Construction method of transcriptome library and kit

Abstract

The invention provides a construction method of a transcriptome library and a kit. The construction method comprises the following steps: randomly breaking a cDNA product of a sample to obtain a broken product; modifying the tail end of the broken product and adding an A tail to obtain an A tail-added product; the product added with the A tail is connected with a connector, and a product connected with the connector is obtained; and removing a TSO sequence in a product connected with the linker by using a TSO probe to obtain a purified sample, and carrying out PCR amplification on the purified sample to obtain the single cell transcriptome library. The method can solve the problem of poor TSO sequence removal effect in a single cell transcriptome library in the prior art, and is suitable for the field of transcriptome sequencing.

Description

Technical Field

[0001] This invention relates to the field of transcriptome sequencing, and more specifically, to a method and kit for constructing a transcriptome library. Background Technology

[0002] Since its inception, transcriptome sequencing technology has played a vital role in biological research, especially bulk RNA-seq, which reveals the average gene expression patterns of cell populations by sequencing the RNA of large numbers of cells. However, this technique has a limitation: it cannot capture gene expression differences between individual cells, which is particularly inadequate given the increasing research focus on cellular heterogeneity. With the emergence and maturation of single-cell transcriptome sequencing (scRNA-seq) technology, it is possible to explore cellular characteristics and functions at the single-cell level. This technology not only identifies new cell types and discovers rare cell populations, but more importantly, it can depict detailed maps of cellular states under specific conditions, providing unprecedented research perspectives for multiple fields such as neurobiology, oncology, and immunology. Since its first report in 2009, single-cell transcriptome sequencing technology has rapidly become a core tool in related scientific research.

[0003] Currently, the mainstream single-cell transcriptome sequencing platform is 10×Genomics. It combines microfluidic technology, oil droplet encapsulation, and barcode labeling to achieve high-throughput cell capture, capable of isolating and labeling 500-20,000 single cells at a time, thereby obtaining 3' or 5' transcriptome information for each cell. Specifically, this platform uses the Poly(dT)VN sequence to capture mRNA molecules with a PolyA tail. Under the action of reverse transcriptase, the generated cDNA one-strand automatically extends to a C-tail, which pairs complementary with the G-rich TSO sequence. Through a primer-mediated PCR reaction, double-stranded cDNA is finally obtained, providing the basic material for library construction.

[0004] However, during single-cell transcriptome library construction, although TSO sequences should theoretically be excluded, in practice, reads containing TSO sequences frequently appear in Fastq sequence data. This phenomenon reduces the usable data in the final library, affects the alignment efficiency between sample data and the reference genome, and consequently reduces sequencing quality. The presence of TSO sequences not only wastes sequencing resources but also increases the complexity of data processing, becoming a stumbling block to improving the performance of single-cell transcriptome sequencing technology. Summary of the Invention

[0005] The main objective of this invention is to provide a method and kit for constructing a transcriptome library to solve the problem of poor TSO sequence removal in single-cell transcriptome libraries in the prior art.

[0006] To achieve the above objectives, according to a first aspect of the present invention, a method for constructing a transcriptome library is provided, the method comprising: randomly fragmenting the cDNA product of a sample to obtain fragmented products; modifying the ends of the fragmented products by adding an A-tail to obtain an A-tailed product; ligating the A-tailed product to an adapter to obtain a product after adapter ligation; removing the TSO sequence from the product after adapter ligation using a TSO probe to obtain a purified sample; and then performing PCR amplification on the purified sample to obtain a transcriptome library.

[0007] Furthermore, the nucleotide sequences of the TSO probe are SEQ ID NO: 1 and SEQ ID NO: 2.

[0008] Furthermore, the TSO probe contains biotin modification.

[0009] Furthermore, the product after ligation with the adapter is incubated with the TSO probe to obtain the binding product;

[0010] The conjugated product was purified to obtain the purified product.

[0011] Furthermore, the incubation temperature is 55~60℃; preferably, the incubation time is 5~15min.

[0012] Furthermore, the purification method includes purifying the conjugated product using magnetic beads; preferably, the magnetic beads include streptavidin magnetic beads.

