TET2 as biomarker for wet age-related macular degeneration and application of TET2

By detecting the expression level of TET2 protein and regulating its expression using TET2 activators such as vitamin C, the problem of lacking highly specific biomarkers for wet age-related macular degeneration (nAMD) has been solved, enabling precise diagnosis and treatment of nAMD.

CN121780680APending Publication Date: 2026-04-03EYE & ENT HOSPITAL SHANGHAI MEDICAL SCHOOL FUDAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-29
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing technologies lack highly specific biomarkers for wet age-related macular degeneration (nAMD), resulting in poor early diagnosis and treatment outcomes. Furthermore, long-term anti-VEGF treatment carries individual differences and the risk of macular atrophy.

Method used

This study aims to provide TET2 as a biomarker for wet age-related macular degeneration (nAMD) and its applications. By detecting the expression level of TET2 protein and regulating its expression with TET2 activators such as vitamin C, drugs can be prepared for the precise diagnosis and treatment of nAMD.

Benefits of technology

It enables precise assessment of nAMD disease progression based on individual TET2 protein expression levels, provides highly specific biomarkers for detection and treatment, and improves diagnostic accuracy and treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780680A_ABST
    Figure CN121780680A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biomedicine, and relates to a biomarker for wet age-related macular degeneration and application of the biomarker. According to the present invention, the change of the expression level of the TET2 protein in the biological sample is detected to evaluate the disease state, such that the TET2 can be adopted as the potential of the wet age-related macular degeneration (nAMD) biomarker and the treatment target spot, and the application of the TET2 in the treatment of the wet age-related macular degeneration (nAMD) can be provided. The aptamer is applied to preparation of products for detecting nAMD and / or drugs for treating diseases caused by nAMD, and has important clinical value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to a biomarker for wet age-related macular degeneration and its application. Specifically, the biomarker is TET2. Background Technology

[0002] Wet age-related macular degeneration (nAMD) is one of the leading causes of irreversible vision loss in the elderly. Its pathological features mainly include choroidal neovascularization (CNV), macular edema, subretinal fibrosis (SRF), and ocular inflammation, severely impacting patients' vision. The pathogenesis of nAMD is complex, with immune and inflammatory responses playing crucial roles in its progression. In particular, the abnormal activation of myeloid macrophages in the local microenvironment is a significant factor driving disease progression. With age, cumulative damage to the retinal pigment epithelium (RPE)-choroidal complex (such as drusen deposition and oxidative stress) can induce epigenetic reprogramming of macrophages, thereby affecting their inflammatory phenotype and function.

[0003] Currently, anti-vascular endothelial growth factor (anti-VEGF) drugs have become the first-line treatment for nAMD, which can inhibit angiogenesis and reduce edema to some extent. However, long-term anti-VEGF therapy still faces many challenges: some patients develop treatment resistance, and the treatment effect varies from person to person; long-term use can increase the risk of macular atrophy. In addition, anti-VEGF therapy has limited inhibitory effect on symptomatic retinopathy of prematurity (SRF), and 60-70% of patients still experience SRF progression after long-term treatment, seriously affecting visual prognosis. Summary of the Invention

[0004] In view of this, the purpose of this invention is to provide a biomarker for wet age-related macular degeneration and its application, which solves the problem of the lack of highly specific biomarkers for nAMD in the prior art, and provides a new technical means for the early and accurate diagnosis and treatment of nAMD, and has important clinical value.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] In a first aspect, the present invention provides a detection reagent for biomarkers associated with wet age-related macular degeneration, the nucleotide sequences of which are as shown in SEQ ID NO.1:

[0007]

[0008] Preferably, the detection reagent comprises a primer pair for detecting the biomarker, the nucleotide sequence of which is shown in SEQ ID NO.2-3:

[0009] TET2-F: TCGCAGAAGCAGCAGTGAAGAG (SEQ ID NO. 2);

[0010] TET2-R: AGCCAGAGACAGCGGGATTCCTT (SEQ ID NO. 3).

[0011] Secondly, the present invention also provides the application of TET2 activator in the preparation of drugs for diseases related to wet age-related macular degeneration.

[0012] Preferably, the TET2 activator is vitamin C.

