Composition and kit for specific detection of polyrocentrum Polaninae and application of composition and kit for specific detection of polyrocentrum Polaninae

Abstract

The invention provides a composition and a kit for specific detection of Polish-dorocentrum and application of the composition and the kit, relates to the technical field of microbiological detection, and aims to obtain a crRNA sequence which is used for specific detection of Polish-dorocentrum and has high specific recognition capability and a recombinase isothermal amplification product primer pair with low background amplification characteristic. The detection method of the polyrocentrum Polish still has good performance in a real environment sample, and achieves the technical effects of being not interfered by background impurities and being compatible with fluorescence and test strip dual-mode detection.

Description

Technical Field

[0001] This invention relates to the field of microbial detection technology, and in particular to compositions, kits, and applications for the specific detection of *Polydinium porphyria* in Poland. Background Technology

[0002] Polish dinoflagellate ( Peridinium polonicum *Polygonium podophyllum* is a type of freshwater microalga belonging to the phylum Dinophyta. The toxins secreted by this algae can cause mass fish deaths; under experimental conditions, the toxins even exhibit lethality to mammals. In 2006, the toxin-producing *Polygonium podophyllum* was first detected in the Xiangxi River in the Three Gorges Reservoir area of ​​my country, with a concentration as high as 4.2 × 10⁻⁶. 4 The number of algae present at a rate of [number] per L is seriously affecting the safety of local fisheries and domestic water use. Therefore, rapid and accurate identification of target algae is necessary to ensure the ecological security of water sources.

[0003] In existing technologies, nucleic acid sequence detection, represented by real-time fluorescence PCR, is the main method. However, these methods are highly dependent on equipment and involve complex procedures, making them unsuitable for scenarios such as field monitoring. In contrast, recombinase isothermal amplification (RAA) technology, as a rapid isothermal amplification tool, does not require expensive instruments and can amplify efficiently in a short time, making it suitable for field applications. However, its specificity is poor, and non-specific amplification is prone to occur, leading to a decrease in detection accuracy. In recent years, CRISPR-like enzyme digestion recognition systems have emerged, possessing extremely high sequence recognition accuracy and capable of identifying and distinguishing single-base differences. After recognizing the target DNA, this system can activate non-specific cleavage signal substrates, thereby generating a visual signal. This effectively compensates for the lack of specificity in recombinase isothermal amplification technology and improves the detection accuracy of target algae in red tide early warning.

[0004] The prior art discloses a detection method for Karenia mikimotoi based on a combined recombination amplification and enzyme digestion recognition platform (publication number: CN115896321A), which realizes the detection of Karenia mikimotoi based on the CRISPR enzyme digestion recognition system; however, the primers and guide RNA sequences used in its detection system are mainly for Karenia mikimotoi and have no ability to distinguish against Polydinophthora polii, and there are certain limitations in terms of specificity and purity of amplification products.

[0005] Therefore, there is an urgent need for a rapid detection method for Polish polydinophthora with high specificity, low detection limit, and applicability to complex river and lake water sample backgrounds. Summary of the Invention

[0006] To improve the specificity and sensitivity of detection and to solve the problems of non-specific amplification and target misjudgment in the prior art, this invention proposes a composition, kit and application for the specific detection of Polish polydinophthora.

[0007] In a first aspect, the present invention protects a composition for the specific detection of *Polydinium glaciformis* in Poland, comprising: crRNA with the sequence shown in SEQ ID NO:1; and a recombinase isothermal amplification primer pair with the sequences shown in SEQ ID NO:2 and SEQ ID NO:3.

[0008] Secondly, the present invention protects a kit comprising crRNA, a recombinase isothermal amplification primer pair, and a Cas12a enzyme; the sequence of the crRNA is shown in SEQ ID NO:1; the sequences of the recombinase isothermal amplification primer pair are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0009] Thirdly, this invention protects the application of the above-mentioned kit in the specific detection of *Polydinium glomeratum* in Poland.

