Detection reagent for detecting bacterial cfDNA by using digital PCR, detection method and application
By designing a bacterial cfDNA detection reagent with specific primer and probe combinations and digital PCR technology, the problems of high positive rate, many interfering factors, and cumbersome sample processing in fecal testing samples have been solved, achieving high sensitivity and high accuracy in colorectal cancer screening and early diagnosis, which has clinical application value.
Patent Information
- Application Number
- CN202410045221.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-11
- Publication Date
- 2026-04-03
AI Technical Summary
Existing technologies suffer from high positive rates in fecal samples, numerous interfering factors, cumbersome sample collection and processing, and insufficient specificity and sensitivity in gene methylation detection, resulting in poor performance in colorectal cancer screening and early diagnosis.
Using bacterial cfDNA detection reagents and digital PCR technology, specific primer and probe combinations were designed to detect enterotoxin-producing Bacteroides fragilis, Fusobacterium nucleatum, and PKS+ Escherichia coli in blood. Qualitative and quantitative detection were achieved using digital PCR, and the high sensitivity and accuracy of digital PCR were combined to simplify the sample processing procedure.
It improves the sensitivity and specificity of colorectal cancer screening and early diagnosis, reduces sample volume, is simple to operate and yields stable results, and has clinical application value.
Smart Images

Figure CN121780686A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a detection reagent, detection method, and application for detecting bacterial cfDNA using digital PCR. Background Technology
[0002] Colorectal cancer (CRC) is one of the most common malignant tumors, ranking third in incidence and fourth in mortality worldwide. There are 560,000 new cases and 290,000 deaths annually. One person is diagnosed with colorectal cancer every minute, and one person dies from it every two minutes. In China, the incidence and mortality rates of colorectal cancer are rising year by year, showing a trend towards affecting younger people; higher rates in urban areas than rural areas; and higher rates in men than women. In recent years, with the development of early diagnosis and targeted therapy, the overall survival rate of colorectal cancer has slightly improved, but the prognosis for advanced-stage colorectal cancer remains very poor.
[0003] Meanwhile, the national government attaches great importance to early cancer screening. The "Cancer Prevention and Control Implementation Plan (2019-2022)" states: "Regarding the implementation of cancer prevention and control, for key cancers such as colorectal cancer, unified and standardized screening and early diagnosis and treatment technical guidelines will be formulated and promoted nationwide; the early diagnosis rate for key cancers will reach 55% by 2022." Colorectal cancer takes 10-15 years to develop, and the 5-year survival rate, intervention methods, and treatment costs vary greatly at different stages. When colorectal cancer progresses to a malignant stage, the 5-year survival rate drops sharply; intervention methods change from ordinary endoscopic resection to surgery or even chemotherapy; and treatment costs become exorbitant. Therefore, promoting prevention, screening, and early diagnosis is crucial for the prevention and control of colorectal cancer.
[0004] Traditional methods for early screening of colorectal cancer include fecal occult blood testing, which detects the hemoglobin content in stool. However, the false positive rate remains high, and the sensitivity for colorectal cancer is low, with insufficient sensitivity for advanced adenomas. Traditional colorectal cancer markers in physical examinations, including CEA and CA199, are good indicators of digestive tract diseases and are excellent early screening indicators, but their specificity and accuracy are low, and they change in different digestive tract diseases. Colonoscopy is the "gold standard" for detecting colorectal cancer, but it also has shortcomings, including low compliance, a certain risk of missed diagnoses, and surgical risks. With the continuous development of molecular detection technologies, various methods have been used for colorectal cancer screening, including peripheral blood Septin9 gene methylation detection, fecal miRNA-92a detection, Cologuard (USA), and fecal SDC2 gene methylation detection. However, these methods all target exfoliated tumor cells, and their specificity and sensitivity require further validation and optimization.
[0005] Recent studies have increasingly revealed the crucial role of the gut microbiota in the development and progression of colorectal cancer. Gut microbes, including *Fusobacterium nucleatum* (Fn), enterotoxin-producing *Bacteroides fragilis* (ETBF), and pks+ *Escherichia coli*, are associated with colorectal cancer development and progression by influencing intestinal inflammation and tumor-associated signaling pathways. Previous research has shown that *Fusobacterium nucleatum* can colonize colorectal cancer tumor tissue and promote colorectal cancer formation by activating the β-catenin signaling pathway; it also promotes tumor cell proliferation by upregulating NF-κB and miR-21 via TLR4, leads to CRC chemotherapy resistance by activating autophagy, and enhances the efficacy of PD-1 / PD-L1 antibody immunotherapy by activating the STING signaling pathway. Similarly, ETBF can colonize tumor sites, promote tumor development and progression by secreting enterotoxins, and recruit other bacteria to the tumor site, thus inducing an inflammatory response. Related studies have shown that ETBF promotes the formation of a pre-metastatic ecosystem, thereby promoting liver metastasis of colorectal cancer. pks+ *Escherichia coli* promotes colorectal cancer formation by secreting colistin. However, there are currently no mature specific bacterial detection kits that can be used for the diagnosis and prognosis guidance of colorectal cancer.