[0013] Preferably, the condition associated with wet age-related macular degeneration is selected from at least one of the following (A)-(D):

[0014] (A) Choroidal neovascularization;

[0015] (B) Macular edema;

[0016] (C) Subretinal fibrosis;

[0017] (D) Eye inflammation.

[0018] Preferably, the TET2 activator is vitamin C.

[0019] Preferably, the drug inhibits symptoms associated with wet age-related macular degeneration by regulating the expression of the TET2 protein.

[0020] More preferably, the regulation is positive regulation.

[0021] Preferably, the drug is an ophthalmic preparation.

[0022] More preferably, the dosage form of the ophthalmic preparation is eye drops, eye ointment, eye spray, ophthalmic gel, eye patch, intraocular injection, ophthalmic microsphere, ophthalmic implant, periocular injection, or ophthalmic sustained-release preparation.

[0023] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0024] This invention provides a biomarker for wet age-related macular degeneration (nAMD) and its application, which can accurately determine the progression of nAMD based on an individual's TET2 protein expression level. This solves the problem of the lack of highly specific biomarkers for nAMD in the prior art. It can be applied to the preparation of products for detecting nAMD and / or drugs for treating symptoms caused by nAMD, and has important clinical value. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 A graph showing the statistical analysis of transcriptional differences of the TET2 gene in different groups;

[0027] Figure 2 Figure A shows the results of TET2 protein expression level analysis in different groups; Figure B shows the statistical analysis of expression differences.

[0028] Figure 3 The graphs show the correlation analysis results between the levels of various pro-inflammatory factors and the relative TET2 mRNA levels in patients with active nAMD; Figure A shows the statistical graph of the correlation analysis between IL-6 and the relative TET2 mRNA levels; Figure B shows the statistical graph of the correlation analysis between IL-1β and the relative TET2 mRNA levels; and Figure C shows the statistical graph of the correlation analysis between TNF-α and the relative TET2 mRNA levels.

[0029] Figure 4 The images show the immunofluorescence analysis results of IB4 staining on a flat-surface slide of the vascular complex in a mouse model on day 7 after laser-induced lesion formation. Image A shows the IB4 staining results; Image B shows the statistical analysis of the area of ​​myeloid cells (containing tdTomato red fluorescent protein); and Image C shows the statistical analysis of the area of ​​CNV lesions.

[0030] Figure 5 The images show the CNV lesion detection results in a mouse model on day 7 after laser-induced lesion formation. Image A shows the fundus imaging results; Image B shows the statistical analysis of FFA angiography; Image C shows the OCT imaging; and Image D shows the statistical analysis of CNV lesion thickness.

[0031] Figure 6The images show the results of immunofluorescence analysis of α-SMA staining on a flat-surface slide of a mouse model of neuropathy 14 days after laser-induced lesioning; Figure A shows the α-SMA staining results; Figure B shows the statistical analysis of α-SMA antibody area.

[0032] Figure 7 Figure 1 shows the results of TET2 protein expression level analysis in different groups of the CNV lesion mitigation trial; Figure A shows the expression difference results; Figure B shows the statistical analysis of expression differences.

[0033] Figure 8 The figures show the CNV lesion detection results in a mouse model on day 7 after laser-induced lesion reduction in a CNV lesion experiment; Figure A shows the fundus imaging results; Figure B shows the statistical analysis of FFA angiography.

[0034] Figure 9 The image shows the immunofluorescence analysis results of IB4 staining on a flat-surface slide of the vascular endothelial complex in a mouse model on day 7 after laser-induced lesion reduction in a CNV lesion experiment. Image A shows the IB4 staining results; Image B shows the statistical analysis of myeloid cell area; and Image C shows the statistical analysis of CNV lesion area.

[0035] Figure 10 The image shows the immunofluorescence analysis results of α-SMA staining on a flat-surface slide of a mouse model of vasomotor complex on day 14 after laser-induced lesion reduction in a CNV lesion experiment. Image A shows the α-SMA staining results, and image B shows the statistical analysis of the α-SMA antibody area. Detailed Implementation

[0036] The technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0037] It should be noted that the order of description of the following embodiments is not intended to limit the preferred order of embodiments. Furthermore, in the description of this invention, the term "comprising" means "including but not limited to". Various embodiments of the invention may exist in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be construed as a rigid limitation on the scope of the invention; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within that range. For example, it should be considered that the range description from 1 to 6 has specifically disclosed sub-ranges, such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and single digits within the range, such as 1, 2, 3, 4, 5, and 6, regardless of the range. Additionally, whenever a numerical range is indicated herein, it means including any referenced number (fraction or integer) within the indicated range.