[0010] Fourthly, this invention protects a method for detecting *Polydinium polis*, comprising: performing recombinase isothermal amplification on a sample to be tested using a recombinase isothermal amplification primer pair; the sequences of the recombinase isothermal amplification primer pair are shown in SEQ ID NO:2 and SEQ ID NO:3; mixing the amplification product with crRNA, Cas12a enzyme, and a reporter probe; the crRNA sequence of the crRNA is shown in SEQ ID NO:1; and reading the detection results by fluorescence signal or lateral flow chromatography test strip.

[0011] This invention provides compositions, kits, and applications for the specific detection of *Polydinium polis* in Poland. The invention achieves this through precise design of a crRNA sequence (LW174) with high specific recognition capability and a primer pair (LW169+LW170) for recombinase isothermal amplification products with low background amplification characteristics. The detection method for *Polydinium polis* of this invention is not only low-cost and short-time, but also exhibits good performance in real-world samples, unaffected by background impurities, and compatible with both fluorescence and test strip detection modes. Furthermore, it achieves the technical advantage of not relying on thermal cycling equipment, requiring only a constant-temperature water bath or portable device for on-site detection. Attached Figure Description

[0012] Figure 1 Agarose gel electrophoresis image of primers used for isothermal amplification of recombinase.

[0013] Figure 2 Kinetic curves for trans-cleavage of FQ-ssDNA probe by different crRNA-Cas12a combinations.

[0014] Figure 3 The endpoint fluorescence imaging of different crRNA-Cas12a combinations trans-cleaving FQ-ssDNA probes.

[0015] Figure 4 Agarose gel electrophoresis images of the trans-cleavage of FQ-ssDNA probes by different crRNA-Cas12a combinations.

[0016] Figure 5 This is a graph showing the real-time quantitative PCR detection of a plasmid containing the target fragment.

[0017] Figure 6 Image of a Cas12a-FQ side-flow chromatography test strip containing the target fragment plasmid.

[0018] Figure 7 The image shows the detection results of Cas12a-FB-LFD on plasmids containing the target fragment.

[0019] Figure 8 This image shows the real-time quantitative PCR detection of the genomes of different algae or environmental samples.

[0020] Figure 9 Imaging images of Cas12a-FQ sideflow chromatography strips detecting the genomes of different algae or environmental samples.

[0021] Figure 10 The image shows the results of Cas12a-FB-LFD detection of genomes from different algal or environmental samples. Detailed Implementation

[0022] The present invention will be described in more detail with reference to the following embodiments. However, the scope of protection of the present invention is not limited to the following embodiments.

[0023] Recombinase-mediated isothermal amplification (RAA) is a technique that utilizes recombinase, single-stranded binding protein (SSB), and DNA polymerase to amplify nucleic acids under isothermal conditions (optimal temperature 37°C). The specific principle is as follows: the recombinase, SSB, and primer form a complex that scans double-stranded DNA. At sequences homologous to the primers, the double-stranded DNA unwinds. The SSB prevents single-stranded DNA renaturation. In the presence of energy and dNTPs, DNA polymerase completes strand extension, and instrumental amplification can be achieved in 5-20 minutes.

[0024] RPA (Recombinase Polymerase Amplification) is an isothermal nucleic acid amplification technique that can rapidly amplify target DNA / RNA sequences at a constant temperature (typically 37℃–42℃). Its core advantage is that it eliminates the need for the thermal cycling equipment required for traditional PCR, making it particularly suitable for rapid on-site detection (such as pathogen diagnosis and environmental microbial monitoring).

[0025] CRISPR-like enzyme digestion recognition systems, i.e., CRISPR-based nucleic acid detection, can be divided into two types in principle: (1) utilizing the high specificity of Cas proteins such as Cas9 to recognize and bind to double-stranded DNA (dsDNA); and (2) utilizing the characteristic of Cas proteins such as Cas13 and Cas12 to specifically recognize nucleic acids, activate bypass cleavage activity, and non-specifically cleave single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). For this invention, the Cas12a protein is used for specific recognition.

