Kiwi fruit transcription factor AcCOL5 gene and application thereof
By inhibiting the expression of the kiwifruit transcription factor AcCOL5 gene, the resistance of the fruit to gray mold was reduced, solving the problem of easy rotting of kiwifruit, providing breeding resources, and enhancing the effect of resistance breeding.
Patent Information
- Application Number
- CN202610197310.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-11
- Publication Date
- 2026-04-03
AI Technical Summary
Kiwifruit is susceptible to infection by gray mold, which can cause rot. Existing technologies are not effective in preventing and controlling this, thus hindering the development of the industry.
By inhibiting the expression of the kiwifruit transcription factor AcCOL5 gene, the resistance of the fruit to gray mold was reduced. A silencing expression system for the AcCOL5 gene was constructed by genetic engineering using an AcCOL5 gene silencing vector and specific primers.
It significantly reduces the resistance of kiwifruit to gray mold, increases the area of lesions, reduces the activity of defensive enzymes, provides genetic resources to support breeding, and increases the likelihood of successful resistance breeding.
Smart Images

Figure CN121780600A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to a kiwifruit transcription factor. AcCOL5 Application of genes in fruit resistance to gray mold. Background Technology
[0002] Kiwifruit, scientific name ( Actinidia chinensis Kiwifruit, a vine-like fruit tree native to China, is widely popular for its unique flavor, rich nutritional value, and medicinal properties. It contains abundant vitamin C, antioxidants, and total phenolic compounds, exceeding those of other fruits. Therefore, kiwifruit is one of the world's most important fruit crops, now cultivated in many countries globally. However, after harvesting, kiwifruit is susceptible to infection by various fungi, leading to fruit rot and spoilage, especially by Botrytis cinerea (gray mold). Botrytiscinerea Gray mold, caused by kiwifruit, is the most destructive disease and severely restricts the development of the kiwifruit industry.
[0003] Gray mold is an airborne pathogen, a necrotic fungus that is widely distributed and parasitizes crops and ornamental plants. Gray mold disease caused by *Gyromitra kiwifruit* primarily affects the flowers, young fruit, and leaves of kiwifruit, and can continue to damage the fruit during post-harvest storage. It causes very serious economic losses to the kiwifruit industry, exceeding 30%.
[0004] CONSTANS ( COL The gene family plays a very important regulatory role in plants, and the proteins it encodes are photoperiodic transcription factors that regulate plant growth and development and respond to abiotic stress. COL Genes have different expression patterns and functions in different plants. COL The gene family is characterized by an N-terminal B-box domain and a C-terminal CCT (CO, CO-like and TOC1 (Timing of CAB Expression 1) domain. Based on these characteristics, it can be classified... COL The genes are divided into three groups: Group I contains one B-box and one CCT domain; Group II contains two B-boxes and one CCT domain; and Group III contains one complete B-box, one diffuse zinc finger structure, and one CCT domain. The B-box plays a crucial role in plant proteins and protein-protein interactions, particularly in flowering regulation, light signal sensing, and responses to biotic stress. The presence of the B-box domain endows these genes with specific functions and regulatory capabilities. Summary of the Invention
[0005] To identify the functions of different genes in response to gray mold infection in kiwifruit and provide sufficient gene resources for gray mold resistance breeding in kiwifruit, this invention aims to provide a kiwifruit transcription factor. AcCOL5 A new application of the gene: inhibiting the expression of this gene significantly weakens the resistance of kiwifruit to gray mold.
[0006] To achieve the above objectives, the technical solution provided by the present invention is as follows:
[0007] This invention provides a transcription factor that regulates the resistance of kiwifruit to gray mold. AcCOL5 The gene, the coding sequence of which is shown in SEQ ID NO. 1, and the amino acid sequence of which is shown in SEQ ID NO. 2, is used to inhibit the expression of this gene. AcCOL5 Genes reduce the resistance of kiwifruit to gray mold.