[0013] Furthermore, the construction method also includes: the sample cDNA is not purified before being randomly fragmented.

[0014] To achieve the above objectives, according to a second aspect of the present invention, a kit for constructing a transcriptome library is provided, the kit comprising a TSO probe.

[0015] Furthermore, the nucleotide sequences of the TSO probe are SEQ ID NO: 1 and SEQ ID NO: 2.

[0016] Furthermore, the TSO probe contains biotin modification; preferably, the kit also includes magnetic beads; preferably, the magnetic beads include streptavidin magnetic beads.

[0017] By applying the technical solution of this invention, before PCR amplification, the product ligated with the adapter is combined with a TSO probe, enabling the TSO probe to bind to the TSO sequence in the product. Subsequently, redundant and unnecessary TSO sequences in the sample to be amplified can be removed through purification before PCR amplification, thereby increasing the sample data in the single-cell transcriptome library and improving the quality of the constructed single-cell transcriptome library. The library obtained using the single-cell transcriptome library construction method of this application lays the foundation for subsequent immunological and pathological analysis and research of samples, and is beneficial to improving the accuracy and efficiency of data analysis. Attached Figure Description

[0018] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0019] Figure 1 The figure shows the quality test results of a single-cell transcriptome library from Example 2 of this application.

[0020] Figure 2 The figure shown is a graph illustrating the quality test results of a single-cell transcriptome library from Comparative Example 1 of this application. Detailed Implementation

[0021] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the embodiments.

[0022] Terminology Explanation:

[0023] TSO sequence: short for Target Specific Oligonucleotide, is an oligonucleotide used to achieve template switching during reverse transcription. By complementary pairing with the non-template-added dC sequence at the 3' end of cDNA, the reverse transcriptase integrates the TSO sequence into the 5' end of the cDNA, thereby achieving the synthesis of full-length cDNA and subsequent amplification and library construction.

[0024] As mentioned in the background section, the presence of TSO sequences leads to wasted bioinformatics data and affects alignment values ​​with the reference genome. Therefore, in this application, the inventors propose a novel method for constructing a single-cell transcriptome library that removes TSO sequences and improves the quality of the final library, thus proposing a series of protection schemes in this application.

[0025] In a first typical embodiment of this application, a method for constructing a transcriptome library is provided. This method includes: randomly fragmenting the cDNA product of a sample to obtain fragmented products; modifying the ends of the fragmented products by adding an A-tail to obtain an A-tailed product; ligating the A-tailed product to a adapter to obtain a ligated product; removing the TSO sequence from the ligated product using a TSO probe to obtain a purified sample; and then performing PCR amplification on the purified sample to obtain a transcriptome library. The aforementioned transcriptome library includes, but is not limited to, a single-cell transcriptome library.

[0026] In the process of constructing a full-length single-cell transcriptome library, the third-generation sequencing platforms Oxford Nanopore Technology and PacBio use the principle of specific binding of biotin and streptavidin to remove fragments (TSO artifacts) with TSO sequences at both ends from the purified cDNA product.

[0027] The basic approach to TSO sequence removal in existing technologies is as follows: before library construction using cDNA products from randomly fragmented samples, cDNA fragments extracted from the target sample are first subjected to biotin-modified PCR; then, streptavidin magnetic beads are used to bind to the biotin-modified amplification products, enriching the target cDNA fragments and removing impurities that did not bind to the magnetic beads, including TSO sequences. Existing technologies achieve TSO sequence removal from samples using this method. Finally, the target cDNA products are collected using PCR or enzyme digestion, and these cDNA products are used for subsequent single-cell transcriptome library construction. However, in the preliminary research of this application, the inventors found through experimental analysis that the TSO sequence accounted for 40% of the purified cDNA products, meaning that TSO was not completely removed during purification. The presence of these fragments will lead to a decrease in the usable data after sequencing, affecting the quality of sequencing and subsequent library construction. The applicant believes that this may be due to PCR amplification after cDNA ligation, RNA degradation, excessive TSO, or reactions with reverse transcriptase, which may cause TSO fragments to embed into cDNA fragments. The presence of these sequences will reduce the usability of sequencing data and the mapping value with the reference genome.