[0026] The proto-spacer neighbor motif (PAM) of crRNA is an important component of the CRISPR-Cas system. It is located near the target DNA sequence and is crucial for Cas protein recognition and binding to the target DNA.

[0027] Experimental Example 1 Design of primers for recombinase isothermal amplification and crRNA sequence To design highly specific recombinase isothermal amplification primers and crRNA, endogenous transcriptional spacer fragments (ITS) of different strains of the same species *Polygonococcus scripp.* and closely related species were first downloaded and analyzed from the NCBI database. It should be noted that screening for interspecific variation sites by comparing ITS from multiple species can avoid interference from closely related species and achieve the technical effect of improving specificity. In the specific implementation process, closely related species can be different species in the *Scripp.* genus, such as... Scrippsiella precaria , Scrippsiella irregularis , Scrippsiella ramonii Types such as...

[0028] Through meticulous comparative analysis, we searched for all potential target sequences containing crRNA proto-interstitial adjacent motifs (PAM, 5'-TTTV-3', where V represents A, G, or C).

[0029] To accurately distinguish between different species and strains, target regions exhibiting conserved differences in the PAM motif adjacent to the protospacer of crRNA and its adjacent 1-8 bp seed region were identified as candidate crRNAs. It should be noted that the above method utilizes sequence differences at key active sites to identify different strains. Specifically, compared to off-target effect detection, experimentally verifying the impact of seed region mismatches and excluding closely related species provides a more reliable biovalidation-guided design.

[0030] After identifying the target region of the crRNA, suitable recombinase isothermal amplification primers are screened upstream and downstream of it. In practice, to enhance primer specificity for specific strains, the sequence variability near the 3' end of the primer needs special consideration. In one specific embodiment, the design of recombinase isothermal amplification primers must meet the following conditions: the length of the amplified product is less than 500 bp, preferably in the 100-200 bp range; the primer length is between 30-36 bp; the GC content is between 20-70%; the primer annealing temperature is between 50-100℃; and single-base repeats exceeding 5 bp should be avoided.

[0031] Based on the above principles, three pairs of primers for isothermal amplification of recombinase were designed and screened: LW167+LW168 primer pair, LW169+LW170 primer pair, and LW171+LW172 primer pair.

[0032] For enzymatic nuclease systems, to design a single guide RNA (crRNA), which uses double-stranded DNA as a substrate, it needs to recognize a sequence containing a PAM region (5'-TTTV-3') at the 5' end of the complementary strand of the target DNA. All possible crRNA recognition regions (20 nucleotides downstream of 5'-TTTV-3') are carefully screened within the target amplification region, and a stem-loop structure is added upstream of the recognition region to synthesize a highly specific crRNA. In this experimental example, the stem-loop sequence is 5'-UAAUUUCUACUAAGUGUAGAU-3'.

[0033] in: The sequence of LW167 (SEQ ID NO:4) is: TTGTTGTCTCCTTCTCTCTCTGTGATGAATTC The sequence of LW168 (SEQ ID NO:5) is: CAATTCACAATGCTTATCACACTTTGCTG The sequence of LW169 (SEQ ID NO:2) is: CTTGGTGGTAGTGTTGTCTGGGTGTATTT The sequence of LW170 (SEQ ID NO:3) is: TATGAGCCATACTACATCAAGGGTTATTTC The sequence of LW171 (SEQ ID NO:6) is: CAAAGTGTGATAAGCATTGTGAATTGCAG The sequence of LW172 (SEQ ID NO:7) is: CACAAATACACCCAGACAACACTAC The specific method is as follows: (1) The endogenous transcription spacer fragment of the Polish polydinophthora was cloned and sequenced. The sequence was compared with 100 similar sequences by NCBI Blast.