[0038] TET2 (Ten-eleven Translocation-2), a key DNA demethylase, participates in regulating the transcriptional activity of various genes, especially exhibiting specific regulatory functions in myeloid cells. This invention focuses on a systematic study of the expression changes and functions of the TET2 protein in individuals with nAMD, aiming to reveal its potential value in disease diagnosis and treatment, and to provide new avenues for developing novel intervention strategies.

[0039] The following specific embodiments further illustrate a biomarker for wet age-related macular degeneration and its application. This section further explains the invention with reference to specific embodiments, but should not be construed as limiting the invention. Unless otherwise specified, the techniques used in the embodiments are conventional methods well known to those skilled in the art, such as the conditions described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory or the conditions recommended by the manufacturer. Unless otherwise specified, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in the art.

[0040] In the following embodiments, the Cre-Loxp system is described in accordance with the method described in the literature ([1] Shi J, Hua L, Harmer D, et al. Cre driver mice targeting macrophages[M] / / Macrophages: Methods and Protocols. New York, NY: Springer New York, 2018: 263-275.).

[0041] In the following examples, the IB4 staining was performed in accordance with the method described in the literature ([2] Theodoropoulou S, Copland DA, Liu J, et al. Interleukin‐33 regulates tissue remodelling and inhibits sangiogenesis in the eye[J]. The Journal of pathology, 2017, 241(1): 45-56.).

[0042] Example: Correlation verification of TET2 with symptoms caused by nAMD

[0043] 1. Sample classification and processing

[0044] This embodiment sets up 3 experimental groups and 1 control group. Specifically, peripheral blood samples were collected from 50 patients with dry age-related macular degeneration (dAMD group), 50 patients with active wet age-related macular degeneration (nAMD active group), and 50 patients with scarring wet age-related macular degeneration (nAMD scarring group) as experimental groups. At the same time, peripheral blood samples were collected from 50 cataract patients without fundus lesions (healthy control group) as control group.

[0045] 2. Extraction of peripheral blood mononuclear cells (PBMCs) and plasma

[0046] Peripheral blood samples were diluted with an equal volume of sterile PBS buffer. Then, Ficol extraction buffer (Shanghai Gleise Life Sciences Co., Ltd., catalog number: 17544602) was mixed with the diluted sample mixture at a volume ratio of 1:1 and centrifuged at 400 g for 30 min. The supernatant was collected separately to obtain plasma extract and PBMC extract. Red blood cells in the PBMC extract were lysed using erythrocyte lysis buffer (MedChemExpress LLC, catalog number: HY-K3010) and centrifuged at 400 g for 5 min. The precipitate after centrifugation was the PBMC precipitate.

[0047] 3. Analysis of TET2 gene transcription and TET2 protein expression

[0048] 3.1 Analysis of TET2 gene transcription level

[0049] 3.1.1 RNA Extraction

[0050] Add 1 mL of Trizol lysis buffer to the PBMC precipitate and mix well. Then add 200 μL of chloroform and immediately vortex for 20 s. After standing at room temperature for 2 min, centrifuge at 12000 rpm for 15 min at 4 ℃. Take the supernatant after centrifugation and add an equal volume of isopropanol. Mix by inverting the container and let stand at room temperature for 10 min. After centrifugation at 12000 rpm for 10 min at 4 ℃. Discard the supernatant and add 1 mL of anhydrous ethanol. Centrifuge at 7500 rpm for 10 min at 4 ℃. After discarding the supernatant, invert the container to dry for 30 min. Add 20 µL of RNase-free H2O (Thermo Fisher Scientific Inc., catalog number: 10977023) and heat in a dry bath at 55 ℃ for 15 min. Detect the obtained RNA sample using a NanoDrop 2000 (Thermo Fisher Scientific Inc.) for subsequent experiments.

[0051] 3.1.2 Reverse transcription of cDNA

[0052] Genomic DNA removal and amplification system: 4 µl of 4x gDNA wiper Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number: R323), 1 µg of RNA sample, and 16 µl of RNase-free H2O; reaction program: 42 ℃, 2 min.