[0028] Therefore, there is an urgent need for an innovative technical solution that can efficiently remove TSO sequences, thereby improving the utilization rate of sequencing data and enhancing the alignment rate with the reference genome. This application addresses this by placing TSO sequence removal post-construction during library building. First, the cDNA of the sample is randomly fragmented and ligated with adapters. The aforementioned TSO probe binds to the product after adapter ligation, allowing the TSO probe to bind to the TSO sequence within the product. Subsequent purification methods remove the TSO sequence, resulting in a single-cell transcriptome library with enhanced sample data. This avoids data redundancy, improves library quality, and enhances the accuracy of subsequent bioinformatics analysis.

[0029] The product resulting from the ligation of the adapter is a product formed by randomly fragmenting the sample cDNA and attaching an A-tail and adapter to its ends. This adapter includes, but is not limited to, the Read2 adapter, and can be any adapter commonly used in library construction known to those skilled in the art. The step of randomly fragmenting the sample cDNA and attaching an A-tail and adapter to its ends is a standard procedure for constructing a single-cell transcription library. The sample includes any tissue or cell sample suitable for single-cell transcription sequencing; this application does not impose any limitation. The cDNA extraction method can be any extraction method known to those skilled in the art.

[0030] In a preferred embodiment, the nucleotide sequences of the TSO probe are SEQ ID NO: 1 and SEQ ID NO: 2.

[0031] In a preferred embodiment, the TSO probe contains biotin modification.

[0032] SEQ ID NO: 1: TGTACTCTGCGTTGATACCACTGCTT.

[0033] SEQ ID NO: 2: TAAGCAGTGGTATCAACGCAGAG.

[0034] The dual TSO probe sequence designed in this application possesses high affinity for TSO sequences bound to both the forward and reverse strands of DNA. Through the design of the dual probe, this application enables complementary base pairing between the probe and the TSO-containing DNA forward and reverse strands for subsequent removal. Combined with the aforementioned method, this improves the TSO removal rate compared to existing methods and probes.

[0035] To further enhance this specific recognition and separation effect, biotin can be used to modify the TSO probe. Biotin is a water-soluble vitamin that can bind to streptavidin to form a stable complex, thereby achieving specific recognition and separation of target molecules. In this application, two complementary TSO probes are linked to biotin. Subsequently, the specific affinity of biotin for streptavidin is utilized to purify and remove the biotin-containing TSO probe + TSO sequence, thus removing most of the TSO sequence from the cDNA sample, thereby increasing the amount of sample data in the library and further improving the quality of the single-cell transcriptome library.

[0036] In a preferred embodiment, the product after ligation is combined with the TSO probe and then incubated to obtain a binding product; the binding product is then purified to obtain a purified product.

[0037] In a preferred embodiment, the incubation temperature is 55~60℃ (including but not limited to 55℃, 56℃, 57℃, 58℃, 59℃ or 60℃); preferably, the incubation time is 5~15min (including but not limited to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 min).

[0038] This application controls the incubation temperature at 55 to 60°C and the time at 5 to 15 minutes, which can promote the TSO probe to effectively recognize and bind to the TSO sequence on the cDNA fragment, avoid non-specific binding, facilitate the subsequent magnetic bead purification step, and further improve the quality of library construction and the resolution of sequencing data.

[0039] In a preferred embodiment, the purification method includes purifying the conjugated product using magnetic beads; preferably, the magnetic beads include streptavidin magnetic beads.

[0040] In a preferred embodiment, the construction method further includes: the sample cDNA is not purified before being randomly fragmented.

[0041] This application is based on the principle of specific binding between streptavidin and biotin. It utilizes streptavidin magnetic beads to bind to biotin-labeled TSO probes to enrich and remove cDNA fragments containing TSO sequences. The purified product obtained is a collection of high-quality cDNA fragments containing little or no TSO sequences. Subsequent PCR can then yield a single-cell transcriptome library with increased sample data and improved quality, providing technical support for the study of sample tissues and cells.

