Screening and identifying method of gene related to regulation and control of sperm motility of lion-head geese

Abstract

The invention relates to the technical field of lion-head goose breeding, in particular to a method for screening and identifying genes related to lion-head goose sperm motility regulation and control, which comprises the following steps: dividing healthy lion-head male geese in a breeding period into a high sperm motility group and a low sperm motility group according to sperm motility, collecting two groups of testicular tissues and sperm samples, and preserving the testicular tissues at low temperature for molecular detection; performing transcriptome sequencing on the testicular tissue to obtain mRNA and non-coding RNA expression data; screening two groups of nucleic acid molecules with significant differential expression, and determining candidate genes through functional enrichment analysis of reproductive development related biological pathways; and verifying the authenticity of the expression difference of the candidate gene through fluorescent quantitative PCR, and finally determining the target gene. According to the method, related data are obtained through sequencing, the candidate genes are determined by screening differential molecules through enrichment analysis and PCR verification, accurate identification of a related gene system is achieved, and the problems of missing detection and insufficient accuracy caused by lack of transcriptome sequencing in a traditional method are solved.

Description

Technical Field

[0001] This invention relates to the field of Lionhead goose breeding technology, and in particular to a method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese. Background Technology

[0002] The Lionhead Goose, originating from Xilou Village, Fubin Town, Raoping County, Chaoshan District, Guangdong Province, is my country's only large goose breed. It was included in the National List of Protected Livestock and Poultry Genetic Resources in 2006. It possesses core advantages such as rapid growth, tolerance to roughage, strong disease resistance, and delicious meat, making it a core element of the distinctive culinary culture of the Chaoshan region and a pillar breed of the local livestock and poultry farming industry. The reproductive efficiency of breeding male geese directly affects the large-scale development of the Lionhead Goose industry. Sperm motility, as a core indicator for assessing semen quality, is closely related to the fertilization rate and hatching rate of eggs; low sperm motility is one of the key factors leading to poor reproductive performance in male geese.

[0003] Traditional methods for screening genes related to sperm motility in Lionhead geese often rely on single-gene validation or phenotypic association analysis, and lack transcriptome sequencing systems, leading to missed detection of key regulatory genes and insufficient identification accuracy. Summary of the Invention

[0004] To overcome the above shortcomings, this invention provides a method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese. This method aims to improve upon the problems of traditional Lionhead geese sperm motility-related gene screening methods, which generally rely on single gene verification or phenotypic association analysis and lack transcriptome sequencing system detection, resulting in missed detection of key regulatory genes and insufficient identification accuracy.

[0005] This invention provides the following technical solution: a method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese, comprising the following steps:

[0006] S1. Healthy male Lionhead geese during the breeding season were divided into a high sperm motility group and a low sperm motility group based on the measured sperm motility.

[0007] S2. Collect testicular tissue samples and semen samples from two groups of the Lionhead geese respectively, and preserve the testicular tissue samples at low temperature for subsequent molecular detection.

[0008] S3. Transcriptome sequencing was performed on the two groups of testicular tissue samples to obtain expression data of mRNA and non-coding RNA.

[0009] S4. Based on the expression data, screen for nucleic acid molecules that are significantly differentially expressed between the two groups, wherein the nucleic acid molecules include mRNA and non-coding RNA;

[0010] S5. Perform functional enrichment analysis on the screened nucleic acid molecules, focusing on biological pathways related to reproductive development, and determine candidate genes based on the analysis results;

[0011] S6. The expression levels of the candidate genes in the two groups of testicular tissue samples were detected by real-time quantitative PCR to verify the authenticity of their expression differences. Based on the verification results, candidate genes related to the regulation of sperm motility in Lionhead geese were identified.

[0012] By employing the above technical solution, transcriptome sequencing was performed on testicular tissues of Lionhead geese with high and low sperm motility to obtain mRNA and non-coding RNA expression data. After screening differentially expressed nucleic acid molecules, candidate genes were identified through functional enrichment analysis and quantitative real-time PCR. This enabled the systematic screening and accurate identification of genes regulating Lionhead goose sperm motility, thereby improving the problems of missed detection and insufficient identification accuracy caused by the traditional Lionhead goose sperm motility-related gene screening methods, which generally rely on single gene verification or phenotypic association analysis and lack transcriptome sequencing system detection.

[0013] Furthermore, in S1, the male Lionhead geese are 52-week-old breeding individuals. All male geese are under the same feeding and management conditions. After at least 2 weeks of semen collection training, individuals with good ejaculation response are selected for sperm motility testing. The sperm motility of the high sperm motility group is ≥50%, and the sperm motility of the low sperm motility group is ≤20%.

[0014] Furthermore, in step S2, the testicular tissue sample is flash-frozen in liquid nitrogen and then transferred to an ultra-low temperature environment of -80°C for preservation, while the semen sample is used to determine sperm motility, sperm density, plasma membrane integrity, and acrosome integrity.

[0015] Furthermore, in S3, the transcriptome sequencing includes the following operations: total RNA is extracted from testicular tissue using the Trizol method, and after quality testing to ensure that the OD260 / 280 is between 1.8 and 2.2 and the RIN value is ≥6.5, an mRNA and non-coding RNA sequencing library is constructed, and expression data is obtained through high-throughput sequencing. The non-coding RNA includes miRNA.