[0034] (2) According to sequence alignment, the endogenous transcription spacer fragments of different strains of the same species are basically the same; therefore, only one sequence is retained for a species.

[0035] (3) Mark the PAM sequence and the seed region of 1-8 bp at the 3' end adjacent to PAM.

[0036] It should be noted that mismatches between PAM and the seed region weaken the activity of enzymatic nucleases. Furthermore, mismatches of more than two bases in the non-seed region and PAM region also significantly weaken the activity of enzymatic nucleases.

[0037] (4) Several amplifiable regions are defined in the endogenous transcription spacer region using recombinase isothermal amplification primers. For example, the recombinase isothermal amplification primer pairs are LW167+LW168, LW169+LW170, and LW171+LW172, which are three amplification regions. All crRNAs containing PAM (5'-TTTV-3', where V represents A, G, or C) are searched in these three regions respectively.

[0038] Specifically, it is necessary to exclude crRNA that falls on the RPA primer to prevent the CRISPR-like enzyme digestion recognition system from using the primer as a substrate and causing false positives.

[0039] In summary, preliminary selections were made for RPA amplification primers and crRNA.

[0040] In order to overcome the limitation of high non-specific amplification risk of PRA, primers are designed by screening for highly variable ITS regions through multiple sequence alignment, as described above. In addition, as shown in Experimental Example 2, CRISPR-Cas12a secondary verification is also introduced. Even if there is slight non-specific amplification of RPA, the Cas12a / gRNA complex can strictly identify and exclude false positives through seed region.

[0041] Experiment Example 2 Screening of recombinase isothermal amplification primers and crRNA-specific target sequences. (1) Screening of primers for isothermal amplification of recombinase Experimental materials: Recombinase isothermal amplification kit, Hangzhou Zhongce basic nucleic acid amplification reagent, S001ZC.

[0042] To determine the optimal primer pairs for isothermal amplification of recombinase, isothermal amplification of recombinase was performed on *Polydinium polis* using primer pairs LW167+LW168, LW169+LW170, and LW171+LW172, respectively.

[0043] Use a plasmid containing the target fragment (10 ng, equivalent to 2.65 × 10⁻⁶). 9 Using a template (copy / μL), a recombinase isothermal amplification reaction was performed. The specific steps are as follows: Add buffer A, 2 μL each of forward and reverse primers (10 uM), and buffer B to the lyophilized recombinase isothermal amplification powder, and bring the volume to 50 μL with enzyme-free water. After mixing, transfer 19 μL to a new centrifuge tube and add 1 μL of plasmid. Finally, incubate at 37℃ for 30 minutes. After the reaction, add 20 μL of enzyme-free water and 40 μL of phenol:chloroform:isoamyl alcohol (25:24:1) to the centrifuge tube, vortex vigorously to mix, centrifuge at 12,000×g for 5 minutes, and take 15 μL of the supernatant for 2% agarose gel electrophoresis to observe the amplification. Figure 1 The image shown is an agarose gel electrophoresis diagram of the primers used for isothermal amplification of recombinase.

[0044] Through observation Figure 1 As can be seen, NC_water represents the negative control using enzyme-free water instead of plasmid DNA, and P. polonicum_plasmid represents the plasmid carrying the target DNA of *P. polonicum* as a template. Lane M is DL500. Lanes RAA1_NC_water and RAA1_P. polonicum_plasmid represent the negative control and detection results using primers (LW167+LW168), respectively. It can be seen that RAA1_P. polonicum_plasmid produced a specific band of approximately 150 bp and a non-specific band of approximately 350 bp. Lanes RAA2_NC_water and RAA2_P. polonicum_plasmid represent the negative control and detection results using primers (LW169+LW170), respectively. It can be seen that RAA1_P. polonicum_plasmid produced a specific band of 150 bp. Lanes RAA 3_NC_water and RAA 3_P. polonicum_plasmid represent the negative control and detection results using primers (LW171+LW172), respectively. It can be seen that RAA 3_P. polonicum_plasmid has a specific band of 150bp.