[0053] Reverse transcription amplification system: 4 µl of 5x HiScript III RT SuperMix (Nanjing Novizan Biotechnology Co., Ltd., catalog number: R323) and 16 µl of genomic DNA removal system reaction solution; reaction program: 15 min at 37 ℃, followed by 5 s at 85 ℃.

[0054] 3.1.3 qRT-PCR analysis

[0055] A CFX96™ Real-Time PCR instrument (Bio-Rad Laboratories, Inc.) was used. The internal control gene was β-actin. The qRT-PCR amplification system consisted of: 10 μL of 2x ChamQ Universal SYBR qPCR Master Mix (Nanjing Novizan Biotechnology Co., Ltd., catalog number: Q711), 0.5 μL each of upstream and downstream primers (the nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NO. 2-3, respectively; where "F" represents the upstream primer and "R" represents the downstream primer), 5 μL of cDNA sample, and RNase-free H2O to a final volume of 20 μL. The reaction program was: 95 ℃ for 30 s (pre-denaturation), 95 ℃ for 10 s (PCR reaction), and 60 ℃ for 30 s (40 cycles). Melting curves were plotted using the instrument's default program.

[0056] Figure 1 The graph shows the statistical analysis of the transcriptional differences of the TET2 gene in different groups. The vertical axis "Relative TET2 mRNA levels" represents the relative TET2 mRNA level. The results show that the transcriptional level of the TET2 gene was significantly reduced in the patient population with nAMD-induced disease (i.e., the nAMD active phase group and the nAMD scarring phase group).

[0057] 3.2 Analysis of TET2 protein expression level

[0058] 3.2.1 Protein Extraction

[0059] Add 50 μL of Cell Lysis Buffer (Thermo Fisher Scientific Inc., catalog number: FNN0011) to the PBMC precipitate, mix well, centrifuge at 4 ℃ and 12000 rpm for 10 min, and collect the supernatant to obtain the protein extract.

[0060] 3.2.2 SDS-PAGE and Western blot analysis

[0061] The protein extract was mixed with SDS loading buffer (Thermo Fisher Scientific Inc., catalog number: LC1676) and heated at 95°C for 10 min. 10 μL of the mixture was then subjected to SDS-PAGE electrophoresis and Western blot analysis. β-actin was used as the internal control protein. The gray values ​​of the protein samples in each group were compared to analyze the expression level of TET2 protein among the groups.

[0062] Figure 2The results of the TET2 protein expression level analysis in different groups are shown in Figure A. Figure A is a statistical analysis of expression differences, where the vertical axis "Relative TET2 protein levels" represents the relative TET2 protein level. Figure B is a graph showing the expression difference results. The results show that the expression level of TET2 protein was significantly reduced in the patient population with nAMD-induced disease (i.e., the nAMD active phase group and the nAMD scarring phase group), which is consistent with the analysis results of TET2 gene transcription level.

[0063] 4. Correlation analysis between TET2 gene transcription level and pro-inflammatory factor level

[0064] 4.1 Detection of pro-inflammatory factors in peripheral blood plasma

[0065] The levels of pro-inflammatory factors IL-6, TNF-α, and IL-1β in peripheral blood plasma of the nAMD active group were detected using the human interleukin-6 (IL-6) enzyme-linked immunosorbent assay kit (Wuhan Elite Biotechnology Co., Ltd., catalog number: E-EL-H6156), the human tumor necrosis factor-α (TNF-α) enzyme-linked immunosorbent assay kit (Wuhan Elite Biotechnology Co., Ltd., catalog number: E-EL-H0109), and the human interleukin-1β (IL-1β) enzyme-linked immunosorbent assay kit (Wuhan Elite Biotechnology Co., Ltd., catalog number: E-EL-H0149).

[0066] 4.2 Correlation Analysis

[0067] The relative TET2 mRNA level data obtained above were combined with the level data of each pro-inflammatory factor for correlation analysis: for data that conformed to a normal distribution, Pearson correlation analysis was used; for data that did not conform to a normal distribution, Spearman correlation analysis was used. The statistical analysis and processing of the data were performed using IBM SPSS Statistics 25 software (IBM Corporation, America).