[0016] Furthermore, in S4, the screening criteria for differentially expressed nucleic acid molecules are: mRNAs and non-coding RNAs that, after statistical testing, satisfy P<0.05 and |log2FoldChange|>1.

[0017] Furthermore, in S5, the biological pathways focused on by the functional enrichment analysis include one or more of the following: biosynthetic cofactor pathway, tyrosine metabolism pathway, retinol metabolism pathway, oxidative phosphorylation pathway, glycolysis / glucose production pathway, and cytochrome P450 metabolic pathways of xenobiotics.

[0018] Furthermore, in S5, the candidate genes include one or more of BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L.

[0019] Furthermore, in S6, the real-time PCR uses β-actin as an internal reference gene, employing 2... -ΔΔCt The relative expression levels of candidate genes were calculated using the following amplification reaction conditions: UDG activation at 50℃ for 2 min, pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 15 s, followed by annealing / extension at 60℃ for 1 min, for 40 cycles. Finally, the temperature was increased in a gradient from 65℃ to 95℃, with an increase of 0.5℃ every 5 s. The melting curve was then measured.

[0020] Furthermore, in S6, the primers used for quantitative real-time PCR were designed for the BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L genes. The upstream and downstream primer sequences and pre-amplified fragment lengths for each gene are as follows:

[0021] BCO1 (F: AGTGGAGCCCAGTTCCTACA, R: CCTCTTCTCTTGCATCGGGG, 129bp); ATF1 (F: CTGGAGAGCAAGTCCAGGTC, R: GGACGACGTGCTAAGATCCC, 178bp); DRC1 (F: AGTGCAGGATGAGGAGGAGT, R: TCATTGCTGGAGCT GCCTC, 86bp); COQ6 (F: GGGACATGCGACAGAGTACG, R: GATCTTGCCCGTTGAAGGCT, 158bp); TSNAXIP1 (F: AGCTATGGCGGCAGGC, R: ACTGGCCTCTAGCAGAAAGC, 225bp); SERF1A (F: CCATGACTCGTGGGAACCAG, R: GA CTTCCTCTCGTTAGCCGC, 169bp); SPAG6 (F: GGAGCGCAGGTGTAATGTCT, R: AGTCCTTCAGGCATGTGAGC, 675bp); NEK2 (F: AGATGCTCGTTTCGGAGGTG, R: GTGCTGCTCCTGTCGATGAT, 91bp); WNT3A (F: CTGTGCCAGTTT TCTCACCAT, R: AAGGCAAAGTCATTCACAACAA, 106bp); EIF4G2 (F: CTCCAGGTGCACTGCTACAA, R: TCCAGCCAGTTAGCCATTG, 185bp); HSPA4L (F: GACCATCGCCAACGAGTACA, R: CTCCTACAGAGCCATTCGGC, 230bp).

[0022] The present invention has the following beneficial effects:

[0023] 1. In this invention, transcriptome sequencing is performed on testicular tissues of Lionhead geese with high and low sperm motility to obtain mRNA and non-coding RNA expression data. After screening differentially expressed nucleic acid molecules, candidate genes are identified through functional enrichment analysis and quantitative real-time PCR. This enables systematic screening and accurate identification of genes related to the regulation of Lionhead goose sperm motility, thereby improving upon traditional methods for screening Lionhead goose sperm motility-related genes, which mostly rely on single gene verification or phenotypic association analysis. Due to the lack of transcriptome sequencing system detection, key regulatory genes are often missed, resulting in insufficient identification accuracy.

[0024] 2. In this invention, by simultaneously acquiring expression data of mRNA and non-coding RNA during transcriptome sequencing and performing differential screening, various nucleic acid molecules involved in the regulation of sperm motility in Lionhead geese are comprehensively captured. This improves upon the problem that traditional gene screening methods mostly focus only on changes in mRNA expression, neglecting the regulatory role of non-coding RNA, resulting in incomplete analysis of regulatory networks and incomplete coverage of candidate genes.

[0025] 3. In this invention, by performing functional enrichment analysis on differentially expressed nucleic acid molecules focusing on biological pathways related to reproductive development, candidate genes directly related to sperm motility in Lionhead geese can be quickly identified. This improves upon the fact that traditional differential gene screening methods often lack targeted pathway enrichment guidance and suffer from low candidate gene screening efficiency and weak correlation with target traits due to their broad screening scope. Attached Figure Description

[0026] Figure 1 This diagram illustrates the testicular development of Lionhead geese with high and low sperm motility, illustrating the screening and identification method for genes related to the regulation of sperm motility in Lionhead geese proposed in this invention.

[0027] Figure 2 This is a schematic diagram illustrating the identification and analysis of differentially expressed mRNAs between high and low sperm motility groups in a screening and identification method for genes related to the regulation of sperm motility in Lionhead geese, as proposed in this invention.

[0028] Figure 3 This is a schematic diagram illustrating the identification and analysis of differentially expressed miRNAs between high and low sperm motility groups in a screening and identification method for genes related to the regulation of sperm motility in Lionhead geese, as proposed in this invention.

[0029] Figure 4 This is a schematic diagram of the RT-qPCR results of testicular tissue mRNAs in a method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese, as proposed in this invention.