[0008] This invention also provides a transcription factor that regulates the above-mentioned resistance of kiwifruit to gray mold. AcCOL5 The primers for gene amplification are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0009] Furthermore, the present invention also provides a solution containing the above-mentioned kiwifruit transcription factor. AcCOL5 Genetically engineered bacteria.
[0010] A kiwifruit transcription factor AcCOL Application of gene 5 in the resistance of kiwifruit to gray mold. The coding sequence of the gene is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.
[0011] The present invention has the following beneficial effects: Because plant resistance to gray mold conforms to the quantitative trait characteristics controlled by multiple genes, the resistance phenotype is synergistically regulated by multiple genes and is easily affected by environmental factors, exhibiting continuous variation. The identification of numerous gray mold-related gene loci has become particularly important in plant breeding. Understanding the regulatory network composed of multiple genes helps researchers understand the resistance mechanisms of gray mold in different varieties, enabling variety optimization after gene interactions.
[0012] This invention provides a transcription factor that regulates the resistance of kiwifruit to gray mold. AcCOL Gene 5, whose expression is suppressed, significantly reduces the resistance of kiwifruit to gray mold. This invention clones... AcCOL5The gene was identified and its role in resisting gray mold in kiwifruit was demonstrated. Specifically, after inoculation with the virus, compared with the control, the transgenic fruit obtained by this invention showed more severe disease symptoms, a significantly larger infected area, and a significant decrease in the activities of SOD, POD, and CAT enzymes in the fruit compared with the control group. This can provide sufficient gene resources for breeding kiwifruit resistance to gray mold, thereby greatly increasing the possibility of subsequent success in modern molecular breeding. Attached Figure Description
[0013] Figure 1 Inhibit expression AcCOL5 Phenotypic observation of kiwifruit infected with gray mold compared to the control group.
[0014] Figure 2 Inhibit expression AcCOL5 Statistics on the area of lesions in kiwifruit infected with gray mold for 3 days and 5 days compared to the control group.
[0015] Figure 3 Inhibit expression AcCOL5 Changes in POD activity in kiwifruit infected with gray mold for 3 and 5 days compared to the control group.
[0016] Figure 4 Inhibit expression AcCOL5 Changes in SOD activity in kiwifruit infected with gray mold for 3 and 5 days compared to the control group.
[0017] Figure 5 Inhibit expression AcCOL5 Changes in CAT activity in kiwifruit infected with gray mold for 3 and 5 days compared to the control group. Detailed Implementation
[0018] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention, but the present invention is not limited to the scope of the specific embodiments.
[0019] All carriers and the 'Hongyang' kiwifruit variety used in the following examples were obtained from Chongqing Sanlei Tiantian Agricultural Development Co., Ltd., and all reagents were commercially available. The *Botrytis cinerea* strain used in the experiment was CJLC2, preserved in our laboratory at -80℃. After being removed from the ultra-low temperature freezer, it was thawed on ice, aseptically inoculated onto PDA medium, and activated by incubation at 25℃ for three weeks. It was then transferred to a new medium and incubated for another two weeks before being diluted and used to infect kiwifruit.