[0068] Figure 3 The correlation analysis results of various pro-inflammatory factor levels and relative TET2 mRNA levels in patients with active nAMD are shown in the figure. Figure A shows the correlation analysis of IL-6 and relative TET2 mRNA levels; Figure B shows the correlation analysis of IL-1β and relative TET2 mRNA levels; and Figure C shows the correlation analysis of TNF-α and relative TET2 mRNA levels. The results show that the levels of all pro-inflammatory factors were significantly elevated in patients with active nAMD, and were significantly negatively correlated with TET2 gene transcription levels (p < 0.001).

[0069] 5. In vivo validation experiment in mice

[0070] 5.1 Construction of the mouse model

[0071] Lyz2 cre B6-G / R is a genetically engineered mouse model belonging to the C57BL / 6 background knock-in strain, which is typically used to specifically knock out or express target genes in myeloid cells.

[0072] This embodiment utilizes the Cre-Loxp system principle to construct myeloid tracing mice Lyz2 cre B6-G / R and TET2 mice, respectively. MC-KO B6-G / R mice (TET2) MC-KO This indicates a specific knockout of the TET2 gene. The specific steps are as follows: B6-G / R mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd., strain number: T006163) are crossed and cultured with Lyz2-specific promoter-driven Cre recombinase transgenic mice (Jiangsu Jicui Yaokang Biotechnology Co., Ltd., strain number: T003822) for at least two generations to obtain Lyz2 cre B6-G / R mice; Tet2... f TET2 mice were obtained by crossbreeding mice (Shanghai Jackson Medical Technology Co., Ltd., strain number: 017573) with Lyz2 cre B6-G / R mice for at least two generations. MC-KO B6-G / R mice.

[0073] 5.2 The TET2 gene is involved in regulating CNV lesions.

[0074] 5.2.1 Sample Preparation

[0075] (1) Laser-induced modeling: Two types of 6-8 week old myeloid tracer mice (Lyz2 cre B6-G / R mice as control) were weighed (g), and compound tropicamide eye drops (Medoli, Santen Pharmaceutical China Co., Ltd.) were applied to both eyes to dilate the pupils; 0.02 times the mouse body weight (g) of medical ready-to-use anesthetic was injected intraperitoneally, and compound tropicamide eye drops were applied to both eyes again to dilate the pupils; levofloxacin hydrochloride ophthalmic gel (Hubei Yuanda Tianming Pharmaceutical Co., Ltd.) was applied to a round coverslip and then placed over the mice's eyes; laser spots were generated evenly around the optic disc using a laser (avoiding retinal blood vessels as much as possible). When the laser penetrated the Bruch membrane and transparent bubbles were visible, the modeling was successful.

[0076] (2) Separation of the choroid-scleral complex flattening: The anesthetized mouse eyeball was removed and fixed in paraformaldehyde solution (Nanjing Senbeijia Biotechnology Co., Ltd., product number: BL-G002) for 1 h. After the end of the procedure, the extrascleral connective tissue and attached muscle were trimmed and removed. A circular incision was made 1 mm behind the limbus to remove the anterior segment and retina, including structures such as the cornea, iris, and lens. The remaining complex was then made into 4-5 radial incisions and flattened on a glass slide until the RPE-choroid-scleral complex was completely flattened.

[0077] 5.2.2 Examination of CNV lesions in the fundus

[0078] 5.2.2.1 IB4 staining immunofluorescence analysis

[0079] Figure 4 The image shows the IB4 staining immunofluorescence analysis results of a mouse model of vascular endothelial cell complex (VECC) on day 7 after laser-induced lesions. Image A shows the IB4 staining results, with red representing myeloid cells and white representing neovascularization. Image B shows the statistical analysis of the area of ​​myeloid cells (carrying tdTomato red fluorescent protein), with the vertical axis "Relative tdTomato positive area" representing the relative tdTomato protein area. Image C shows the statistical analysis of the CNV lesion area, with the vertical axis "Relative CNV area" representing the relative CNV lesion area. The results show that in TET2... MC-KO In B6-G / R mice, myeloid cells were recruited to the lesion site in greater numbers, and the CNV lesion area was larger.