[0030] Figure 5 This is a flowchart illustrating a method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese, as proposed in this invention. Detailed Implementation

[0031] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0032] Example 1

[0033] In the first embodiment of the present invention, the present invention provides a method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese, such as... Figure 1-5 As shown, the process includes the following steps: S1, dividing healthy male Lionhead geese during the breeding season into a high sperm motility group and a low sperm motility group based on the measured sperm motility;

[0034] Furthermore, in S1, the male Lionhead geese were 52-week-old breeding individuals. All male geese were under the same feeding and management conditions. After at least 2 weeks of semen collection training, individuals with good ejaculation response were selected for sperm motility testing. The high sperm motility group had sperm motility ≥50%, and the low sperm motility group had sperm motility ≤20%.

[0035] Specifically, healthy male Lionhead geese aged 52 weeks and in their breeding season were selected as experimental subjects. The Lionhead geese were provided by the Raoping Lionhead Goose Science and Technology Yard in Guangdong (Guangdong Agricultural Development Co., Ltd., and the National Lionhead Goose Breeding Farm). All were healthy individuals from a breeding candidate group free of reproductive diseases. All male geese were raised under the same feeding and management conditions. The basal diet was formulated based on the nutritional requirements of geese according to the US NRC (1994) and combined with practical experience in Lionhead goose breeding in the Chaoshan region. The dry matter basal diet consisted of 20.1% corn. The composition of the feed was as follows: brown rice 27.02%, cassava 7.50%, soybean meal 8.00%, rapeseed meal 4.50%, sunflower seed meal 5.00%, dicalcium phosphate 1.06%, limestone powder 1.32%, sodium chloride 0.30%, wheat bran 4.70%, corn germ meal 6.00%, palm kernel meal 8.00%, distiller's grains 1.50%, rice bran 3.00%, DL-methionine 0.11%, threonine 0.13%, lysine sulfate 0.66%, liquid choline chloride 0.10%, and premix 1.00%, totaling 100.00%. The nutritional levels were: metabolizable energy 10.56 MJ / kg, crude protein 14.85%, crude fat 2.97%, calcium 0.93%, total phosphorus 0.79%, and lysine 0.63%. Metabolizable energy is a calculated value, and the others are measured values. The premix provides 5000 IU of vitamin A, 5.0 mg of vitamin B1, 8 mg of vitamin B2, 5.0 mg of vitamin B6, and 10 mg of vitamin B1 per kilogram of feed. 1212 μg, Vitamin D3 800 IU, Vitamin E 50 IU, Vitamin K3 2.5 mg, Folic acid 0.5 mg, Nicotinamide 40 mg, Biotin 0.3 mg, Pantothenic acid 25 mg, Iron 85.2 mg (provided as ferrous sulfate), Copper 10 mg (provided as copper sulfate), Zinc 50 mg (provided as zinc sulfate), Iodine 0.3 mg (provided as potassium iodide), Selenium 0.25 mg (provided as sodium selenite). The formal experiment was conducted from December 2024 to January 2025 at the Lion Head Goose Science and Technology Courtyard in Raoping County, Guangdong Province. The goose house was equipped with a ground exercise area and a small water pool. One week prior to the experiment, the goose house was thoroughly disinfected with a conventional disinfectant. During the experiment, the water in the pool was changed every two days. The immunization program followed the routine immunization procedures of the national breeding farm. All experimental geese had free access to food and water, and the goose house was disinfected regularly. Before the experiment, all male geese underwent semen collection training for at least two weeks. Training was conducted at fixed times each day using the back-abdomen massage method, with a one-hour interval between each training session, twice daily. The personnel responsible for semen collection, restraint, and receiving remained consistent. After training, individuals with good ejaculation responses were selected for sperm motility testing. For sperm motility testing, fresh semen was first appropriately diluted with 0.9% physiological saline. 2.5 μL of the diluted semen was dropped onto a glass slide, covered with a coverslip, and observed under a microscope. At least 200 sperm were randomly counted, and the number of linearly motile sperm was determined using the formula... Sperm motility V was calculated, where the number of linearly motile sperm was obtained manually under a microscope, and 200 was the set total sperm count. Based on the calculated sperm motility values, sperm were grouped, with V serving as the grouping criterion. 高 ≥50% and V 低 ≤20%, sperm motility meets V 高 ≥50% of individuals were classified as the high sperm motility group, meeting the V criteria. 低 ≤20% of individuals were classified as low sperm motility group, and 12 male geese were selected from each group for subsequent experiments. The tibia length of the Lionhead geese in the high sperm motility group was 116.23±1.68 mm, while that in the low sperm motility group was 113.24±0.62 mm. The difference in tibia length between the two groups was statistically significant. These grouping results were used to collect testicular tissue samples and semen samples from the two groups of male geese to provide experimental materials for subsequent transcriptome sequencing, differential nucleic acid molecular screening, and candidate gene identification, ensuring that subsequent experiments can be conducted on relevant molecular mechanisms based on clear differences in sperm motility phenotypes.

[0036] S2. Collect testicular tissue samples and semen samples from two groups of Lionhead geese respectively. Preserve the testicular tissue samples at low temperature for subsequent molecular detection.

