Lactococcus carrier vaccine for enterotoxigenic escherichia coli f18 pilus type and application

Abstract

The application belongs to the technical field of biological gene engineering, and discloses a lactococcus lactis carrier oral vaccine for producing enterotoxigenic escherichia coli F18 pilus type and application. Four lactococcus lactis antigen surface display strains are prepared, and are mixed to perform oral immunization. The oral immunization mode is convenient to operate, avoids the stress reaction caused by injection immunization on animals, and greatly improves the immunization effect, so that the diarrhea caused by enterotoxigenic escherichia coli on piglets can be effectively prevented. 50 The application is an oral escherichia coli vaccine, and mouse immunization challenge experiment shows that all the mice can survive under the challenge dose of LD , and piglet immunization challenge experiment shows that the piglets can be 100% protected from diarrhea, which shows that the immunization group has effective mucosal immune protection ability.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to oral vaccines using Lactococcus lactis vectors for enterotoxigenic Escherichia coli F18 fimbriae and their applications. Background Technology

[0002] Enterotoxigenic Escherichia coli (ETEC) is a pathogenic Escherichia coli that can cause diarrhea in humans and various animals. This disease is most common in young animals, primarily causing severe diarrhea and dehydration in piglets under 7 days old. It spreads rapidly, with high morbidity and mortality rates, and is known as piglet yellow scours. Piglets aged 10-30 days often develop white scours, with a lower mortality rate, but it leads to stunted growth, emaciation, and even runts. Furthermore, this bacterium is a major bacterial pathogen causing diarrhea in weaned piglets, and some strains are even associated with piglet edema disease (Zhang Fanqing 2022). The main reason for this difference is the variation in fimbrial adhesins and enterotoxins. Piglet yellow and white scours are often associated with K88 and K99 fimbriae and heat-sensitive enterotoxins lt and st, while weaned piglet diarrhea and piglet edema disease are often associated with F18 fimbriae and Shiga toxin stx2e (Duan et al. 2020). Overall, ETEC mainly causes severe diarrhea and even death in piglets, resulting in huge losses to farms. Therefore, researching and developing vaccines against this disease is of great significance.

[0003] Live vector vaccines involve introducing the gene encoding the target antigen into a live vector (avirulent or attenuated bacteria or virus) using molecular biology techniques to construct a recombinant bacterial (viral) strain. The target gene is then expressed in large quantities as the recombinant strain proliferates in the host, thereby inducing a corresponding protective immune response. *Lactococcus lactic acid bacteria* is a typical lactic acid bacteria species, possessing advantages such as rapid growth, ease of handling, and safety. Its complete genome sequence has been obtained, making it an ideal choice for expressing exogenous proteins and serving as a live vector vaccine carrier (Wang Chen 2019). However, lactic acid bacteria exhibit high biological and genetic genotypic diversity. The expression levels of different exogenous genes vary significantly, sometimes even remaining unexpressed. The expression levels of the same gene also differ in different host bacteria, leading to varying levels of cellular and humoral immunity. The amount of antigen displayed on the surface of the recombinant strain also varies considerably. Since protein expression level is a key factor in the effectiveness of vector vaccines, the results of immunization in animals are inconsistent in actual use, which is one of the challenges in the development of lactic acid bacteria vector vaccines (Liu Qiong et al. 2019).

[0004] Currently, the main method for controlling ETEC in the swine industry is antibiotic treatment. However, clinically isolated E. coli are generally drug-resistant, and the use of antibiotics sometimes not only fails to achieve the desired therapeutic effect but also increases the number of multidrug-resistant strains. Furthermore, with the continuous implementation of antibiotic restriction and ban policies worldwide, antibiotic treatment is no longer sufficient for the current control of this disease. Therefore, vaccination is the best method for prevention (Yang Dehong et al., 2019). Research on ETEC vaccines has been ongoing for over 30 years, achieving a series of advancements from purely physicochemical methods to genetic engineering techniques. However, to date, no vaccine is effectively applicable to all regions, and most vaccine research has stalled due to poor immunogenicity or lack of broad-spectrum protection (Zhang Henghui et al., 2015). Whole-cell inactivated vaccines are currently the main method for preparing experimental and commercial ETEC vaccines. However, due to the large number of ETEC serotypes and their geographically varying distribution, their actual use is geographically limited and their broad-spectrum protective effect is poor. Furthermore, they suffer from problems such as a low proportion of active ingredients, high immunization doses, lack of high vaccine efficacy, high levels of endotoxins and irrelevant components, and severe side effects, resulting in less than ideal clinical efficacy. Genetically engineered vaccines have also had some products approved for clinical use, but their clinical adoption rate is low due to issues such as the mutual influence of protein expression, the inability to fully exert the antigen's effect, the inability to protect against some non-piloadhesion virus strains, and good experimental results but poor practical application results.