[0080] 5.2.2.2 Fundus imaging, FFA angiography, and OCT detection

[0081] (1) Fundus imaging examination: After anesthetizing and fixing the mice, compound tropicamide eye drops were used to dilate the pupils; promecaine hydrochloride eye drops (Alcon China Ophthalmic Products Co., Ltd.) were used for surface anesthesia; after the pupils were dilated, medical carbomer eye drops (Shandong Bausch & Lomb Freda Pharmaceutical Co., Ltd.) were applied to the cornea of ​​the eye to be tested; the condition of both eyes was observed using a small animal microvascular ultra-micro imaging system (Optoprobe Science Ltd, United Kingdom, model: Micro-VCC).

[0082] (2) FFA (fluorescein sodium) contrast imaging examination: The experimental mice were weighed and injected intraperitoneally with fluorescein sodium injection solution (Alcon China Ophthalmic Products Co., Ltd., product number: 107R4) at a ratio of 1.7 ml / kg; after the pupils of the eyes were dilated, medical carbomer eye drops were applied to the cornea to be tested; the light source of the small animal microvascular ultra-micro imaging system was replaced with the Blue channel, the light intensity and manual filter wheel were adjusted, and the condition of both eyes was observed.

[0083] (3) OCT (Optical Coherence Tomography) detection: After anesthetizing and fixing the mice, compound tropicamide eye drops were used to dilate the pupils; promecaine hydrochloride eye drops were used for surface anesthesia; after the pupils were dilated, ultrasound coupling gel (Kefu Medical Technology Co., Ltd.) was applied to the cornea to be tested; the light source of the ophthalmic super-microscopic imaging system (OptoprobeScience Ltd, United Kingdom, model: ISOCT) was adjusted and focused, and the lens focus was adjusted to the retina to perform OCT scanning imaging of the retina. Figure 5 The results of CNV lesion detection in a mouse model on day 7 after laser-induced lesion are shown. Figure A shows the fundus imaging results; Figure B shows the statistical analysis of FFA angiography, where the vertical axis "Lesionsevenity" represents the degree of CNV lesion (%), with higher values ​​indicating stronger lesions; Figure C shows the OCT imaging; and Figure D shows the statistical analysis of CNV lesion thickness, where the vertical axis "Relative lesion thickness" represents the relative lesion thickness. The results show that TET2... MC-KO B6-G / R mice showed increased leakage of CNV lesions and thicker CNV lesions.

[0084] 5.2.2.3 α-SMA staining immunofluorescence analysis

[0085] After separating the vasomotor complex and spreading the slide, it was blocked at 37°C for 1 h with 0.1% Triton X-100 (MerckKGaA, catalog number: X100) solution and PBS-BSA solution (Shanghai Yuanye Biotechnology Co., Ltd., catalog number: R27679). After aspirating the excess liquid, α-SMA antibody (Shanghai Abogen Biosciences Co., Ltd., catalog number: ab124964) was added and incubated overnight at 4°C under humid conditions. After overnight incubation, it was placed at room temperature for 1 h and washed 3 times for 5 min each time with PBST buffer (PBS containing 0.5% Tween-20, Dalian Meilun Biotechnology Co., Ltd., catalog number: MA0101-1). After aspirating the excess liquid, it was incubated for 2 h with fluorescent secondary antibody (Shanghai Abogen Biosciences Co., Ltd., catalog number: ab202510) in the dark. The staining was observed under a fluorescence inverted microscope (Shanghai Leica Microsystems Trading Co., Ltd., model: DMi8).

[0086] Figure 6 The image shows the immunofluorescence analysis results of α-SMA staining on a flat-surface slide of the vasomotor complex in a mouse model 14 days after laser-induced lesions. Image A shows the α-SMA staining results, where blue-purple represents α-SMA antibodies. Image B shows the statistical analysis of the α-SMA antibody area, where the vertical axis "Relative α-SMA area" represents the relative α-SMA antibody area. The results show that TET2... MC-KO The increased subretinal fibrosis area in B6-G / R mice indicates that specific knockout of the TET2 gene exacerbates the CNV pathological process (i.e., increases vascular leakage and subretinal fibrosis).

[0087] 5.3 TET2 activator slows down the process of CNV lesions

[0088] This section uses Lyz2 cre B6-G / R mice as experimental subjects to investigate the process by which TET2 activator (vitamin C) alleviates CNV lesions. The specific steps are as follows: Mice were fed with physiological saline (control group) or vitamin C dissolved in physiological saline (experimental group, dose: 200 mg kg⁻¹ b.wgt) for 2 weeks. The experimental group and control group mice were subjected to laser-induced modeling, TET2 protein expression level detection, fundus imaging examination, FFA angiography examination and immunofluorescence analysis (IB4 staining, α-SMA staining) in sequence. The relevant detection, examination and / or analysis methods are the same as those described in Chapters 4-5 of this embodiment.