[0037] Furthermore, in S2, testicular tissue samples were flash-frozen in liquid nitrogen and then stored in an ultra-low temperature environment of -80°C, while semen samples were used to determine sperm motility, sperm density, plasma membrane integrity, and acrosome integrity.

[0038] Specifically, after the high and low sperm motility groups of Lionhead geese were grouped and sperm motility was confirmed, semen samples were collected from each group of Lionhead geese using the dorsal-abdominal massage semen collection method. The semen volume was directly measured using a pipette with a range of 100-1000 μL to determine the total volume of a single ejaculation. During collection, the personnel responsible for semen collection, restraint, and receiving the semen remained the same, with a collection interval of 3 days, for a total of 6 semen samples collected for subsequent testing. Subsequently, 6 experimental geese from each group were selected and slaughtered after fasting for 12 hours. Bilateral testicular tissue was immediately collected after slaughter. Part of the testicular tissue was rapidly placed in liquid nitrogen for flash freezing, and after flash freezing, it was transferred to an ultra-low temperature environment of -80℃ for preservation. The other part of the testicular tissue was immersed in 4% paraformaldehyde solution for morphological observation. The immersed testicular tissue was fixed for 24 hours, subjected to gradient dehydration, paraffin embedding, and continuous cutting. After staining with hematoxylin and eosin (HE), the seminiferous tubules and germ cell arrangement were observed under a microscope. In the high sperm motility group, the seminiferous tubules had clear and neatly arranged lumens, with germ cells at various stages distributed in an orderly manner and a large number of mature sperm present in the center. In the low sperm motility group, the seminiferous tubules were malformed, the luminal structure was blurred, the germ cells were loosely arranged, and the number of mature sperm was low. For semen sample analysis, fresh semen was first appropriately diluted with 0.9% physiological saline. 2.5 μL of the diluted semen was dropped onto a glass slide, covered with a coverslip, and observed under a microscope. At least 200 sperm were counted each time, according to the formula: Sperm viability was calculated, with the number of live sperm determined and counted by observing sperm motility under a microscope. Sperm density was determined using a hemocytometer method. 6 μL of fresh semen was diluted with 3% physiological saline at a ratio of 1:50 and mixed thoroughly. The number of sperm in the five central squares (upper right, lower right, upper left, lower left, and center) of a large grid was counted under a 400x optical microscope, according to the formula: The total sperm count in the five square cells is the result of direct microscopic counting. 5×16 represents the total number of small squares within the five square cells, 400 represents the total number of small squares within the large square cell, 10000 is the volume conversion factor, and 50 is the dilution factor. A 2.5 μL smear of semen was prepared, air-dried, stained with Giemsa, rinsed, and air-dried. At least 200 sperm were counted under a microscope, according to the formula: ; Calculate acrosome integrity; sperm with intact acrosomes are determined by the morphology of the acrosome structure after staining; Dilute fresh semen 10-fold with hypotonic swelling solution and let stand for 5 minutes; take 2.5 μL and count at least 200 sperm under a microscope, according to the formula: The integrity of the plasma membrane was calculated, and sperm with a circled tail were considered to have an intact plasma membrane. The testicular tissue was cryopreserved for subsequent transcriptome sequencing, relative expression levels of differentially expressed gene mRNAs, and primer expression verification. The results of these four indicators in the semen sample clearly demonstrated the differences in semen quality between the high and low sperm motility groups, providing support for the rationality of the grouping. This result, combined with subsequent morphological observations and transcriptome analysis of the testicular tissue, will be used to screen and identify genes related to the regulation of sperm motility in Lionhead geese. The next step will be to extract total RNA from the preserved testicular tissue and conduct transcriptome sequencing and differential nucleic acid molecular screening.

[0039] S3. Transcriptome sequencing was performed on the two groups of testicular tissue samples to obtain expression data of mRNA and non-coding RNA.

[0040] Furthermore, in S3, transcriptome sequencing includes the following operations: total RNA is extracted from testicular tissue using the Trizol method, and after quality testing to ensure that the OD260 / 280 is between 1.8 and 2.2 and the RIN value is ≥6.5, an mRNA and non-coding RNA sequencing library is constructed, and expression data is obtained through high-throughput sequencing. The non-coding RNA includes miRNA.