[0006] Detection of bacterial DNA in feces has the advantages of being simple, convenient, and non-invasive, but it also has disadvantages such as a high positive rate, many interfering factors, and cumbersome sample collection and processing. Blood has the advantages of being easy to collect and highly stable, but bacterial DNA fragments are more difficult to capture than feces. Therefore, this invention attempts to use a new high-sensitivity detection technology to detect bacterial DNA fragments in the blood of colorectal cancer patients.
[0007] Currently, no effective solutions have been proposed for the problems existing in related technologies, such as high positive rate in fecal samples, many interfering factors, cumbersome sample collection and processing, and insufficient specificity and sensitivity of gene methylation detection. Summary of the Invention
[0008] The purpose of this invention is to address the shortcomings of existing technologies by providing a detection reagent, detection method, and application for detecting bacterial cfDNA using digital PCR, thereby solving problems such as high positive rates in fecal samples, numerous interfering factors, cumbersome sample collection and processing, and insufficient specificity and sensitivity of gene methylation detection in related technologies.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] In a first aspect, a bacterial cfDNA detection reagent is provided, comprising a bacterial cfDNA extraction reagent and a digital PCR amplification reaction reagent, wherein the digital PCR amplification reaction reagent comprises a primer and probe composition for detecting bacterial cfDNA, wherein the primer and probe composition comprises at least one of a primer and probe set for detecting enterotoxin-producing Bacteroides fragilis, a primer and probe set for detecting Fusobacterium nucleatum, and a primer and probe set for detecting PKS+ Escherichia coli.
[0011] The primer and probe set for detecting enterotoxin-producing Bacteroides fragilis includes primers with sequences shown in SEQ ID NO: 1 to SEQ ID NO: 2 and probes with sequences shown in SEQ ID NO: 3; the primer and probe set for detecting Fusobacterium nucleatum includes primers with sequences shown in SEQ ID NO: 4 to SEQ ID NO: 5 and probes with sequences shown in SEQ ID NO: 6; and the primer and probe set for detecting pks+ Escherichia coli includes primers with sequences shown in SEQ ID NO: 7 to SEQ ID NO: 8 and probes with sequences shown in SEQ ID NO: 9.
[0012] The specific sequence information is shown in the table below:
[0013] name Sequence (5' to 3') Serial Number Enterotoxin-producing Bacteroides fragilis - upstream primer GGATAAGCGTACTAAAATACAGCTGGAT SEQ ID No: 1 Enterotoxin-producing Bacteroides fragilis - downstream primer CTGCGAACTCATCTCCCAGTATAAA SEQ ID No: 2 Enterotoxin-producing Bacteroides fragilis - probe sequence CAGACGGACATTCTC SEQ ID No: 3 Fusobacterium nucleatum - upstream primer CAACCATTACTTTAACTCTACCATGTTCA SEQ ID No: 4 Fusobacterium nucleatum - downstream primer GTTGACTTTACAGAAGGAGATTATGTAAAATC SEQ ID No: 5 Fusobacterium nucleatum - probe sequence GTTGACTTTACAGAAGGAGATTA SEQ ID No: 6 pks+E. coli-upstream primer GCGCATCCTCAAGAGTAAATA SEQ ID No: 7 pks+E. coli-downstream primer GCGCTCTATGCTCATCAACC SEQ ID No: 8 pks+E. coli probe sequence TATTCGACACAGAACAACGCCGGT SEQ ID No: 9
[0014] Furthermore, the bacterial cfDNA extraction reagent includes a buffer, a washing solution, an elution buffer, a proteinase (Proteinase K), a nucleic acid precipitation aid (RNase-Free ddH2O), and an adsorption column;
[0015] Furthermore, the buffer solution includes buffer GA, buffer GB, and buffer GD; the wash solution includes wash solution PW; and the elution buffer includes elution buffer TB.
[0016] Furthermore, the digital PCR amplification reaction reagent also includes Master Mix, DNA sample, and H2O.
[0017] Furthermore, the Master Mix includes dNTPs, Taq polymerase, DNA, polymerase, and Mg. 2+ PCR reaction buffer.
[0018] Further, in the 40 μL reaction system, the digital PCR amplification reaction reagent includes: 4 μL of primer and probe composition, 10 μL of DNA sample, and the remainder is made up with H2O; wherein, in the reaction system, the final concentration of primer is 0.8 μM and the final concentration of probe is 0.4 μM. Optionally, the reaction system may also include 1 μL of restriction enzyme.
[0019] Furthermore, the 5' end of the probe is labeled with a reporter fluorescent dye, and the 3' end is labeled with a quencher fluorescent dye; wherein, the reporter fluorescent dye is selected from FAM, HEX, VIC, ROX, TAMRA, and CY5; the quencher fluorescent dye is selected from MGB, and the reporter fluorescent dye of each probe is different.