[0089] Figure 7 The results of the TET2 protein expression level analysis in different groups of the CNV lesion mitigation trial are shown in Figure A. Figure A shows the expression difference results, and Figure B shows the statistical analysis of expression differences. The vertical axis "Relative TET2 protein levels" in the figures represents the relative TET2 protein level. The results show that the relative TET2 protein level in the experimental group (Lyz2 cre B6-G / R+VC) was significantly higher than that in the control group (p<0.0001), indicating that vitamin C can effectively promote the expression of TET2 protein. Figure 8 The results of CNV lesion detection in a mouse model on day 7 after laser-induced lesion reduction in the CNV lesion mitigation experiment are shown. Figure A shows the fundus imaging results; Figure B shows the statistical analysis of FFA angiography. The vertical axis "Lesion seventy" represents the degree of CNV lesion (%), with higher values ​​indicating more severe lesions. The results show that the CNV lesion leakage was significantly reduced in the experimental group (Lyz2 cre B6-G / R+VC).

[0090] Figure 9The results of IB4 staining immunofluorescence analysis of the vascular endothelial complex (VDC) in a mouse model on day 7 after laser-induced lesion reduction in a CNV lesion mitigation experiment are shown. Figure A shows the IB4 staining results, with red representing myeloid cells and white representing neovascularization. Figure B shows the statistical analysis of the area of ​​myeloid cells (carrying tdTomato red fluorescent protein), where the vertical axis "Relative tdTomato positive area" represents the relative tdTomato protein area. Figure C shows the statistical analysis of the CNV lesion area, where the vertical axis "Relative CNV area" represents the relative CNV lesion area. The results show that the experimental group (Lyz2 cre B6-G / R+VC) had reduced myeloid cell recruitment to the lesion site and a reduced CNV lesion area.

[0091] Figure 10 The image shows the immunofluorescence analysis results of α-SMA staining on a mouse model of the vasomotor complex on day 14 after laser-induced lesion reduction in a CNV lesion mitigation experiment. Figure A shows the α-SMA staining results, with blue representing α-SMA antibodies. Figure B shows the statistical analysis of the α-SMA antibody area, where the vertical axis "Relative α-SMA area" represents the relative α-SMA antibody area. The results show that the subretinal fibrosis area was reduced in the experimental group (Lyz2 cre B6-G / R+VC), indicating that activating TET2 protein expression can reduce subretinal fibrosis.

[0092] comprehensive Figure 7-10 It is known that increasing TET2 protein expression can significantly improve mononuclear cell infiltration lesions, reduce CNV lesion area, leakage and fibrosis, thereby slowing down the development of CNV lesions.

[0093] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A reagent for detecting biomarkers associated with wet age-related macular degeneration, characterized in that, The nucleotide sequence of the biomarker is shown in SEQ ID NO.1; The detection reagent contains primer pairs for detecting the biomarker, the nucleotide sequences of which are shown in SEQ ID NO.2-3.

2. Application of TET2 activator in the preparation of drugs for diseases related to wet age-related macular degeneration.

3. The application as described in claim 2, characterized in that, The TET2 activator is vitamin C.

4. The application as described in claim 2, characterized in that, The condition associated with wet age-related macular degeneration is selected from at least one of the following (A)-(D): (A) Choroidal neovascularization; (B) Macular edema; (C) Subretinal fibrosis; (D) Eye inflammation.

5. The application as described in claim 2, characterized in that, The drug inhibits symptoms associated with wet age-related macular degeneration by regulating the expression of the TET2 protein.

6. The application as described in claim 5, characterized in that, The regulation mentioned is a positive regulation.

7. The application as described in claim 2, characterized in that, The drug is an ophthalmic preparation.

8. The application as described in claim 7, characterized in that, The dosage forms of the ophthalmic preparations are eye drops, eye ointments, eye sprays, ophthalmic gels, eye patches, intraocular injections, ophthalmic microspheres, ophthalmic implants, periocular injections, or ophthalmic sustained-release preparations.