[0005] Subunit vaccines targeting this disease have long been a focus of attention due to their broad-spectrum efficacy, high immunogenicity, and minimal animal stress. However, the preparation of bacterial antigen proteins is challenging, leading to issues such as low expression levels in strains, difficulty in obtaining large quantities of soluble proteins, high purification costs, and suboptimal immunization efficacy. To date, no such products are in clinical use. Live attenuated vaccines carry the risk of virulence reversion and are often only effective against homologous strains. Furthermore, research on live attenuated bacterial vaccines is limited worldwide, resulting in the current lack of available vaccines (Xia et al., 2016; Yang et al., 2019; Bourgeois et al., 2016). Therefore, an effective vaccine strategy is urgently needed for the prevention and control of ETEC.

[0006] To address the aforementioned problems, this invention provides an oral vaccine using a lactococcus vector for enterotoxigenic Escherichia coli F18 fimbrial type. This vaccine is administered orally, avoiding the stress response associated with vaccine injection, while maximizing the effect of mucosal immunity to resist Escherichia coli infection. Summary of the Invention

[0007] The purpose of this invention is to provide a lactic acid bacteria mixture, wherein the lactic acid bacteria mixture is Lactococcus lactis NZ3900 expressing SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6 and SEQ ID NO.8 respectively.

[0008] Another object of the present invention is to provide the application of the above-mentioned lactic acid bacteria mixture in the preparation of an oral vaccine against enterotoxin-producing Escherichia coli.

[0009] To achieve the above objectives, the present invention adopts the following technical measures:

[0010] A lactic acid bacteria mixture comprising recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM expressing SEQ ID NO. 2, recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM expressing SEQ ID NO. 4, recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM expressing SEQ ID NO. 6, and recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stA-ACM expressing SEQ ID NO. 8.

[0011] The preferred embodiment of the above-described scheme is the recombinant Lactococcus lactis rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM, which is obtained by introducing the gene shown in SEQ ID NO.1 into Lactococcus lactis NZ3900.

[0012] The recombinant lactococcus rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM was obtained by introducing the gene shown in SEQ ID NO.3 into lactococcus NZ3900.

[0013] The recombinant lactococcus rL.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM was obtained by introducing the gene shown in SEQ ID NO.5 into lactococcus NZ3900.

[0014] The recombinant lactococcus rL.Lactis--NZ3900-pNZ8149-Usp45-stA-ACM was obtained by introducing the gene shown in SEQ ID NO.7 into lactococcus NZ3900.

[0015] In the above-described scheme, the preferred ratio of the effective bacterial content of the three recombinant lactococci is 1-2:1-2:1-2:1-2.

[0016] The scope of protection of this invention also includes the application of the above-mentioned lactic acid bacteria mixture in the preparation of an oral vaccine against enterotoxigenic Escherichia coli. Preferably, the enterotoxigenic Escherichia coli has a fimbrial type of F18.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] 1. This invention provides for the first time an orally edible enterotoxigenic Escherichia coli (ETE C). Using this vaccine in mouse immune challenge experiments, the protection rate of the vaccine can reach 100% after 7 days of observation. In piglets, after immunization and challenge, it was found that the vaccine can completely protect against diarrhea.

[0019] 2. This invention specifically designs an enterotoxin-producing Escherichia coli antigen display sequence for Lactococcus lactis NZ3900. This sequence can be expressed in large quantities and stably on the Lactococcus lactis NZ3900 display vector, and achieves good immune effects after animal administration.