[0020] Furthermore, the probe of the sequence shown in SEQ ID NO: 3 is labeled with FAM fluorescent dye at its 5' end and MGB at its 3' end; the probe of the sequence shown in SEQ ID NO: 6 is labeled with HEX fluorescent dye at its 5' end and MGB at its 3' end; the probe of the sequence shown in SEQ ID NO: 9 is labeled with TAMRA fluorescent dye at its 5' end and MGB at its 3' end.
[0021] It is understood that the fluorescent dyes and quenching fluorescent dyes mentioned above may also be other fluorescent dyes conventionally used in the art.
[0022] The second aspect provides a method for detecting bacterial cfDNA in blood using digital PCR with the detection reagents described in the first aspect, comprising the following steps:
[0023] S1. Extract cfDNA from the sample to be tested using a bacterial cfDNA extraction reagent;
[0024] S2. Detect the concentration and purity of the extracted cfDNA to determine the cfDNA that meets the criteria;
[0025] S3. The cfDNA extracted in step S2 is subjected to digital PCR amplification reaction using digital PCR amplification reaction reagent;
[0026] S4. Perform fluorescence detection on the digital PCR reaction products from step S3, and determine whether bacterial cfDNA fragments are present in the sample based on the detection results.
[0027] Further, in step S1, the samples include blood samples, tissue fluid samples, fecal samples, intestinal fluid samples, and oral samples; preferably, blood samples.
[0028] Further, in step S2, the concentration and purity of the extracted cfDNA are detected using an ultraviolet spectrophotometer. The cfDNA that meets the conditions satisfies the following: it has a significant absorption peak at OD260 and the OD260 / OD280 ratio is 1.7-1.9.
[0029] Further, in step S3, the reaction conditions for the digital PCR amplification reaction are: pre-denaturation: 95℃ for 2 min; denaturation: 95℃ for 15 s; annealing: 60℃ for 30 s, 40 cycles.
[0030] Furthermore, the method for determining whether bacterial cfDNA fragments exist in a sample includes: determining whether cfDNA fragments of enterotoxigenic Bacteroides fragilis, nucleotoxigenic Fusobacterium, or pks+ Escherichia coli exist in the sample based on the cut-off value; wherein, a positive control group and a negative control group are used to identify positive and negative cut-off values.
[0031] Furthermore, the cut-off value of the enterotoxin-producing Bacteroides fragilis is set to 50, the cut-off value of the nucleated Fusobacterium is set to 80, and the cut-off value of the pks+ Escherichia coli is set to 38.
[0032] Furthermore, the detection method further includes the following steps:
[0033] S5. Quantitative analysis of the relevant bacteria based on the test results.
[0034] Furthermore, in step S5, the quantitative analysis specifically includes:
[0035] The endpoint PCR results were detected and interpreted, and the number of effective droplets, positive droplets, and negative droplets were counted. The average number of target molecules in each droplet was calculated using the Poisson distribution, and then the concentration of target molecules in each reaction system was calculated.
[0036] Thirdly, an application is provided for a detection reagent as described in the first aspect or a detection method as described in the second aspect, the application being selected from at least one of the following applications: application in detecting bacterial cfDNA, application in preparing colorectal cancer screening and early diagnosis reagents.
[0037] The present invention adopts the above technical solution and has the following technical effects compared with the prior art:
[0038] This invention discloses a detection reagent, method, and application for detecting bacterial cfDNA using digital PCR. The reagent comprises a bacterial cfDNA extraction reagent and a digital PCR amplification reaction reagent. The primers and probes in the detection reagent are optimized. Digital PCR is used to achieve qualitative and quantitative detection of enterotoxigenic Bacteroides fragilis, Fusobacterium nucleatum, and PKS+ Escherichia coli. This method exhibits high sensitivity and accuracy, requires small sample volumes, and demonstrates high stability. The operation and result analysis are also simple. Furthermore, these three bacteria, individually or in combination, can serve as potential biomarkers for early colorectal cancer diagnosis. Therefore, the use of digital PCR to detect bacterial cfDNA and prepare colorectal cancer screening and early diagnosis reagents has clinical application value. Attached Figure Description
[0039] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are for illustrative purposes only, and do not constitute an undue limitation of the invention. In the drawings:
[0040] Figure 1 This is a representative diagram of the detection of Fusobacterium nucleatum according to an embodiment of the present invention;
[0041] Figure 2 This is a representative image of the detection of enterotoxin-producing Bacteroides fragilis according to an embodiment of the present invention;
[0042] Figure 3 This is a representative image of PKS+ Escherichia coli detection according to an embodiment of the present invention;
[0043] Figure 4 This is a positive rate statistical chart according to an embodiment of the present invention. Detailed Implementation
[0044] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.
[0045] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.