[0041] Specifically, testicular tissue samples preserved from high and low sperm motility groups were collected, and total RNA was extracted using the Trizol method. During extraction, the testicular tissue was first thoroughly ground in liquid nitrogen, then lysed with Trizol reagent. The samples were centrifuged at 13000g for 5 minutes at 4℃, and the supernatant was transferred to a new centrifuge tube. Pre-chilled chloroform was added at a ratio of 0.2mL chloroform to 1mL Trizol, and the mixture was vortexed and allowed to stand at room temperature for 5 minutes. Then, it was centrifuged at 13000g for 15 minutes at 4℃. An equal volume of pre-chilled isopropanol was added to the upper aqueous phase, and the mixture was allowed to stand at room temperature for 10 minutes. Then, it was centrifuged at 13000g for 10 minutes at 4℃, and the supernatant was discarded. 1 The precipitate was gently resuspended in 75% ethanol at 4°C and 12000g for 5 minutes after pre-cooling. The supernatant was discarded, and the precipitate was air-dried at room temperature for 3-5 minutes. After separation with chloroform, precipitation with isopropanol, washing with 75% ethanol, and air-drying, the precipitate was dissolved in DEPC water to obtain total RNA. The quality of the extracted total RNA was tested using Nanodrop to determine the OD260 / 280 ratio and Agilent 5300 to determine the RIN value. The quality standard was set as an OD260 / 280 ratio between 1.8 and 2.2 and an RIN value ≥ 6.5. The OD260 / 280 ratio reflects RNA purity, and the RIN value assesses RNA integrity. Only RNA samples that met the quality standards were retained for subsequent experiments. For the qualified total RNA, mRNA and non-coding RNA sequencing libraries were constructed. High-throughput sequencing was performed using the Illumina NovaSeq 6000 platform, and mRNA library construction was performed using the Illumina® Stranded Total RNA Prep, Ligation with Ribo-ZeroPlus kit. The total RNA volume was 1... The mRNA library was constructed using the QIAseq miRNA Library Kit. The mRNA library was constructed using an rRNA-despecific method. The non-coding RNA library was constructed by focusing on miRNA fragments of 16-35 nt for enrichment. High-throughput sequencing was used to obtain mRNA and miRNA expression data from two groups of testicular tissues. This expression data contains the expression abundance information of each gene and miRNA in the two groups of samples. It is used for the next step of screening mRNAs and miRNAs with significant differential expression between the two groups based on expression abundance, and provides basic data support for subsequent functional enrichment analysis and candidate gene identification.

[0042] S4. Based on expression data, screen for nucleic acid molecules that are significantly differentially expressed between the two groups. Nucleic acid molecules include mRNA and non-coding RNA.

[0043] Furthermore, in S4, the screening criteria for differentially expressed nucleic acid molecules are: mRNAs and non-coding RNAs that, after statistical testing, satisfy P<0.05 and |log2FoldChange|>1.

[0044] Specifically, using mRNA and non-coding RNA expression data from testicular tissues of high and low sperm motility groups obtained through transcriptome sequencing, differential nucleic acid molecule screening was performed using edgeR software. The screening process first used the DGEList function to convert the raw count matrix into an analysis object. This raw count matrix was obtained quantitatively by STAR software after aligning the sequencing data to the goose reference genome, containing the number of expression reads for each nucleic acid molecule in each group of samples. Subsequently, standardization was performed, and the gene expression dispersion was estimated using the estimateDisp function. Then, the ExactTest function was used for statistical testing based on a negative binomial distribution to calculate the p-value and log2FoldChange value for each nucleic acid molecule. The log2FoldChange value was calculated using the formula: The p-value was calculated to be a quantitative indicator of statistical significance. The screening criteria were set as p < 0.05 and |log2FoldChange| > 1. Based on this, significantly differentially expressed mRNAs and non-coding RNAs between the two groups were screened, and a total of 199 significantly differentially expressed mRNAs were identified, of which 131 were upregulated and 68 were downregulated in the high sperm motility group. 59 significantly differentially expressed miRNAs were identified, of which 28 were upregulated and 31 were downregulated in the high sperm motility group. The screening results were used for the next step of functional enrichment analysis of differentially expressed nucleic acid molecules, focusing on biological pathways related to reproductive development. A total of 29 GO items were significantly enriched, including 2 cellular component items and 27 biological process items. The differentially expressed genes are mainly involved in the regulation of multicellular biological processes, the regulation of multicellular biological development, the regulation of cell adhesion, and cell activation, providing a direct basis for the subsequent identification of candidate genes. The next step will be to use the clusterProfilerR package to perform GO and KEGG enrichment analysis on the screened differentially expressed nucleic acid molecules to clarify their biological functions and pathways.

[0045] S5. Perform functional enrichment analysis on the screened nucleic acid molecules, focusing on biological pathways related to reproductive development, and determine candidate genes based on the analysis results;

[0046] Furthermore, in S5, the functional enrichment analysis focused on one or more of the following biological pathways: biosynthetic cofactor pathway, tyrosine metabolism pathway, retinol metabolism pathway, oxidative phosphorylation pathway, glycolysis / glucose production pathway, and cytochrome P450 metabolic pathways in xenobiotics.

[0047] Specifically, differentially expressed mRNAs and non-coding RNAs obtained through S4 screening that met the criteria of P < 0.05 and |log2FoldChange| > 1 were subjected to functional enrichment analysis using the clusterProfilerR package. Before analysis, the differentially expressed genes from geese were mapped to the chicken genome using the blastp method, with P = 1e-5 set as the threshold. The chicken ENSEMBLID was used to replace the goose gene name for subsequent analysis. Subsequently, GO functional enrichment and KEGG pathway enrichment were performed using the enrichGO function and enrichKEGG function, respectively, with P < 0.05 set as the significant enrichment criterion. The focus was on biological pathways related to reproductive development, with particular emphasis on screening for biosynthetic cofactor pathways, tyrosine metabolism pathways, retinol metabolism pathways, oxidative phosphorylation pathways, glycolysis / glucose production pathways, and cytochrome P450-mediated differential expression. Metabolic pathways in this organism were analyzed, and the correlation between pathway function and sperm motility was investigated. Genes involved in spermatogenesis, energy metabolism, and germ cell development were identified from significantly enriched pathways as candidate genes, specifically including BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L. The differential nucleic acid expression data were obtained from transcriptome sequencing and differential screening procedures. The genome mapping step was carried out based on the fact that geese lack high-quality functional annotation databases. The setting of significant enrichment criteria ensured the reliability of pathways and genes. The candidate gene list output from this step was used in the next step to detect their expression levels in two groups of testicular tissue samples using real-time PCR to verify the authenticity of expression differences and thus identify key genes related to the regulation of sperm motility in Lionhead geese.

