitrogen with 5% perchloric acid, incubated on ice for 1 h, and then centrifuged at 12000×g for 20 min at 4℃. The supernatant was used for the determination of free polyamines. 200 µL of the supernatant was derivatized with 2 M NaOH and benzoyl chloride, reacted at 37℃, and then extracted with saturated NaCl and cold diethyl ether. The ether phase was dried and dissolved in HPLC-grade methanol. Store at 20℃ until analysis. Polyamine content was determined using a Waters ACQUITY UPLC H-Class system, employing an ACQUITY UPLC HSS T3 column with acetonitrile / water (44:56, v / v) as the mobile phase, a flow rate of 0.45 mL / min, a column temperature of 30℃, a detection wavelength of 230 nm, and an injection volume of 2 µL. Data were analyzed using Empower software to calculate the content of various free polyamines, including putrescine, spermidine, and spermine, in the sample.
[0074] 2 Results and Analysis 2.1 Analysis of Cadmium Tolerance in Paspalum distichum 2.1.1 Overexpression PvSAMDC2 Improving the cadmium tolerance of seashore paspalum Transgenic lines OE4, OE5, and OE8, as well as the wild-type line WT, were selected. At least three cuttings of each line were propagated and planted in soil substrate. One month later, when the growth of all lines was uniform, each individual plant was subjected to stress treatment by watering with the same volume of 125 mM dCl2 solution. The results showed that under natural conditions, there was no significant difference between the transgenic lines and the wild type. After 10 days of stress treatment, the leaves of the wild-type lines began to wilt and turn yellow, and in severe cases, even withered. The transgenic lines, however, retained more green leaves and showed significantly better growth than the wild type. Figure 4 -A).
[0075] 2.1.2 Overexpression PvSAMDC2 Effects of cadmium absorption on seashore paspalum On the third day of CdCl2 treatment, the cadmium ion content in the roots, stems, and leaves of the transgenic seashore paspalum lines OE04, OE05, and OE08, as well as the wild-type WT, was measured. The results showed that the cadmium ion content in the roots, stems, and leaves of the wild-type was significantly higher than that of the transgenic lines. Figure 4 -C), preliminary judgment of overexpression PvSAMDC2 It has the ability to reduce the cadmium ion content in the leaves and stems of the sea finches.
[0076] 2.1.3 Overexpression PvSAMDC2 Effects on photosynthesis of seashore paspalum Cadmium stress leads to leaf yellowing and decreased photosynthetic rate, with Fv / Fm and chlorophyll content being the core indicators for assessing photosynthetic efficiency. Under cadmium stress, the degree of leaf yellowing in wild-type plants was significantly higher than that in transgenic lines, and both chlorophyll content and net photosynthetic rate were significantly lower in wild-type plants than in transgenic plants. Figure 4 -B,D,E).
[0077] 2.1.4 Overexpression PvSAMDC2 Effects on the steady state of ROS in seashore paspalum Cadmium ions often poison plants by inducing endoplasmic reticulum stress, leading to protein folding failure or abnormal folding, ultimately causing protein inactivation. Under control conditions, the transgenic lines showed no significant differences in soluble protein, SOD, POD, GSH, APX, and ASA compared to the wild type, but CAT was higher and MDA concentration was lower. Under cadmium stress, MDA content was significantly lower than in the wild type. Figure 5 -C), soluble protein showed no significant change ( Figure 5 -F), the transgenic lines showed significantly higher levels of SOD, POD, APX, and ASA than the wild type ( Figure 5 - G, H, J, L), CAT and GSH variations were not significantly different from those in the wild type. Figure 5 -I, K), from which we can know that the expression PvSAMDC2 The cadmium tolerance of seashore paspalum can be improved by increasing and maintaining the levels of antioxidant enzymes and ascorbic acid.
[0078] Example 3: Seashore Paspalum PvSAMDC2 Salt tolerance function verification analysis 1. Experimental Materials and Methods Plant materials: Wild-type Sea Spray, prepared in Example 1 containing... PvSAMDC2 Transgenic lines that overexpress the target gene.
[0079] Plant material cultivation and treatment: Select two PvSAMDC2 Overexpression lines (OE4, OE5) and a wild-type line WT were used as experimental subjects. They were propagated by rhizome and stolon cuttings in premixed organic matter (a 1:1:2 mixture of sterilized vermiculite, perlite, and potting soil). Each line was propagated in triplicate. The temperature was 25±2℃, humidity 60-70%, and the photoperiod was 16 hours / 8 hours (light intensity 800 μmol·m²). -2 ·s -2 Water it every 3-4 days.
[0080] Before salt treatment, all pre-treated lines were stopped from watering for seven days before salt treatment. Initially, each line was treated with a 500 mM / L sodium chloride solution for seven days, and then the solution was changed to a 700 mM / L sodium chloride solution. When wild-type lines showed severe wilting or even the leaves began to dry out, samples were taken in time and various physiological and biochemical indicators were measured. When significant differences in traits were observed between lines, photos were taken and recorded.
[0081] 1.1Na + K + Ion content determination Take 0.2g of the first and second leaves from the top of a single stem of the plant, wash with ultrapure water and ddH2O. After freezing in liquid nitrogen, grind into powder. Weigh 0.1g of the powder, add 5 mL of HNO3 and 1 mL of HClO4, let stand overnight, and heat at 160-170℃ to digest until a light yellow color remains, with approximately 1 mL remaining. Add 10 mL of deionized water, heat for 5 minutes, and bring the volume to 25 mL. Determine Na by atomic absorption spectrophotometry. + K + content.