[0046] Example 1
[0047] In this embodiment, after determining the target sequence fragment and amplification primers, probes suitable for digital PCR detection of enterotoxigenic Bacteroides fragilis, Fusobacterium nucleatum, and PKS+ Escherichia coli were designed. The specific primer and probe compositions are shown below:
[0048] The primer and probe set for enterotoxin-producing Bacteroides fragilis includes:
[0049] The sequence of the upstream primer is shown in SEQ ID NO: 1: GGATAAGCGTACTAAAATACAGCTGGAT;
[0050] The sequence of the downstream primer is shown in SEQ ID NO: 2: CTGCGAACTCATCTCCCAGTATAAA;
[0051] The nucleotide sequence of the probe set is shown in SEQ ID NO: 3: CAGACGGACATTCTC;
[0052] Primer and probe set for Fusobacterium nucleatum:
[0053] The sequence of the upstream primer is shown in SEQ ID NO: 4: CAACCATTACTTTAACTCTACCATGTTCA;
[0054] The sequence of the downstream primer is shown in SEQ ID NO: 5: GTTGACTTTACAGAAGGAGATTATGTAAAAATC;
[0055] The nucleotide sequence of the probe set is shown in SEQ ID NO: 6: GTTGACTTTACAGAAGGAGATTA;
[0056] pks+E. coli primer and probe set:
[0057] The sequence of the upstream primer is shown in SEQ ID NO: 7: GCGCATCCTCAAGAGTAAATA;
[0058] The sequence of the downstream primer is shown in SEQ ID NO: 8: GGCGCTCTATGCTCATCAACC;
[0059] The nucleotide sequence of the probe set is shown in SEQ ID NO: 9: TATTCGACACAGAACAACGCCGGT.
[0060] The probe of the sequence shown in SEQ ID NO: 3 is labeled with FAM fluorescent dye at its 5' end and MGB at its 3' end; the probe of the sequence shown in SEQ ID NO: 6 is labeled with HEX fluorescent dye at its 5' end and MGB at its 3' end; the probe of the sequence shown in SEQ ID NO: 9 is labeled with TAMRA fluorescent dye at its 5' end and MGB at its 3' end.
[0061] Example 2
[0062] This embodiment relates to a specific example of a preferred reagent for detecting bacterial cfDNA.
[0063] The above-mentioned detection reagents include bacterial cfDNA extraction reagents and digital PCR amplification reaction reagents. The bacterial cfDNA extraction reagents include buffer GA, buffer GB, buffer GD, wash buffer PW, elution buffer TB, proteinase K, carrier RNA, and an adsorption column (RNase-free adsorption column CR2). The digital PCR amplification reaction reagents include the primer and probe composition for detecting bacterial cfDNA described in Example 1, Master Mix, DNA sample, and H2O (optionally, restriction enzyme may also be included). The Master Mix includes dNTPs, Taq polymerase, DNA, polymerase, and Mg2+. 2+ PCR reaction buffer.
[0064] In a 40 μL reaction system, the digital PCR amplification reaction reagents include: 4 μL of primer and probe composition, 10 μL of DNA sample, and the remainder is made up with H2O (optionally, 1 μL of restriction enzyme may also be included, with the remainder made up with H2O); wherein, in the reaction system, the final concentration of primers is 0.8 μM and the final concentration of probes is 0.4 μM.
[0065] Example 3 - Extraction of cfDNA from Plasma
[0066] This embodiment is a specific example of a preferred method for extracting cfDNA from plasma.
[0067] I. Extraction kit:
[0068] Use the Tiangen serum / plasma cell-free DNA extraction kit (catalog number: DP339). Before use, please add anhydrous ethanol to buffer GD and wash buffer PW. Please refer to the label on the bottle for the volume to be added.
[0069] The extraction reagents are shown in Table 1 below:
[0070] Table 1 Composition of extraction reagents
[0071]
[0072] II. Extraction steps:
[0073] 1. Take 100μL-200μL of plasma into a 2ml centrifuge tube. If the volume is less than 100μL, add buffer GA to a final volume of 100μL.
[0074] 2. Add 20 μL of Proteinase K solution and vortex to mix.
[0075] 3. Add 200 μL of buffer GB (you can add 1 μL of carrier RNA storage solution, concentration is 1 μg / μL), gently invert to mix, incubate at 56℃ for 10 min, and shake the sample from time to time. Vortex for 10 s to remove droplets from the inner wall of the tube cap.
[0076] A white precipitate may form when buffer GB is added; this will usually disappear when incubated at 56°C and will not affect subsequent experiments. If the solution does not become clear, it indicates incomplete cell lysis, which may result in insufficient DNA extraction and impure DNA.
[0077] 4. Add 200 μL of ethanol (96-100%). If the room temperature exceeds 25°C, pre-cool the ethanol on ice. Gently invert to mix the sample, let it stand at room temperature for 5 min, and then vortex for 10 s to remove droplets from the inner wall of the cap.
[0078] 5. Add the solution obtained in step 4 to an adsorption column CR2 (place the adsorption column in the collection tube), centrifuge at 12,000 rpm to 13,400 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CR2 back into the collection tube.
[0079] 6. Add 500 μL of buffer GD to the adsorption column CR2 (please check that anhydrous ethanol has been added before use), centrifuge at 12,000 rpm to 13,400 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CR2 back into the collection tube.
[0080] 7. Add 600 μL of washing buffer PW to the adsorption column CR2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm to 13,400 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CR2 back into the collection tube.
[0081] 8. Repeat step 7 once.