[0048] Furthermore, in S5, candidate genes include one or more of BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L.

[0049] Specifically, differentially expressed mRNAs and non-coding RNAs obtained from the initial screening that met the criteria of P < 0.05 and |log2FoldChange| > 1 were used for functional enrichment analysis using the clusterProfilerR package. Before analysis, the differentially expressed genes from geese were mapped to the chicken genome using the blastp method, with a mapping threshold of P = 1e-5. The chicken ENSEMBLID was used to replace the goose gene name for subsequent analysis. Subsequently, the enrichGO and enrichKEGG functions were used for GO functional enrichment and KEGG pathway enrichment, respectively, with an enrichment significance threshold of P < 0.05, focusing on biological pathways related to reproductive development. Combining pathway functional correlation and differential gene expression characteristics, pathways involved in spermatogenesis, energy metabolism, and germ cell development were screened from the significantly enriched pathways. The study included genes that regulate male reproductive function, as reported in the literature, to identify candidate genes, specifically BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L. The differential nucleic acid expression data were derived from transcriptome sequencing and differential screening procedures. The genome mapping step was conducted based on the lack of high-quality functional annotation databases for geese, and various threshold settings ensured the reliability of pathway and gene screening. The candidate gene list output from this step was used in the next step to detect their expression levels in two groups of testicular tissue samples using quantitative real-time PCR, verifying the authenticity of expression differences and thus identifying key genes regulating sperm motility in Lionhead geese, providing molecular target support for subsequent improvement of Lionhead goose reproductive performance.

[0050] S6. The expression levels of candidate genes in the two groups of testicular tissue samples were detected by real-time quantitative PCR to verify the authenticity of their expression differences. Based on the verification results, candidate genes related to the regulation of sperm motility in Lionhead geese were identified.

[0051] Furthermore, in S6, quantitative real-time PCR used β-actin as an internal reference gene, employing 2... -ΔΔCt The relative expression levels of candidate genes were calculated using the following amplification reaction conditions: UDG activation at 50℃ for 2 min, pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 15 s, followed by annealing / extension at 60℃ for 1 min, for 40 cycles. Finally, the temperature was increased in a gradient from 65℃ to 95℃, with an increase of 0.5℃ every 5 s. The melting curve was then measured.

[0052] Specifically, testicular tissue samples from high and low sperm motility groups were collected, and total RNA was extracted using the Trizol method. After quality control to ensure that the OD260 / 280 ratio was between 1.8 and 2.2, the RNA was reverse transcribed into cDNA according to the reverse transcription kit procedure and stored at -20℃ for later use. Quantitative real-time PCR was performed using β-actin as an internal reference gene. Specific primers were designed for the selected candidate genes. The reaction system consisted of 10 μL of SYBR Green fluorescent dye, 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of cDNA, and 7 μL of ddH2O, with a total volume of 20 μL. The amplification reaction conditions were set as follows: 50℃ UDG activation for 2 min, 95℃ pre-denaturation for 2 min, 95℃ denaturation for 15 s, followed by annealing / extension at 60℃ for 1 min, repeated 40 times. Finally, the melting curve was determined by gradient temperature increase from 65℃ to 95℃, increasing by 0.5℃ every 5 s. Three replicates were set for each sample. -ΔΔCt The relative expression levels of candidate genes were calculated using a method where ΔCt = candidate gene Ct value - β-actin Ct value, ΔΔCt = high sperm motility group ΔCt value - low sperm motility group ΔCt value, and Ct value was the number of cycles required for the fluorescence signal to reach a set threshold during quantitative PCR, automatically obtained using the PCR instrument's built-in software. The relative expression level data of candidate genes output in this step were used to verify the authenticity of differentially expressed genes screened by transcriptome sequencing. All experimental data were analyzed using t-tests with GraphPadPrism 8.0.2 software, and the results are expressed as mean ± standard deviation. P < 0.05 was considered statistically significant. A t-test was used to determine whether the expression differences of candidate genes between the two groups were significant. The results showed that the relative expression levels of 11 candidate genes (BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L) were significantly higher in the high sperm motility group than in the low sperm motility group, consistent with the trend observed in transcriptome sequencing. This identified candidate genes regulating sperm motility in Lionhead geese, providing reliable targets for molecular breeding to improve their reproductive performance.