[0045] from Figure 1It can be seen that the RAA2_P. polonicum_plasmid produced the most specific band, followed by RAA3_P. polonicum_plasmid, and lastly RAA1_P. polonicum_plasmid. RAA1_P. polonicum_plasmid also produced one non-specific band. Therefore, the RAA2 (LW169+LW170) primer pair is considered to have the best amplification effect, and three crRNAs (LW174, LW175, and LW177) were designed targeting its amplicon region.

[0046] The sequence of LW174 (SEQ ID NO:1) is: UAAUUUCUACUAAGUGUAGAUACGCGCUUCAAGUCAUCGGG The sequence of LW175 (SEQ ID NO:8) is: UAAUUUCUACUAAGUGUAGAUUGGCACACAACUCCUAAGCA The sequence of LW177 (SEQ ID NO:9) is: UAAUUUCUACUAAGUGUAGAUAAGACACUGCAACACAAGAC.

[0047] In other words, based on the RAA (recombinase-mediated isothermal amplification) technology principle, the specificity of primer pairs directly affects the detection accuracy. The LW169+LW170 primer pair is more suitable for the specific detection of Polish polydinophthora in this experimental system, providing a basis for primer screening for the subsequent establishment of rapid detection methods.

[0048] (2) crRNA screening 1) Different crRNA-Cas12a combination enzyme digestion single-stranded DNA detection probes Experimental materials: EnGen Lba Cas12a (Cpf1) nuclease, NEB brand.

[0049] To screen for the optimal crRNA, this invention compared the enzymatic cleavage efficiency of different crRNA-Cas12a combinations for detecting single-stranded DNA probes. Utilizing the characteristic that Cas12a, upon recognizing a substrate, activates its activity to cleave surrounding non-specific single-stranded DNA fragments, a chemically synthesized single-stranded DNA probe containing a reporter group (FQ-ssDNA probe) was used as its non-specific cleavage substrate. The fluorescence signal was then monitored in real-time using quantitative real-time PCR to determine the substrate cleavage status.

[0050] The 20 μL fluorescence detection reaction system was as follows: 0.05 µM EnGen® Lba Cas12a, 1x NEBuffer™r2.1, 6.25 μM FQ-ssDNA (FQ: 5'-FAM-TTATT-3'-BHQ), and 2 μL of RAA amplification product (amplification time 10 min, primers LW169 and LW170). The reaction mixture containing FQ-ssDNA was detected using a real-time PCR instrument at 37°C. Signal was collected every 1 minute for 1 hour. The results were as follows: Figure 2 The kinetic curves of trans-cleavage of the FQ-ssDNA probe by different crRNA-Cas12a combinations are shown. After the reaction, the presence or absence of fluorescence was observed under an LED blue light lamp or a gel imaging system to obtain... Figure 3 Endpoint fluorescence imaging of different crRNA-Cas12a combinations trans-cleaving FQ-ssDNA probes.

[0051] Figure 2 In the diagram, NC is the negative control (enzyme-free water instead of crRNA); crRNA1 represents LW174; crRNA2 represents LW175; and crRNA3 represents LW177.

[0052] When Cas12a digests the FQ-ssDNA probe under crRNA guidance, the fluorescence kinetic curve generated by real-time acquisition of fluorescence signals using a quantitative real-time PCR instrument is shown in the figure. Figure 2 and Figure 3 As shown in the curves provided by the real-time PCR instrument, it is clear that the fluorescence signal released in the crRNA1 sample was the strongest, followed by the crRNA2 sample, and then the crRNA3 sample. No fluorescence signal was detected in the negative control NC. Furthermore, the crRNA1 sample exhibited the fastest fluorescence rise rate. Therefore, under the guidance of crRNA1 (LW174), the enzyme digestion efficiency of Cas12a can be maximized.