[0082] 9. Centrifuge the solution from step 8 at 12,000 rpm for 2 minutes and discard the waste liquid. Place the CR2 adsorption column at room temperature for 2-5 minutes to thoroughly dry any residual wash solution in the adsorption material. The purpose of this step is to remove residual wash solution from the adsorption column, as residual ethanol in the wash solution will affect subsequent enzyme reactions (enzyme digestion, PCR, etc.) experiments.
[0083] 10. Transfer the adsorption column CR2 into a clean centrifuge tube, add 20-50 μL of elution buffer TB dropwise to the center of the adsorption membrane, incubate at room temperature for 2-5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube.
[0084] The volume of elution buffer in step 10 should not be less than 20 μL; a smaller volume will affect the recovery efficiency. To increase the yield of genomic DNA, the solution obtained after centrifugation can be added back to the CR2 adsorption column, incubated at room temperature for 2 min, and then centrifuged at 12,000 rpm for 2 min. The pH value of the elution buffer has a significant impact on the elution efficiency. If water is used as the elution buffer, its pH value should be maintained within the range of 7.0-8.5; a pH value below 7.0 will reduce the elution efficiency. Furthermore, the DNA product should be stored at -20℃ to prevent DNA degradation.
[0085] Example 4 - Detection of bacterial cfDNA using digital PCR
[0086] This embodiment is a specific example of a detection method of the present invention.
[0087] Digital PCR is the third generation of PCR technology, following conventional PCR and quantitative real-time PCR. Its principle involves thoroughly diluting a sample and allocating it to different reaction units. Each unit contains one or fewer copies of the target molecule (DNA template). Individual, parallel PCR reactions are performed in each unit. After amplification, the fluorescence signals from each unit are statistically analyzed to achieve absolute quantification and detection of rare alleles. Currently, digital PCR is used to detect pathogens including COVID-19, HIV, herpes simplex virus, and methicillin-resistant Staphylococcus aureus.
[0088] This embodiment utilizes digital PCR to detect bacterial cfDNA, including the cfDNA detection of Fusobacterium nucleatum (Fn), enterotoxigenic Bacteroides fragilis (ETBF), and pks+ Escherichia coli. The specific detection steps are as follows:
[0089] 1. The QIAcuity Probe PCR Master Mix kit was used, containing template DNA, primers, and probes. The QIAcuity probe PCR master mix was mixed and briefly centrifuged at the bottom of the test tube to collect the liquid. The primers and probes used were the primer and probe combination described in Example 1.
[0090] 2. Prepare the reaction mixture according to the requirements in Table 2.
[0091] Because of the presence of a heat-start enzyme, samples do not need to be placed on ice during reaction setup or reaction. For multiplex gene amplification, primers for multiple genes can be added to the same well, but it is necessary to ensure that primers do not cause primer dimers or nonspecific amplification reactions.
[0092] Table 2. Composition of the mixture in the digital PCR reaction
[0093]
[0094]
[0095] 3. Vortex for 10 seconds to mix the reactants.
[0096] 4. Distribute an appropriate volume of reaction mix, including placing the template into a standard eight-tube set. In this example, a 24-well, 40 μL system is used, with 10 μL of template DNA added to each well containing the reaction mixture. The maximum volume for the 96-well set should not exceed 12 μL, and the maximum volume for the 24-well set should not exceed 40 μL.
[0097] 5. Transfer the DNA+MIX from the standard eight-tube pack into the wells of the nanoplate.
[0098] 6. Use the QIAcuity Nanoplate provided by QIAcuity to seal the nanoplate.
[0099] 7. If the reaction contains restriction endonucleases for DNA digestion, allow it to stand at room temperature (15-25°C) for 10 minutes.
[0100] 8. Program the loop program of the QIAcuity instrument according to Table 3.
[0101] Table 3 Conditions for digital PCR reaction
[0102]
[0103] 9. Set the parameters for the digital PCR instrument:
[0104] (1) First, set up the droplet distribution operation. In Priming, select QIAGEN Standard Priming Profile.
[0105] (2) Then set the PCR details in Cycling: as shown in Table 2, click add temperature to add the temperature.
[0106] (3) Check the box next to the loop step, click "group", and change the number of loops to the desired number. If you want to edit the already edited step, click the three dots, uncheck "group", and then edit.
[0107] (4) Finally, set the imaging steps, as shown in Table 4, to select the required fluorescence channel for detection using the dyes used in the experiment. For the first experiment, it is recommended to use the default exposure time and signal gain value. Based on the imaging results, if the fluorescence signal value is too high in the 1D image, the exposure time and gain value can be shortened and reduced. When using EveGreen, an exposure time of approximately 200ms can be tried, with a gain value starting between 3 and 4. If the fluorescence signal is found to be too low, the exposure time or gain value can be increased by 30%. In this embodiment, an exposure time of 2400ms and a gain value of 6 are used.