[0020] Example 1: Kiwi fruit transcription factor AcCOL5 Obtaining gene silencing sequences RNA was extracted using a polysaccharide and polyphenol plant total RNA extraction kit (BaiSha Biotechnology Co., Ltd.), and the obtained kiwifruit total RNA was reverse transcribed into cDNA using an All-in-One First-Strand Synthesis Master Mix (with dsDNase) kit (Jiangsu Baishimei Technology Biotechnology Co., Ltd.). The specific steps are as follows: First, 'Hongyang' kiwifruit leaves were rapidly frozen in liquid nitrogen, ground into powder, and transferred to a 1.5 mL centrifuge tube. 600 μL of Buffer PSL lysis buffer was immediately added, vortexed for 30 s, and centrifuged at 12000 rpm for 5 min. 500 μL of the supernatant was transferred to a Fast Pure gDNA-Filter Columns III adsorption column equipped with a collection tube, centrifuged at 12000 rpm for 30 s, discarded the adsorption column, and retained the filtrate. 250 μL of anhydrous ethanol was added to the filtrate, vortexed for 15 s, and then the mixture was transferred to a Fast Pure RNA Columns V adsorption column (with a collection tube), centrifuged at 12000 rpm for 30 s, and the filtrate was discarded. Add 700 μL of Buffer RWA to the adsorption column, centrifuge at 12000 rpm for 30 s, and discard the filtrate. Then add 500 μL of Buffer RWB (confirm that 48 mL of anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 s, and discard the filtrate. Repeat this washing step to ensure complete removal of impurities. Place the adsorption column back into the collection tube, centrifuge at 12000 rpm for 2 min, then open the cap and let it stand for 5 min to allow residual ethanol to evaporate. Finally, place the adsorption column in a new 1.5 mL centrifuge tube, add 80 μL of RNase-free ddH2O to the center of the column, let it stand for 2 min, centrifuge at 12000 rpm for 1 min, and collect the RNA solution.
[0021] Using the obtained total RNA as a template, reverse transcription was performed using the All-in-One First-Strand Synthesis MasterMix (with dsDNase) kit. In a PCR tube, 1 μg of total RNA, 4 μL of All-in-One First-Strand Synthesis Master Mix, and 1 μL of dsDNase were added sequentially, followed by ddH2O to a total volume of 20 μL. The reaction program was as follows: incubation at 37°C for 2 min, 55°C for 15 min, and 85°C for 5 min to terminate the reaction. The resulting cDNA was stored at -20°C for later use.
[0022] Obtained from the Sapindaceae Genome Database (https: / / www.sapindaceae.com / GeneSearch / GeneSearch.html) AcCOL5 The gene sequence information, its base sequence is shown in SEQ ID NO. 1, and its amino acid sequence is shown in SEQ ID NO. 2. According to... AcCOL5 The gene's base sequence was designed as follows: Primers for the silencing region were used to construct the silencing vector: Upstream primer: agtctcaacaaccaatcacac (SEQ ID NO. 3) Downstream primer: cgtattgaccgaaccacaaaagtc (SEQ ID NO. 4) The cDNA obtained from the reverse transcription process was used as a template for amplification. The enzyme mixture used in the PCR reaction was 2×Taq plus Master Mix with Dye (White Shark Biotechnology Co., Ltd.). The PCR reaction system was as follows: 2×Taq plus Master Mix with Dye, 12.5 μL; sterile water, 10.5 μL; cDNA template, 1 μL; forward and reverse primers, 0.5 μL each. The reaction conditions are shown in Table 1.
[0023] Table 1 PCR reaction conditions
[0024] The amplified PCR products were subjected to agarose gel electrophoresis. After observing bands in a fluorescence image analysis system, the products were removed and placed in a fully automated gel imaging system. Clearly bright bands were cut and placed into appropriate centrifuge tubes, and then analyzed using EZNA. ® The Gel Extraction Kit is used for purification and recovery.
[0025] Example 2 AcCOL5 Construction of silencing vectors and analysis of resistance to gray mold 1. Construction of expression carrier The purified PCR product was ligated into the intermediate vector GV pX19-T Vector and sequenced. The fragment size was 233 bp, and the base sequence is shown in SEQ ID NO. 5. The correctly sequenced plasmid was extracted, and the TRV2 vector and the correctly sequenced plasmid were double-digested with Kpn I and BamHI, respectively. A DNA ligase containing [the following fragments are used to construct a DNA ligation sequence] was then used. AcCOL5 The target gene was silenced using a vector and transformed into *E. coli* DH5α. The transformed samples were plated on Kana antibody-resistant plates, and PCR was performed on resistant colonies. Plasmids were extracted from PCR-positive colonies and sequenced. After successful sequencing, the constructed TRV2-AcCOL5 and TRV1 vectors were mixed in a 1:1 ratio and transformed into *Agrobacterium* GV3101.