[0082] 1.2 Other indicators were measured in the same way as in Example 2 above. 2 Results and Analysis 2.1 Salt tolerance analysis of seashore paspalum 2.1.1 Overexpression PvSAMDC2 Improving the salt tolerance of seashore paspalum Under high salt stress, the survival rate and leaf growth status of wild-type and transgenic Paspalum notatum showed significant differences. After treatment with 700 mM sodium chloride solution, the leaves of all lines showed wilting and shrinkage. However, the aboveground parts of the wild-type lines were severely chlorotic and the mortality rate was high, while the aboveground parts of the transgenic lines could still maintain a good growth status and still had a high survival rate after 60 days of high salt treatment.
[0083] Experimental results are as follows Figure 4 As shown, under natural conditions ( Figure 6 -A), there was no significant difference in growth status between wild-type and transgenic types after salt treatment ( Figure 6 -B), the older leaves at the base of each strain began to show varying degrees of drying, with the wild type exhibiting severe drying of the lower leaves, and the middle of the plant also showing signs of drying; while the transgenic plants retained more green leaves at the base compared to the wild type, and the middle of the plant was less affected by stress. After 60 days of continuous high salt treatment, all wild-type plants died, but the transgenic strains still survived. After 15 days of high salt treatment, the survival rate of the transgenic plants was significantly higher ( Figure 6-D). This shows that salt stress severely damaged the physiological characteristics and function of leaves in wild-type lines, while the leaves of transgenic lines were less damaged.
[0084] 2.1.2 Overexpression of PvSDMAC2 on Na+ in seashore paspalum + K + Effect of content Maintaining ion homeostasis plays a crucial role in plant adaptation to salt stress. Under control conditions, the potassium (K) in the roots of transgenic OE4 and OE5 plants was significantly lower. + The content was significantly higher than that of the wild type ( Figure 7 -A), indicating a stronger ability to absorb or retain potassium ions in the roots; however, K in the leaves... + The content was significantly lower than that of the wild type ( Figure 7 -D). Meanwhile, Na in the roots of transgenic OE4 and OE5 plants... + The content was significantly lower than that of the wild type ( Figure 7 -B), but Na in the leaves + There was no significant difference in content ( Figure 7 -E).
[0085] Following salt stress treatment, potassium levels in the roots and leaves of transgenic OE4 and OE5 plants were significantly reduced. + The content was significantly higher than that of wild type ( Figure 7 -A, E), indicating that it can still maintain a high K content under high salinity conditions. + Levels, thus maintaining cellular ion balance and osmotic stability. Conversely, Na... + The K content did not differ significantly between the two plant types. It is noteworthy that the K content in the roots of transgenic plants increased after salt stress. + / Na + The ratio was not significantly different from that of the wild type. Figure 7 -C), but K in the leaves + / Na + The ratio was significantly higher than that of the wild type ( Figure 7 -F) indicates that transgenic plants possess superior ion regulation capabilities under salt stress, especially in maintaining higher K levels more effectively in the aboveground tissues. + / Na + This balance enhances its salt tolerance.
[0086] It is understood that those skilled in the art can make equivalent substitutions or modifications to the technical solutions and concepts of this invention, and all such substitutions or modifications should fall within the protection scope of the appended claims.
Claims
1. PvSAMDC2 Application in any of the following: (1) Application in improving plant tolerance to cadmium stress; (2) Application in improving plant tolerance to salt stress; (3) Application in reducing cadmium accumulation in plants; (4) Application in constructing transgenic materials resistant to cadmium stress; (5) Application in cadmium stress-tolerant plant breeding; The PvSAMDC2 The CDS sequence is shown in SEQ ID NO.
1.
2. Includes PvSAMDC2 The expression carrier is used in any of the following applications: (1) Application in improving plant tolerance to cadmium stress; (2) Application in improving plant tolerance to salt stress; (3) Application in reducing cadmium accumulation in plants; (4) Application in constructing transgenic materials resistant to cadmium stress; (5) Application in cadmium stress-tolerant plant breeding; The PvSAMDC2 The CDS sequence is shown in SEQ ID NO.
1.
3. The application of host bacteria containing recombinant vectors in any of the following: (1) Application in improving plant tolerance to cadmium stress; (2) Application in improving plant tolerance to salt stress; (3) Application in reducing cadmium accumulation in plants; (4) Application in constructing transgenic materials resistant to cadmium stress; (5) Application in cadmium stress-tolerant plant breeding; The recombinant vector is a genome-specific vector. PvSAMDC2 The carrier, the PvSAMDC2 The CDS sequence is shown in SEQ ID NO.
1.
4. The application as described in any one of claims 1-3, characterized in that, The plant in question is seashore paspalum.
5. A method for improving plant tolerance to cadmium stress and / or salt stress, characterized in that, Including overexpression in plants PvSAMDC2 Under cadmium or salt stress conditions, plants can improve their tolerance to cadmium and / or salt stress by accumulating more free polyamines, including spermine, spermidine, and putrescine, and by enhancing the activity of enzymes related to the antioxidant defense system. PvSAMDC2 The CDS sequence is shown in SEQ ID NO.
1.
6. A method for cultivating plants tolerant to cadmium stress and / or salt stress, characterized in that, Including overexpression in plants PvSAMDC2 Methods for cultivating plants tolerant to cadmium stress and / or salt stress; PvSAMDC2 The CDS sequence is shown in SEQ ID NO.
1.
7. A method for reducing cadmium accumulation in plants, characterized in that, Including through gene overexpression in plants PvSAMDC2 To reduce cadmium accumulation in the roots, stems, and leaves of plants; PvSAMDC2 The CDS sequence is shown in SEQ ID NO.
1.
8. The method according to any one of claims 5-7, characterized in that, The plant in question is seashore paspalum.