[0020] 3. Since this invention is an oral vaccine, the immunization method is simple, and oral administration mixed with feed is easy to implement on a large scale, avoiding the stress reaction caused by injection, and can effectively prevent the occurrence of yellow and white scours in piglets. Attached Figure Description

[0021] Figure 1 A schematic diagram showing the antigen on the surface of lactic acid bacteria.

[0022] Figure 2 WB diagrams of protein expression in four recombinant bacterial strains.

[0023] Figure 3 This is a schematic diagram of the survival curves of mice after challenge with the virus.

[0024] Figure 4 This is a diagram illustrating the weight changes of piglets during the immunization period.

[0025] Figure 5 This is a diagram of tissue lesions from an immune challenge experiment on piglets.

[0026] Figure 6 A schematic diagram of HE staining of piglet tissue sections. Detailed Implementation

[0027] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or materials described are all from commercial sources unless otherwise specified.

[0028] Example 1:

[0029] Analysis and synthesis of surface display proteins in enterotoxigenic Escherichia coli K88 genotype:

[0030] Based on the gene and protein sequences of two subtypes of Shiga toxin in Escherichia coli (stx2eA and stx2eB), the F18 fimbriae protein subunit fedF, and the thermostable enterotoxin subtype stA published in GenBank, codons were optimized and proteins were effectively truncated to obtain the target gene fragments. Simultaneously, the secretory transmembrane peptide gene Usp45 of protein 45 from Lactococcus lactis was used as the secretion signal peptide of the exogenous protein and inserted into the 5' end of the target gene. The polypeptide fragment ACM, encoded by three repetitive Lysm gene sequences also derived from Lactococcus lactis, was inserted into the 3' end of the target gene. The antigen was anchored to the surface of the Lactococcus lactis cell wall via non-covalent linkage, thereby achieving surface display of the exogenous protein.

[0031] The final designed Usp45-stx2eA-ACM is shown in SEQ ID NO.1, and the protein it encodes is shown in SEQ ID NO.2; Usp45-stx2eB-ACM is shown in SEQ ID NO.3, and the protein it encodes is shown in SEQ ID NO.4; Usp45-fedF-ACM is shown in SEQ ID NO.5, and the protein it encodes is shown in SEQ ID NO.6; Usp45-stA-ACM is shown in SEQ ID NO.7, and the protein it encodes is shown in SEQ ID NO.8.

[0032] Four gene segments were synthesized using Nanjing GenScript Biotech Co., Ltd.

[0033] Example 2:

[0034] Preparation of three recombinant lactococci:

[0035] The primers used in this embodiment are shown in the table below:

[0036] Table 1: Primers for target gene amplification and universal identification primers for vectors

[0037] Serial Number Primer name Primer sequence 5'-3' ① pNZ8149-F ACGGCTCTGATTAAATTCTGAAGTT ② pNZ8149-R GCTTTCATAATCTAACAGACAACATCT ③ KpnI-Usp45-F CCGGGTACCATGAAAAAAAAGATTATCTCAGCTATTTTAATGTCT ④ SacI-ACM-R CGCGAGCTCTTTTATTCGTAGATACTGACC

[0038] 1) Construction of four recombinant lactococci expressing stx2eA, stx2eB, fedF, and stA, respectively:

[0039] (1) Using the sequences shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.7 as templates, four fragments were amplified by primers ③ and ④ in Table 1 respectively.

[0040] (2) The vector pNZ8149 and the four amplification products mentioned above were digested with KpnI / SacI double enzymes. The digested products were then recovered from the gel using the OMEGA Gel Extraction Kit. A 10 μL ligation reaction system was prepared and ligated at 37°C for 1 hour.

[0041]

[0042] (3) Electroconversion of the ligation product into competent cells of Lactococcus lactis

[0043] A. Add 10 μL of the ligation product to 100 μL of NZ3900 competent cells, gently tap the tube wall to mix, and incubate on ice for 20 min.