[0053] Furthermore, in S6, primers used for real-time PCR were designed for the BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L genes. The upstream and downstream primer sequences and pre-amplified fragment lengths for each gene are as follows:

[0054] BCO1(F:AGTGGAGCCCAGTTCCTACA,R:CCTCTTCTCTTGCATCGGGG,129bp);ATF1(F:CTGGAGAGCAAGTCCAGGTC,R:GGACGACGTGCTAAGATCCC,178bp);DRC1(F:AGTGCAGGATGAGGAGGAGT,R:TCATATGCTGGAGCTGCCTC,86bp);COQ6(F:GGGACATGCGACAGAGTACG,R:GATCTTGCCCGTTGAAGGCT,158bp);TSNAXIP1(F:AGCTATGGCGGCAGGC,R:ACTGGCCTCTAGCAGAAAGC,225bp);SERF1A(F:CCATGACTCGTGGGAACCAG,R:GACTTCCTCTCGTTAGCCGC,169bp);SPAG6(F:GGAGCGCAGGTGTAATGTCT,R:AGTCCTTCAGGCATGTGAGC,675bp);NEK2(F:AGATGCTCGTTTCGGAGGTG,R:GTGCTGCTCCTGTCGATGAT,91bp);WNT3A(F:CTGTGCCAGTTTTCTCACCAT,R:AAGGCAAAGTCATTCACAACAA,106bp);EIF4G2(F:CTCCAGGTGCACTGCTACAA,R:TCCAGCCAGGTTAGCCATTG,185bp);HSPA4L(F:GACCATCGCCAACGAGTACA,R:CTCCTACAGAGCCATTCGGC,230bp)。

[0055] Specifically, testicular tissue samples from high and low sperm motility groups were collected, and total RNA was extracted using the Trizol method. After quality control to ensure that the OD260 / 280 ratio was between 1.8 and 2.2, the RNA was reverse transcribed into cDNA according to the reverse transcription kit procedure and stored at -20℃ for later use. Quantitative real-time PCR was performed using β-actin as an internal reference gene, employing specific primers designed for the genes BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L. The upstream primer sequence for BCO1 was AGTGGAGCCCAGTTCCTACA. The downstream primer sequence is CCTTTCTCTTGCATCGGGG, with a pre-amplified fragment length of 129 bp; the upstream primer sequence for ATF1 is CTGGAGAGCAAGTCCAGGTC, and the downstream primer sequence is GGACGACGTGCTAAGATCCC, with a pre-amplified fragment length of 178 bp; the upstream primer sequence for DRC1 is AGTGCAGGATGAGGAGGAGT, and the downstream primer sequence is TCATATGCTGGAGCTGCCTC, with a pre-amplified fragment length of 86 bp; the upstream primer sequence for COQ6 is GGGACATGCGACAGAGTACG, and the downstream primer sequence is GATCTTGCCC. The pre-amplified fragment length is 158 bp for GTTGAAGGCT; the upstream primer sequence for TSNAXIP1 is AGCTATGGCGGCAGGC, and the downstream primer sequence is ACTGGCCTCTAGCAGAAAGC, with a pre-amplified fragment length of 225 bp; the upstream primer sequence for SERF1A is CCATGACTCGTGGGAACCAG, and the downstream primer sequence is GACTTCCTCTCGTTAGCCGC, with a pre-amplified fragment length of 169 bp; the upstream primer sequence for SPAG6 is GGAGCGCAGGTGTAATGTCT, and the downstream primer sequence is AGTCCTTCAGGCATGTGAGC, with a pre-amplified fragment length of 158 ... AGCTATGGCAGGTAATGTCT, and the downstream primer sequence is AGTCCTTCAGGCATGTGAGC, with a pre-amplified fragment length of 169 bp. The pre-amplified fragment length is 675bp; for NEK2, the upstream primer sequence is AGATGCTCGTTTCGGAGGTG, and the downstream primer sequence is GTGCTGCTCCTGTCGATGAT, with a pre-amplified fragment length of 91bp; for WNT3A, the upstream primer sequence is CTGTGCCAGTTTTCTCACCAT, and the downstream primer sequence is AAGGCAAAGTCATTCACAACAA, with a pre-amplified fragment length of 106bp; for EIF4G2, the upstream primer sequence is CTCCAGGTGCACTGCTACAA, and the downstream primer sequence is TCCAGCCAGGTTAGCCATTG, with a pre-amplified fragment length of 185bp.The upstream primer sequence for HSPA4L was GACCATCGCCAACGAGTACA, and the downstream primer sequence was CTCCTACAGAGCCATTCGGC, with a pre-amplified fragment length of 230 bp. The reaction system consisted of 10 μL of SYBR Green fluorescent dye, 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of cDNA, and 7 μL of ddH2O, for a total volume of 20 μL. The amplification reaction conditions were set as follows: 50℃ UDG activation for 2 min, 95℃ pre-denaturation for 2 min, 95℃ denaturation for 15 s, followed by annealing / extension at 60℃ for 1 min, repeated 40 times. Finally, the melting curve was determined by gradient heating from 65℃ to 95℃, increasing by 0.5℃ every 5 s. Three replicates were set for each sample. -ΔΔCt The relative expression levels of candidate genes were calculated using a method where ΔCt = candidate gene Ct value - β-actin Ct value, ΔΔCt = high sperm motility group ΔCt value - low sperm motility group ΔCt value, and Ct value is the number of cycles when the fluorescence signal reaches the set threshold during the quantitative PCR process, which is automatically read by the PCR instrument's built-in software. The testicular tissue samples input in this step were from the high and low sperm motility groups after the initial grouping. cDNA was obtained by reverse transcription of qualified total RNA. The primer sequences and pre-amplified fragment lengths were designed based on the candidate gene sequences and verified to be feasible through experiments. The output relative expression level data of candidate genes were used to verify the authenticity of differentially expressed genes screened by transcriptome sequencing. The t-test was used to determine whether the expression difference of candidate genes between the two groups was significant, thereby identifying the relevant candidate genes regulating sperm motility in Lionhead geese and providing reliable targets for molecular breeding to improve the reproductive performance of Lionhead geese.