[0108] Table 4. Dyes used in the experiment
[0109] Channel Excitation(nm) Emission (nm) Example fluorophores Green 463-503 518-548 FAM, EvaGreen* Yellow 514-535 550-564 HEX,VIC,JOE Orange 543-565 580-606 TAMRA Red 570-596 611-653 ROX, Texas Red Crimson 590-640 654-692 Cy5
[0110] (5) Set reaction mixes
[0111] Click "New reaction mix" to add a reaction system, name the mix, enter the name of the gene target to be detected by the mix, select the dye to be used, and the corresponding fluorescence channel will be automatically displayed. If the target is an internal control, check "internal control". To delete the target, click the trash can icon. Click "create" to generate the reaction mix. To view the details of the mix, click "detailed list". This example detects enterotoxin-producing Bacteroides fragilis (ETBF), Fusobacterium nucleatum (Fn), and pks+ Escherichia coli (pks+ E. coli), and the fluorescent groups carried by the corresponding probes.
[0112] (6) Set samples & controls
[0113] Click "New samples" to add a new sample. In the pop-up dialog box, enter the sample name. If you enter "Amount 5", five independent samples will be generated, each prefixed with the sample name and numbered 01-05. If you enter "Amount 1", only one sample will be generated without a number. After setting, click "Create" to generate the sample. In "Controls", click "Add control" to set up the control sample. In "Non Template Controls", click "Add NTC" to set up a negative control without a template. In this example, umbilical cord blood cfDNA is used as a negative control, and bacterial DNA is used as a positive control.
[0114] (7) Set plate layout
[0115] Select the corresponding wells, click the plus sign, add a reaction mix, select the mix set above, and assign it to these wells. If you don't need these selected wells, set them to blank. For wells with pre-set reaction mixes, select the corresponding well, click the droplet icon, select what type of sample it is (sample / control / template-free negative control), and click assign. If the wrong reaction mix was selected for the well, you can click remove reaction mix to correct the incorrect setting. For control samples, you need to select whether the amplification effect of this reaction mix should be positive or negative before assignment.
[0116] (8) After setting, click "done" in the lower right corner to complete the microplate setting.
[0117] 10. Prepare microplates
[0118] According to QIAcuity TM EG PCR Kit or QIAcuity TM The instructions for the Probe PCR Kit state that the reaction mixture should be prepared in PCR tubes or plates, mixed thoroughly, and briefly centrifuged until it gathers to the bottom of the tube. If using restriction enzymes, allow it to stand at room temperature for 10 minutes. Then, transfer the reaction mixture to the round sample wells of a microplate. When removing the microplate from the packaging, only hold it by the side. First, place the microplate on a white tray to prevent scratches or dirt from affecting photography. If the bottom of the microplate accidentally gets dusty or dirty, it can be cleaned with lint-free paper dampened with alcohol. When transferring the PCR mixture, insert the pipette tip to the lower middle part of the well, close to the wall, avoiding air bubbles. Since the microplate cannot be centrifuged, the reaction mixture must be added to the lower middle part of the sample well; do not add liquid to the tip or wet the tip, as this will prevent poor adhesion when attaching the membrane.
[0119] 11. Applying a film to the microplate
[0120] Take the sealing film out of the microplate box. There is a layer of transparent protective plastic on top and a layer of white protective plastic underneath. First, turn the white side up and gently peel off a corner. Press down on a small corner of the blue sealing film and peel off the white protective plastic to the side. Do not lift it too high to avoid the blue sealing film being pulled up by the white plastic, which would cause the blue sealing film to separate from the transparent protective plastic and form a bulge.
[0121] Then, lift the blue protective film with the transparent plastic covering and place it over the microplate. The left and bottom edges of the microplate are narrower, so when aligning the film, make sure it covers these edges. Also, try to align the film as closely as possible with the plate; avoid excessive misalignment. If the film extends more than 1mm beyond the plate, it may stick to the robotic arm. After aligning the film and the plate, carefully lower the film. The film is very sticky and will adhere to the microplate holes.
[0122] First, use a roller to roll the transparent protective plastic several times horizontally and vertically to ensure the blue sealant adheres stably to the microplate. Then, carefully press the lower left corner of the blue sealant, being careful not to press it above the injection port, and peel the transparent protective plastic off from the lower left corner to the upper right side, being careful not to lift the blue sealant. Next, use the roller to press firmly onto the blue sealant, rolling it back and forth horizontally and vertically at least three times. Once it is firmly adhered, use the edge of the roller to seal the edges around the plate, first sealing the bottom edge, then the left side, and finally the top and right edges.
[0123] 12. Microplate assembly
[0124] Press the button on the upper right of the instrument's front panel, or click the eject tray button for each plate slot on the touchscreen. The sample tray on the instrument will eject. Carefully remove the microplate from the white tray, being careful not to let the microplate bounce, which could cause reagent spillage. Place the microplate with the barcode facing inwards into the sample tray on the instrument's front panel, and press the button on the upper right of the instrument's front panel again to insert the microplate into the instrument.
[0125] 13. During operation, the instrument's touchscreen will display the progress of the experimental steps and the remaining time in real time, and the corresponding status will also be displayed on the computer's Software Suite interface.