[0044] B. Transfer the mixed bacterial culture to a pre-cooled electric transfer cup. Electric shock parameters: voltage 2000V, resistance 200Ω, shock time 5ms.

[0045] C. Immediately after the electroporation, add 900 μL of pre-cooled electroporation recovery medium, transfer to a 1.5 ml EP tube, incubate on ice for 5 min, and then transfer to a 30°C incubator for static incubation for 1 h.

[0046] D. Centrifuge at 3000 rpm for 5 min at room temperature, discard 900 μL of supernatant, resuspend the bacterial pellet in the remaining 100 μL, spread it onto a screening solid medium, incubate at 30℃ for 24 h, and observe the colony morphology.

[0047] (4) Identification of positive recombinant plasmids

[0048] Positive colonies were picked from solid culture plates and inoculated into 10 ml of GM17 liquid medium. The cultures were incubated overnight at 30°C, and plasmids were extracted. Using the extracted positive recombinant plasmids as templates, and primers ① and ② in the table as upstream and downstream primers, PCR identification was performed. After PCR amplification, 1% agarose gel electrophoresis was performed, and the results were observed. Plasmids correctly identified by PCR were sent to Qingke Biotechnology Co., Ltd. for sequencing. The positive plasmids with correctly aligned sequences were named pNZ8149-Usp45-stx2eA-ACM, pNZ8149-Usp45-stx2eB-ACM, pNZ8149-Usp45-fedF-ACM, and pNZ8149-Usp45-stA-ACM, respectively, resulting in four surface-displaying recombinant Lactococcus lactis strains rL.L. actis--NZ3900-pNZ8149-Usp45-stx2eA-ACM, rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM , rL.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM, rL.Lactis--NZ3900-pNZ8149-Usp45-stA-ACM.

[0049] In addition, the applicant used the secretory peptides of the above four antigens and the LPxTG motif derived from Lactobacillus plantarum as surface display peptides. After optimization, the above four antigens were expressed in Lactococcus lactis NZ3900. The results showed that the protein expression level was lower than that of the combination of secretory peptide Usp45 and surface display peptide ACM, indicating that the surface display scheme of the present invention can display the four antigens more efficiently.

[0050] Example 3:

[0051] Preparation of compound lactococcus vector oral vaccine:

[0052] The selected rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM, rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM, rL.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM, and rL.Lactis--NZ Recombinant lactic acid bacteria 3900-pNZ8149-Usp45-stA-ACM and control strain rL. Lactis--NZ3900-pNZ8149 (obtained by transferring empty vector pNZ8149 into NZ3900) were inoculated into GM17 solid medium, respectively. One clone from each strain was then picked and cultured statically for 24 h. The culture was then subcultured in liquid medium at a ratio of 1:25. When the OD value reached 0.4, Nisin was added to a final concentration of 10 ng / mL, and the culture was induced for 6 h. The cells were centrifuged at 12000×g for 2 min, and the precipitate was washed three times with pre-cooled PBS. The cells were then resuspended in PBS at a ratio of 1:10. The cells were sonicated to disrupt the bacterial culture. The disrupted culture was centrifuged at 12000g for 10 min at 4℃, the supernatant was discarded, and the precipitate was resuspended in PBS. Mix the 5× protein loading with the resuspended precipitate samples of recombinant strains rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM, rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM, rL.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM, rL.Lactis--NZ3900-pNZ8149-Usp45-stA-ACM and control strain rL.Lactis--NZ3900-pNZ8149, and heat in a metal bath at 100℃ for 10 min. Protein markers were used as controls to determine protein molecular weight. Lane 1 contained the control strain L. Lactis--NZ3900, lane 2 contained the control blank vector strain rL. Lactis--NZ3900-pNZ8149, and lane 3, from top to bottom, contained the four recombinant strains after induction. Western blot analysis was performed, and the results are shown below. Figure 2 As shown, all recombinant strains showed correct protein expression after induction.