[0042] In a second typical embodiment of this application, a kit for constructing a transcriptome library is provided, the kit including a TSO probe.

[0043] In a preferred embodiment, the nucleotide sequences of the TSO probe are SEQ ID NO: 1 and SEQ ID NO: 2.

[0044] In a preferred embodiment, the TSO probe contains biotin modification; preferably, the kit further includes magnetic beads; preferably, the magnetic beads include streptavidin magnetic beads.

[0045] Using the TSO probes in the above-described kit, residual TSO sequences embedded in the cDNA of the sample during library construction can be identified and removed, significantly improving library quality and the reliability of sequencing data. The TSO probes in this kit specifically bind to the TSO sequences. Preferably, the TSO probes are biotin-modified, enabling them to form stable complexes with streptavidin magnetic beads, allowing for efficient and precise removal during purification steps, separating the cDNA sample along with the TSO sequences. This simplifies the complex library construction process, promotes the accuracy and depth of sequencing data, and improves the efficiency and effectiveness of sample research.

[0046] The beneficial effects of this application will be explained in more detail below with reference to specific embodiments.

[0047] Example 1

[0048] The library construction process in this embodiment of the application, from cDNA product fragmentation, end modification to add an A tail, addition of Read2 adapter, and sample index PCR, uses the 10× Genomics Library Construction Kit (PN-1000196).

[0049] 1. Remove fragments containing TSO sequences;

[0050] 1. The product after connecting the connector is 15µL;

[0051] 2. The TSO sequence of the product after the TSO probe binds to the ligator;

[0052] The reaction system is shown in Table 1, the reaction conditions are shown in Table 2, and the total volume of the reaction system is 20 µL.

[0053] Biotin-modified TSO probe sequence:

[0054] DH2F1: / 5Biosg / TGTACTCTGCGTTGATACCACTGCTT (SEQ ID NO: 1);

[0055] DH2R: / 5Biosg / TAAGCAGTGGTATCAACGCAGAG (SEQ ID NO: 2).

[0056] Table 1

[0057]

[0058] Table 2

[0059]

[0060] 3. Prepare 4 mL of 2× binding-washing buffer; the formulation components are shown in Table 3.

[0061] Table 3

[0062]

[0063] 4. Transfer 3.5 mL of 2× binding-wash buffer to a 15 mL centrifuge tube, and add 3.5 mL of NF water to dilute it to 1× binding-wash buffer;

[0064] 5. Vortex resuspension of M280 streptavidin magnetic beads;

[0065] 6. Place 5µL of beads into a clean 1.5mL low-adsorption tube;

[0066] 7. Add 1 mL of 1× binding-washing buffer, vortex for 5 seconds, place the test tube on a magnetic rack for 2 minutes, and discard the supernatant;

[0067] 8. Repeat step 7 twice more;

[0068] 9. Add 20µL of 2× binding-washing buffer and resuspend until homogeneous;

[0069] 10. Take 20µL of the prepared M280 beads and mix them with 20µL of sample cDNA. Incubate at room temperature on a rotary mixer for 20 min.

[0070] 11. Centrifuge at 5000g for 5 min at 4℃, and transfer 40µL of supernatant to a new PCR tube;

[0071] 12. Vortex mix the SPRI magnetic beads beforehand, add 32µL of SPRI magnetic beads (0.8×) and mix by blowing and sucking. Incubate at room temperature for 5 minutes, then place on a magnetic rack (High) until the supernatant is clear and transparent. Discard the supernatant.

[0072] 13. Add 200µL of 80% ethanol to wash the magnetic beads. After 30 seconds, discard the supernatant and repeat the operation once.

[0073] 14. Centrifuge rapidly, place the PCR tube on a magnetic rack, discard the residual ethanol, let stand for 30 seconds, add 16µL EB, incubate at room temperature for 2 minutes, and transfer 15µL of elution buffer to a new PCR tube.

[0074] 15. Incubate the above products at 55°C for 10 min on a PCR instrument, pre-cool to 4°C, and then perform sample index PCR (a PCR method known to those skilled in the art) to build a library.