[0126] 14. After the experiment, analyze the results using the Software Suite software on the computer. Select the plate to be analyzed, click the three-dot icon, and select Analyze to begin the analysis. In the Absolute Quantification interface, select the wells to be analyzed; to select all, click Select All. On the right side of the software, select the imaging step to be used for analysis. In Analyze Per, select whether to analyze based on the target or channel. After selecting the target or channel to be analyzed, click Show Results. All results will be displayed below. The displayed results include a list, signal map, heatmap, histogram, 1D scatter plot, 2D scatter plot, and concentration diagram.
[0127] If secondary analysis is required, select the corresponding secondary analysis module after the absolute quantitative analysis is completed. All results will be displayed below, including a results list, heatmap, point diagram, and concentration diagram. Specifically, in Mutation Detection, the user must specify the wild-type target and the mutant target; in Genome Editing, the user must specify the wild-type target and the edited target; in Copy Number Variation, the user must specify the target of interest and the reference target(s), the reference sample, and the copy number (Copies / genome) of the gene of interest in the reference sample; and in Gene Expression, the user must specify the target of interest, the reference target(s), and the reference sample.
[0128] 15. In the results chart (list), you can check the "show mean values for replicas" option to display the mean values, or click "export to CSV" to export the results table as a CSV file. In the image results, you can check the "Add to report" option to include the image results in the report. After the results analysis is complete, you can click the "Create report" button in the lower right corner to access the report generation page, select the content you want to include in the report, and generate a customized report. An example results analysis is shown in Table 5:
[0129] Table 5 Report Generation Results
[0130]
[0131] 16. Threshold adjustment.
[0132] If you do not use the threshold calculated automatically by the instrument, you can place the mouse on the solid red threshold line. The mouse cursor will change into a small hand. Click once, and the threshold line will turn into a dashed red line. Place the dashed line at a suitable height and click again. The dashed red line will turn into a solid red line, forming a new threshold line. Then click the Recalculate button, and the software will recalculate the result according to the new threshold line.
[0133] 17. Result Interpretation
[0134] The endpoint PCR results are detected and interpreted, and the number of effective droplets, positive droplets, and negative droplets are counted. The average number of target molecules per droplet is calculated using Poisson distribution, and then the concentration of target molecules in each reaction system is calculated. This process is generally automated by software.
[0135] Digital PCR is used to detect bacterial cfDNA without the need for standards. It enables absolute quantification of target molecules, offering higher sensitivity, precision, and repeatability, and is independent of amplification efficiency. The detection process and result analysis are also simple. This technology solves problems in existing fecal testing methods, such as high positive rates, numerous interfering factors, cumbersome sample collection and processing, and insufficient specificity and sensitivity for gene methylation detection.
[0136] Example 5
[0137] This embodiment is a specific implementation of the present invention.
[0138] This embodiment compared the cfDNA of specific bacteria in the plasma of healthy individuals and colorectal cancer patients, identifying bacterial cfDNA fragments that can be used for the early diagnosis of colorectal cancer. The experimental steps are as follows:
[0139] 1. Plasma from 40 healthy individuals and 60 colorectal cancer patients was used as the experimental group, with umbilical cord blood cfDNA as the negative control and bacterial DNA as the positive control.
[0140] 2. Extract cfDNA from the plasma in step 1 according to the method in Example 2;
[0141] 3. Following the method in Example 3, digital PCR was used to detect the cfDNA of Fusobacterium nucleatum (Fn), enterotoxigenic Bacteroides fragilis (ETBF), and pks+ Escherichia coli. The positive and negative cut-off values were determined based on the positive control group (bacterial DNA) and the negative control group (umbilical cord blood).
[0142] like Figure 1 As shown, the cut-off value for *Fusobacterium nucleatum* is set to 80;
[0143] like Figure 2 As shown, the cut-off value for enterotoxin-producing Bacteroides fragilis was set to 50;
[0144] like Figure 3 As shown, the cut-off value for E. coli in pks+ is set to 38.
[0145] 4. Results Analysis
[0146] The results showed that, Figure 4 As shown, *Fusobacterium nucleatum* had the highest detection rate in the plasma of colorectal cancer patients (45%), while the detection rate in healthy individuals was only 5%, making it a relatively ideal biomarker for early diagnosis of colorectal cancer. *Enterotoxin-producing Bacteroides fragilis* had a detection rate of 20% in the plasma of colorectal cancer patients, but was not detected in healthy individuals. *Pks+* *Escherichia coli* had a detection rate of 6.7% in the plasma of colorectal cancer patients, but was not detected in healthy individuals.
[0147] In summary, the above-mentioned Fusobacterium nucleatum, enterotoxigenic Bacteroides fragilis, and PKS+ Escherichia coli, individually or in combination, can all serve as potential biomarkers for early diagnosis of colorectal cancer. Among them, the detection levels of the above-mentioned single bacteria or combinations can all serve as potential biomarkers for early diagnosis of colorectal cancer, and their detection levels have clinical significance in colorectal cancer screening and early diagnosis. Therefore, the detection reagents for detecting bacterial cfDNA and the detection method for detecting bacterial cfDNA using digital PCR have important application value in the preparation of reagents for colorectal cancer screening and early diagnosis.