[0053] Four recombinant Lactococcus lactis strains were cultured and induced to express 1L of the culture. Viable cell counts were determined by plate counting. The cultures were then mixed at a 1:1:1:1 effective bacterial concentration ratio, centrifuged at 3000 rpm for 10 min, washed once with PBS, resuspended in PBS, and concentrated 10-fold to obtain the Lactococcus lactis oral vaccine composition. The total concentration of Lactococcus lactis in the composition was 4 × 10⁻⁶. 10 cfu / mL, where the final concentration of each recombinant bacterium in the system is 1×10⁻⁶. 10 cfu / mL.

[0054] Example 4:

[0055] Mouse experiments with a compound lactococcus vector oral vaccine:

[0056] Evaluation of mouse immune challenge:

[0057] The experimental groups were as follows: 3-4 week old C57BL / 6J mice were selected for the immunization experiment. Each mouse in the immunization group was given 0.4 ml of the oral vaccine prepared in Example 3 each time. The blank control group and the challenge control group were given 0.4 ml of PBS, and the vector control group was given 0.4 ml of blank vector bacterial solution (i.e., rL. Lactis--NZ3900-pNZ814, the same amount of bacteria as the oral vaccine). Gavage was administered weekly on days 1, 2, and 3 for 4 weeks. On day 29, mice were challenged by gavage with ETEC (F18+) strain ETW037 at a dose of 1 LD50. 50 After the mice were challenged with the virus, the mortality rate of each group was recorded.

[0058] The results are as follows Figure 3 As shown, 60% of the mice in the challenge control group died within 4 days after challenge, while 50% of the mice in the vector control group died within 4 days after challenge, confirming that the vector itself does not prevent challenge-induced mouse death. The immunized mice survived completely without death, indicating that oral vaccine immunization can protect mice from the death caused by challenge.

[0059] Example 5:

[0060] Evaluation of piglet immune challenge with compound lactococcus vector oral vaccine:

[0061] The experimental groups were as follows: Eight-day-old three-way crossbred piglets were selected for the immunization experiment. Each pig in the immunization group received 4 ml of the oral vaccine prepared in Example 3 per dose, while the blank control group and the challenge control group received 4 ml of PBS. From day 8, piglets were administered the vaccine via gavage for three consecutive days, with a three-day immunization cycle followed by a three-day rest period, for a total of three cycles. The piglets were 28 days old at the time of immunization completion. At 29 days of age, the piglets were challenged via gavage with the ETEC (F18+) strain ETW037 at a dose of 8 × 10⁻⁶ per piglet. 10CFU (for ETEC in weaned piglets, the main symptom is severe diarrhea, but the mortality rate is generally not high, so 8×10 is selected here) 10 The CFU dosage was the same as the dosage used in the previous validation of all piglets experiencing diarrhea. After challenge, the health status and diarrhea status of each group of piglets were recorded. On day 7 post-challenge, all piglets were euthanized and pathologically dissected to observe lesions and collect intestinal samples, which were sent to Wuhan Baiqiandu Biotechnology Co., Ltd. for HE staining and pathological section preparation.

[0062] The results are as follows Figure 4 As shown, the weight gain rate of the immunized piglets during the immunization period was significantly higher than that of the control group. It was significantly higher than that of the control group from one week after immunization, and by the time the immunization was completed at 28 days of age, the immunized group was significantly higher than the control group. At this time, the weight of the immunized piglets was 23.2% higher than that of the unimmunized piglets, which proves that the oral vaccine itself has a certain effect on promoting the growth of piglets.

[0063] Figure 5 The figures show the clinical diarrhea symptoms and anatomical lesions of the intestines and mesenteric lymph nodes in piglets after viral challenge. As shown, piglets in both the challenge and control groups exhibited significant watery yellow diarrhea, while the immunized and blank control groups showed no diarrhea. Intestinal lesions were observed in both the challenge and control groups, with significant thinning, transparency, and bloating of the intestinal wall, particularly in the small intestine, which was filled with yellowish, liquid contents. No lesions were observed in the intestines of the immunized and blank control groups. Mesenteric lymph node dissection revealed severe congestion and hemorrhage in the mesenteric lymph nodes of both the challenge and control groups, while the immunized and blank control groups showed normal lymph node function.