[0056] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese, characterized in that, Includes the following steps: S1. Healthy male Lionhead geese during the breeding season were divided into a high sperm motility group and a low sperm motility group based on the measured sperm motility. S2. Collect testicular tissue samples and semen samples from two groups of Lionhead geese respectively, and preserve the testicular tissue samples at low temperature for subsequent molecular detection. S3. Transcriptome sequencing was performed on the two groups of testicular tissue samples to obtain expression data of mRNA and non-coding RNA. S4. Based on the expression data, screen for nucleic acid molecules that are significantly differentially expressed between the two groups, wherein the nucleic acid molecules include mRNA and non-coding RNA; S5. Perform functional enrichment analysis on the screened nucleic acid molecules, focusing on biological pathways related to reproductive development, and determine candidate genes based on the analysis results; S6. The expression levels of the candidate genes in the two groups of testicular tissue samples were detected by real-time quantitative PCR to verify the authenticity of their expression differences. Based on the verification results, candidate genes related to the regulation of sperm motility in Lionhead geese were identified.

2. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In S1, the male Lionhead geese are 52-week-old breeding individuals. All male geese are under the same feeding and management conditions. After at least 2 weeks of semen collection training, individuals with good ejaculation response are selected for sperm motility testing. The sperm motility of the high sperm motility group is ≥50%, and the sperm motility of the low sperm motility group is ≤20%.

3. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In step S2, testicular tissue samples are flash-frozen in liquid nitrogen and then stored in an ultra-low temperature environment of -80°C. Semen samples are used to determine sperm motility, sperm density, plasma membrane integrity, and acrosome integrity.

4. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In S3, transcriptome sequencing includes the following operations: total RNA is extracted from testicular tissue using the Trizol method, and after quality testing to ensure that the OD260 / 280 is between 1.8 and 2.2 and the RIN value is ≥6.5, an mRNA and non-coding RNA sequencing library is constructed, and expression data is obtained through high-throughput sequencing. The non-coding RNA includes miRNA.

5. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In S4, the screening criteria for differentially expressed nucleic acid molecules are: mRNAs and non-coding RNAs that, after statistical testing, satisfy P<0.05 and |log2FoldChange|>1.

6. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In S5, the biological pathways focused on by the functional enrichment analysis include one or more of the following: biosynthetic cofactor pathway, tyrosine metabolism pathway, retinol metabolism pathway, oxidative phosphorylation pathway, glycolysis / glucose production pathway, and cytochrome P450 metabolic pathways to xenobiotics.

7. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In S5, the candidate genes include one or more of BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L.

8. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In S6, quantitative real-time PCR uses β-actin as an internal reference gene, employing 2... -ΔΔCt The relative expression levels of candidate genes were calculated using the following amplification reaction conditions: UDG activation at 50℃ for 2 min, pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 15 s, followed by annealing / extension at 60℃ for 1 min, for 40 cycles. Finally, the temperature was increased in a gradient from 65℃ to 95℃, with an increase of 0.5℃ every 5 s. The melting curve was then measured.

9. The method for screening and identifying genes related to the regulation of sperm motility in Lionhead geese according to claim 1, characterized in that, In S6, the primers used for quantitative real-time PCR were designed for the BCO1, ATF1, DRC1, COQ6, TSNAXIP1, SERF1A, SPAG6, NEK2, WNT3A, EIF4G2, and HSPA4L genes. The upstream and downstream primer sequences and pre-amplified fragment lengths for each gene are as follows: BCO1(F:AGTGGAGCCCAGTTCCTACA,R:CCTCTTCTCTTGCATCGGGG,129bp);ATF1(F:CTGGAGAGCAAGTCCAGGTC,R:GGACGACGTGCTAAGATCCC,178bp);DRC1(F:AGTGCAGGATGAGGAGGAGT,R:TCATATGCTGGAGCTGCCTC,86bp);COQ6(F:GGGACATGCGACAGAGTACG,R:GATCTTGCCCGTTGAAGGCT,158bp);TSNAXIP1(F:AGCTATGGCGGCAGGC,R:ACTGGCCTCTAGCAGAAAGC,225bp);SERF1A(F:CCATGACTCGTGGGAACCAG,R:GACTTCCTCTCGTTAGCCGC,169bp);SPAG6(F:GGAGCGCAGGTGTAATGTCT,R:AGTCCTTCAGGCATGTGAGC,675bp);NEK2(F:AGATGCTCGTTTCGGAGGTG,R:GTGCTGCTCCTGTCGATGAT,91bp);WNT3A(F:CTGTGCCAGTTTTCTCACCAT,R:AAGGCAAAGTCATTCACAACAA,106bp);EIF4G2(F:CTCCAGGTGCACTGCTACAA,R:TCCAGCCAGGTTAGCCATTG,185bp);HSPA4L(F:GACCATCGCCAACGAGTACA,R:CTCCTACAGAGCCATTCGGC,230bp)。

Images