[0053] 2) In vitro cleavage of target nucleic acids: Experimental materials: EnGen Lba Cas12a (Cpf1) nuclease, NEB brand.

[0054] The curves provided by the real-time PCR instrument have confirmed that crRNA1 (LW174) can more fully trigger the cleavage activity of Cas12a for single-stranded DNA probes. To confirm whether the target nucleic acid was successfully detected by crRNA1 (LW174)-Cas12a, an in vitro cleavage experiment was conducted using plasmid DNA carrying the target nucleic acid as the cleavage target.

[0055] The 20 μL reaction system is as follows: Each reaction system contains 0.05 µM EnGen® Lba Cas12a, 1xNEBuffer™ r2.1, and plasmid DNA (7.75 × 10⁻⁶). 10 (Copies), and 0.5 ng / ul crRNA (LW174). After reacting at 37°C for 1 hour, cleavage was observed by 1.5% agarose gel electrophoresis. Figure 4 Agarose gel electrophoresis images of different crRNA-Cas12a combinations trans-slicing of FQ-ssDNA probes.

[0056] like Figure 4 As shown, lane M represents DL5,000; lane NC is the negative control (enzyme-free water replaces crRNA); and lane P. polonicum represents crRNA1 (LW174). In the negative control, there was a relatively abundant supercoiled plasmid at the corresponding DNA marker 2000 bp, while a small amount of linear plasmid was present at the corresponding DNA marker 5000 bp. In contrast, in lane P. polonicum, the band corresponding to the supercoiled plasmid was particularly thin, while two more distinct bands appeared at the position corresponding to the linear plasmid. This indicates that crRNA-Cas12a successfully recognized the target nucleic acid carried in the plasmid DNA and activated its cis-cleavage activity, cleaving the circular supercoiled plasmid into a linear structure.

[0057] In summary, RAA2 (LW169+LW170) and crRNA1 (LW174) exhibit superior combined activity. Therefore, this invention utilizes this combination to construct a RAA-CRISPR / Cas detection system for *Polygonococcus pulcherrima*, and performs sensitivity testing and specificity verification as described below.

[0058] Experimental Example 3 Sensitivity detection of the selected recombinase isothermal amplification primers and crRNA for *Polydinium polonum*. Experimental materials: Recombinase isothermal amplification kit, Hangzhou Zhongce basic nucleic acid amplification reagent, S001ZC; EnGenLba Cas12a (Cpf1) nuclease, NEB brand.

[0059] Timely detection of target algae in the early stages of large-scale algal growth is crucial for controlling red tides. The sensitivity of RAA-CRISPR / Cas-FQ and RAA-CRISPR / Cas-FQ-LFA was determined by using plasmids containing fragments from the Polish Polydinales order as substrates.

[0060] First, plasmids containing fragments from the Polish Polydinales order were used as substrates to determine the sensitivity of RAA-CRISPR / Cas-FQ and RAA-CRISPR / Cas-FQ-LFA.

[0061] (1) Recombinase isothermal amplification: Plasmids containing the target fragment were serially diluted 10-fold (5.9 × 10⁻⁶) 6 -5.9×10 -1 (Copies / u1), 8 samples were obtained as templates, sterile water was used as a negative control, and 1ul of template was added to 19 μL of RAA reaction solution for amplification (37℃ reaction, 10min).

[0062] (2) Cas12a-FQ detection: 2 μL of RAA reverse product was added to the Cas12a-FQ reaction solution, placed in a real-time PCR instrument, and reacted at 37℃ for 1 h. Fluorescence signals were collected every 1 min. After the reaction, the final product was observed using blue light or ultraviolet light. Figure 5 A graph showing the detection of a plasmid containing the target fragment using real-time quantitative PCR.