[0026] 2. Disease resistance analysis The above-mentioned Agrobacterium GV301 was used to transiently transform pollinated 'Hongyang' kiwifruit fruits, which were uniform in size, undamaged, and free from pests and diseases, 140 days after pollination. Subsequently, 10 μL of Botrytis cinerea (1... 10 6 Kiwifruit fruits from the transgenic and control groups were infected with a spore suspension (spores / mL) and 10 μL of sterile water, respectively. Subsequently, samples were collected around the injection wells at fixed times each day and... Store at 80℃. Phenotypic observation ( Figure 1 ) and lesion area ( Figure 2 Statistical results showed that a significant difference in the degree of rot was observed between the two groups of kiwifruit three days after infection with Botrytis cinerea; by the fifth day... AcCOL5 Extensive rot occurred around wounds on kiwifruit, while the control group, whose fruits were silent, showed relatively mild rot symptoms at the wound sites. Further investigation was conducted to examine changes in defensive enzymes in transgenic and control kiwifruit during Botrytis cinerea infection. The activities of SOD, POD, and CAT were measured using a superoxide dismutase (SOD) activity assay kit (Beijing Solarbio Science & Technology Co., Ltd., BC0170), a peroxidase (POD) activity assay kit (Beijing Solarbio Science & Technology Co., Ltd., BC0090), a catalase (CAT) activity assay kit (Beijing Solarbio Science & Technology Co., Ltd., BC0680), and an ELISA reader (Tianjin Seres Automation Technology Co., Ltd.).
[0027] The measurement procedure and calculation methods were performed according to the kit instructions. The t-test method in GraphPad Prism 10 software was used for significance analysis. ImageJ software was used to calculate the area of kiwifruit lesions. The results showed that silent expression... AcCOL5 Subsequently, the lesion area was larger than that of the control group. On the third day, the lesion area of the transgenic fruit was 2.83 times that of the control group; on the fifth day, it was 3.05 times that of the control group. Furthermore, the activities of SOD, POD, and CAT enzymes in the transgenic fruit were significantly reduced. Regarding SOD enzyme activity, on the third day, the activity of the transgenic group was 24.7 U / g lower than that of the wild-type control group, and on the fifth day, it was 31.2 U / g lower. Figure 3 Regarding POD enzyme activity, the transgenic group showed a decrease of 22.21 U / g on day 3 compared to the wild-type control group, and a decrease of 116.5 U / g on day 5. Figure 4 Regarding CAT enzyme activity, the transgenic group showed a decrease of 47.73 U / g on day 3 compared to the wild-type control group, and a decrease of 33.75 U / g on day 5. Figure 5 These results indicate that silencing occurs in kiwifruit fruit. AcCOThe L5 gene can reduce the resistance of kiwifruit to gray mold by inhibiting the activity of SOD, POD and CAT enzymes.
Claims
1. A kiwifruit transcription factor AcCOL Application of gene 5 in the resistance of kiwifruit to gray mold. The coding sequence of the gene is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO.
2.
2. The kiwifruit transcription factor as described in claim 1 AcCOL Primers for amplifying 5 genes, characterized in that: The primer sequences are shown in SEQ ID NO.3 and SEQ ID NO.
4.
3. A transcription factor regulating resistance to gray mold in kiwifruit AcCOL 5 genes, the coding sequence of which is shown in SEQ ID NO. 1 and the amino acid sequence is shown in SEQ ID NO.
2.
4. A formulation containing kiwifruit transcription factors AcCOL A 5-gene engineered bacterium, characterized by: The coding sequence of this gene is shown in SEQ ID NO. 1.
Citation Information
Patent Citations
Kiwi fruit transcription factor AcNAC4 and application thereof in synthesis of fruit ester aromatic substances
CN113088525A
Kiwi fruit canker susceptible gene AcBXL1 and application thereof
CN113604490A
Application of kiwi fruit transcription factor AcARF1 gene in gray mold resistance
CN114231536A