[0075] Example 2

[0076] Using the method described in Example 1, a library was constructed from clinical human breast cancer tissue samples. After library construction, the obtained single-cell transcriptome library underwent quality control. The library quality control results were satisfactory (AATI, standard DNA quality control methods), with no small fragments and peaks between 400-500 bp. The peak plot results are shown below. Figure 1 As shown, Figure 1 In this example, "LM" refers to the lower marker, which serves as the calibration point for the lower limit of molecular weight, and is 35bp; "UM" refers to the upper marker, which serves as the calibration point for the upper limit of molecular weight, and is 5000bp in this example. The explanations for the other peaks are the same as here. The library test results are shown in Table 4.

[0077] Table 4

[0078]

[0079] After TSO purification, the percentage of reads aligned to the reference genome increased by 30% (compared to the prior art, i.e., Comparative Example 2 of this application), while the percentage of TSO decreased by 20%.

[0080] Comparative Example 1

[0081] Library construction was performed on human breast cancer tissue consistent with that in Example 2 using an unoptimized reaction system (using only the DH2R probe, a commonly used biotin-modified probe complementary to the TSO sequence; DH2R is used as bait to extract TSO-containing sequences from the denatured DNA product). Peak diagrams are shown below. Figure 2 As shown in Table 5, the results of the warehouse inspection are as follows.

[0082] Table 5

[0083]

[0084] Comparative Example 2

[0085] Library construction was performed on clinical human breast cancer tissue samples using existing technology (TSO artifacts removal operation performed before ONT single-cell third-generation library construction; for specific steps, please refer to the ONT official website SQK-LSK114 kit user manual). The results are shown in Table 6.

[0086] Table 6

[0087]

[0088] Existing technologies cannot be directly adjusted to steps after the removal of the Read2 adapter. TSO optimization is limited to pre-library construction and aims to remove independent TSO sequence byproducts from cDNA. For complex cases where TSO sequences are directly embedded or tandemly incorporated into the target fragment, the improvement is limited.

[0089] As can be seen from the above description, the above embodiments of the present invention achieve the following technical effects: This application introduces a TSO probe into the product after ligating the adapter during the library construction process, which can bind to the TSO sequence in the product after ligating the adapter. Subsequently, the TSO sequence in the product can be removed by simple magnetic bead purification, thereby increasing the amount of sample data in the final library and thus improving the quality of the library.

[0090] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for constructing a transcriptome library, characterized in that, The construction method includes: The cDNA product of the sample is randomly fragmented to obtain fragmented products; The ends of the broken product are modified by adding an A tail to obtain an A-tailed product; Connect the A-tailed product to the connector to obtain the product after connecting the connector; The TSO sequence in the product after ligation of the adapter is removed using a TSO probe to obtain a purified sample. The purified sample is then subjected to PCR amplification to obtain the transcriptome library.

2. The construction method according to claim 1, characterized in that, The nucleotide sequences of the TSO probe are SEQ ID NO: 1 and SEQ ID NO:

2.

3. The construction method according to claim 1, characterized in that, The TSO probe is biotin-modified.

4. The construction method according to claim 1, characterized in that, The product after the connector is combined with the TSO probe and then incubated to obtain the binding product; The conjugated product is then purified to obtain a purified product.

5. The construction method according to claim 1, characterized in that, The incubation temperature is 55~60℃; Preferably, the incubation time is 5 to 15 minutes.

6. The construction method according to claim 4, characterized in that, The purification method includes purifying the conjugated product using magnetic beads; Preferably, the magnetic beads comprise streptavidin magnetic beads.

7. The construction method according to claim 6, characterized in that, The construction method further includes: the sample cDNA is not purified before being randomly fragmented.

8. A kit for constructing a transcriptome library, characterized in that, The kit includes a TSO probe.

9. The reagent kit according to claim 8, characterized in that, The nucleotide sequences of the TSO probe are SEQ ID NO: 1 and SEQ ID NO:

2.

10. The reagent kit according to claim 9, characterized in that, The TSO probe is biotin-modified. Preferably, the kit further includes magnetic beads; Preferably, the magnetic beads comprise streptavidin magnetic beads.

Images