[0148] The above description is merely a preferred embodiment of the present invention and does not limit the implementation and protection scope of the present invention. Those skilled in the art should realize that any equivalent substitutions and obvious changes made based on the description and illustrations of the present invention should be included within the protection scope of the present invention.
Claims
1. A reagent for detecting bacterial cfDNA, characterized in that, The detection reagent includes bacterial cfDNA extraction reagent and digital PCR amplification reaction reagent. The digital PCR amplification reaction reagent includes a primer and probe composition for detecting bacterial cfDNA. The primer and probe composition includes at least one of the following: primer and probe set for detecting enterotoxin-producing Bacteroides fragilis, primer and probe set for detecting Fusobacterium nucleatum, and primer and probe set for detecting PKS+ Escherichia coli. The primer and probe set for detecting enterotoxin-producing Bacteroides fragilis includes primers with sequences shown in SEQ ID NO: 1 to SEQ ID NO: 2 and probes with sequences shown in SEQ ID NO: 3; the primer and probe set for detecting Fusobacterium nucleatum includes primers with sequences shown in SEQ ID NO: 4 to SEQ ID NO: 5 and probes with sequences shown in SEQ ID NO: 6; and the primer and probe set for detecting pks+ Escherichia coli includes primers with sequences shown in SEQ ID NO: 7 to SEQ ID NO: 8 and probes with sequences shown in SEQ ID NO:
9.
2. The detection reagent according to claim 1, characterized in that, The bacterial cfDNA extraction reagent includes buffer, washing solution, elution buffer, protease, nucleic acid precipitation aid and adsorption column; And / or, the digital PCR amplification reaction reagent further includes Master Mix, DNA sample, and H2O. The Master Mix includes dNTPs, Taq polymerase, DNA, polymerase, and Mg2+. 2+ PCR reaction buffer.
3. The detection reagent according to claim 1, characterized in that, In a 40 μL reaction system, the digital PCR amplification reaction reagents include: 4 μL of primer and probe composition, 10 μL of DNA sample, and the remainder is made up with H2O; wherein, in the reaction system, the final concentration of primers is 0.8 μM and the final concentration of probes is 0.4 μM.
4. The detection reagent according to claim 1, characterized in that, The probe is labeled with a reporter fluorescent dye at its 5' end and a quencher fluorescent dye at its 3' end; wherein the reporter fluorescent dye is selected from FAM, HEX, VIC, ROX, TAMRA, and CY5; the quencher fluorescent dye is selected from MGB, and the reporter fluorescent dye is different for each probe.
5. A method for detecting bacterial cfDNA using digital PCR with the detection reagent as described in claim 1, characterized in that, Includes the following steps: S1. Extract cfDNA from the sample to be tested using a bacterial cfDNA extraction reagent; S2. Detect the concentration and purity of the extracted cfDNA to determine the cfDNA that meets the criteria; S3. The cfDNA extracted in step S2 is subjected to digital PCR amplification reaction using digital PCR amplification reaction reagent; S4. Perform fluorescence detection on the digital PCR reaction products from step S3, and determine whether bacterial cfDNA fragments are present in the sample based on the detection results.
6. The detection method according to claim 5, characterized in that, In step S1, the samples include blood samples, tissue fluid samples, fecal samples, intestinal fluid samples, and oral samples; And / or, in step S2, the concentration and purity of the extracted cfDNA are detected using a UV spectrophotometer. The cfDNA that meets the conditions satisfies the following: it has a significant absorption peak at OD260 and the OD260 / OD280 ratio is 1.7-1.
9. And / or, in step S3, the reaction conditions for the digital PCR amplification reaction are: pre-denaturation: 95℃ for 2 min; denaturation: 95℃ for 15 s; annealing: 60℃ for 30 s, 40 cycles.
7. The detection method according to claim 5, characterized in that, The method for determining whether bacterial cfDNA fragments exist in a sample includes: determining whether cfDNA fragments of enterotoxigenic Bacteroides fragilis, nucleotoxigenic Fusobacterium, or pks+ Escherichia coli exist in the sample based on the cut-off value; wherein, a positive control group and a negative control group are used to identify positive and negative cut-off values.
8. The detection method according to claim 5, characterized in that, It also includes the following steps: S5. Quantitative analysis of the relevant bacteria based on the test results.
9. The detection method according to claim 8, characterized in that, The quantitative analysis specifically includes: The endpoint PCR results were detected and interpreted, and the number of effective droplets, positive droplets, and negative droplets were counted. The average number of target molecules in each droplet was calculated using the Poisson distribution, and then the concentration of target molecules in each reaction system was calculated.
10. The application of a detection reagent as described in any one of claims 1 to 4 or a detection method as described in any one of claims 5 to 9, characterized in that, The application is selected from at least one of the following applications: application in detecting bacterial cfDNA, application in preparing reagents for colorectal cancer screening and early diagnosis.