[0064] Figure 6 HE-stained sections of mesenteric lymph nodes and intestinal tissue from piglets in each group after viral challenge are shown. The mesenteric lymph node sections reveal hemorrhage in both the challenge group and the vector control group. The yellow spots in the sections represent hemosiderin deposition after blood cell rupture. Simultaneously, due to intestinal inflammation, the number of mature lymphocytes in the mesenteric lymph nodes is reduced, while the immune group and the blank control group show normal results. HE-stained sections of the duodenum, jejunum, and ileum all show significant thinning of the intestinal wall muscle layer, atrophy and fragmentation of intestinal villi, hemorrhage, lymphocyte infiltration, and loss of plasma cells in the lamina propria in the challenge group and the vector control group. In contrast, the intestinal sections of the immune group and the blank control group appear normal.

[0065] In conclusion, oral vaccination can protect piglets from enterotoxigenic Escherichia coli F18, indicating that oral vaccines have a good protective effect.

[0066] The applicant also attempted to construct recombinant strains using another *Lactococcus lactis* strain MG1363 and its matching plasmid pMG36e, following the antigen surface display methods in Examples 1 and 2. Four recombinant surface-display strains were successfully obtained, named rL.Lactis--MG1363-pMG36e-Usp45-stx2eA-ACM, rL.Lactis--MG1363-pMG36e-Usp45-stx2eB-ACM, rL.Lactis--MG1363-pMG36e-Usp45-fedF-ACM, and rL.Lactis--MG1363-pMG36e-Usp45-stA-ACM. These four recombinant strains were mixed in a 1:1:1:1 ratio to prepare an oral vaccine formulation, maintaining the concentration of this oral vaccine complex consistent with that of the present invention. The formulation of the present invention was named Oral Vaccine A, and this formulation was named Oral Vaccine B. Mouse experiments and piglet immunoprotection experiments were conducted. The results showed that, in mouse immune challenge experiments, oral vaccine B was ineffective against the LD50 of ETEC(F18+). 50 In dose-based challenge experiments, half of the mice died, showing no difference from the challenge control group. In the piglet immunization challenge experiment, the piglets in the oral vaccine B immunization group showed no difference from the challenge control group, and both exhibited typical symptoms of piglet yellow-white diarrhea. This indicates that Lactococcus lactis MG1363, as a carrier of the three antigens in this invention, cannot exert a good immunizing effect. At the same time, the Lactococcus lactis MG1363 system has an erythromycin resistance gene, while the Lactococcus lactis NZ3900 system in this invention does not have a resistance gene and is a food-grade expression system, making it safer in application.

Claims

1. A lactic acid bacteria mixture, said lactic acid bacteria mixture comprising recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM expressing SEQ ID NO. 2, recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM expressing SEQ ID NO. 4, recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM expressing SEQ ID NO. 6, and recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stA-ACM expressing SEQ ID NO. 8; The recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eA-ACM is obtained by introducing the gene shown in SEQ ID NO.1 into *Lactococcus lactis* NZ3900 using the vector pNZ8149. The recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-stx2eB-ACM is obtained by introducing the gene shown in SEQ ID NO.3 into *Lactococcus lactis* NZ3900 using the vector pNZ8149. The recombinant *Lactococcus lactis* rL.Lactis--NZ3900-pNZ8149-Usp45-fedF-ACM is obtained by introducing the gene shown in SEQ ID NO.1 into *Lactococcus lactis* NZ3900 using the vector pNZ8149. The gene shown in NO.5 was introduced into Lactococcus lactis NZ3900 via the vector pNZ8149. The recombinant Lactococcus lactis rL.Lactis--NZ3900-pNZ8149-Usp45-stA-ACM was obtained by introducing the gene shown in SEQ ID NO.7 into Lactococcus lactis NZ3900 via the vector pNZ8149.

2. The mixture according to claim 1, wherein the effective bacterial content ratio of the four recombinant lactococci is 1~2:1~2:1~2:1~2.

3. The use of the lactic acid bacteria mixture of claim 1 in the preparation of an oral vaccine against enterotoxigenic Escherichia coli, wherein the enterotoxigenic Escherichia coli has a fimbrial type of F18.

Images