[0063] (3) Cas12a-FB-LFD detection: The recombinase isothermal amplification product obtained above was added to the prepared Cas12a-crRNA digestion reaction mixture (20 μL reaction system as follows: 0.05 µM EnGen® Lba Cas12a, 1xNEBuffer™ r2.1, 1 uM FB-ssDNA (FQ: 5'-FAM-TATT-3'-Biotin) and 2 uL RAA amplification product). After reacting at 37℃ for 1 hour, 100 uL HybriDetect assay buffer (TwistDx) was added to the reaction mixture. After mixing, it was incubated at room temperature for 2 minutes. Finally, the lateral flow chromatography strip (TwistDx) was inserted and the results were viewed after 1-2 minutes. After the real-time quantitative PCR was completed, photos were taken with a smartphone under blue light and images were obtained using a gel imaging system under ultraviolet light conditions. Figure 6 Imaging image of a Cas12a-FQ side-flow chromatography test strip containing the target fragment of a plasmid. Figure 7 The detection results of Cas12a-FB-LFD with plasmid containing the target fragment.

[0064] Figure 5 , Figure 6 and Figure 7 All results were obtained using plasmids as templates. The results, in descending order, were NC (negative control, with enzyme-free water replacing plasmid DNA in the RAA reaction) and [data missing - likely a specific sample size]. -1 Copies / μL, 5.9 x 100 Copies / μL, 5.9 x 10 1 Copies / μL, 5.9 x 10 2 Copies / μL, 5.9 x 10 3 Copies / μL, 5.9 x 10 4 Copies / μL, 5.9 x 10 5 Copies / μL, 5.9 x 10 6 Experimental samples were prepared using copies / μL as templates for isothermal amplification of recombinase.

[0065] Through observation Figure 5 , Figure 6 and Figure 7 As can be seen, the detection results of Cas12a-FB-LFD are consistent with those of Cas12a-FQ, when the plasmid template is 5.9 x 10⁻⁶. 1 ~5.9x10 6 Even at 5.9 x 10^9 copies / μL, a strong fluorescence signal is still produced, or a clear band is still produced at the test line above the lateral flow chromatography strip. However, the negative control and template concentrations are below 5.9 x 10^9 copies / μL. 1 Samples with a concentration of 5.9 x 10⁻⁶ copies / μL all tested negative. Therefore, it can be confirmed that the Polish polydinophthora RAA-CRISPR / Cas12a detection system of this invention can achieve a detection rate of 5.9 x 10⁻⁶ copies / μL. 1 Copy / μL.

[0066] Example 1 Specificity detection of Polish polydinophthora using screened recombinase isothermal amplification primers and crRNA. A kit comprising a crRNA sequence, a recombinase isothermal amplification primer pair, a lysis buffer (for lysing cells and releasing DNA), a recombinase isothermal amplification reaction buffer and an enzyme mixture, and a Cas12a digestion reaction buffer and a Cas12a enzyme; the crRNA sequence is shown in SEQ ID NO:1; the recombinase isothermal amplification primer pair comprises a forward primer and a reverse primer, the sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively.

[0067] In the specific implementation process, the recombinase isothermal amplification reaction buffer and enzyme mixture were prepared using the basic nucleic acid amplification kit (catalog number: S001ZC) from Hangzhou Zhongce Biotechnology Co., Ltd.; the Cas12a enzyme digestion reaction buffer and Cas12a enzyme were prepared using EnGen® Lba Cas12a (Cpf1) nuclease from New England Biolabs (NEB).

[0068] To verify the specificity of the RAA-CRISPR / Cas12a detection system for *Polydinium polis*, common microalgae in freshwater environments and environmental water samples collected from the Minjiang River estuary in Fujian Province were selected for specificity detection.

[0069] Specifically, the genomes of different algae or environmental samples were extracted, namely Chlorella ( Chlorella sp. Scenedesmus ( Scenedesmus sp. The samples were taken from the Minjiang River estuary and the surrounding waters of the Minjiang River Estuary National Wetland Park, located at the mouth of the Minjiang River in Tantou Town-Meihua Town, Changle District, Fuzhou City, Fujian Province.

[0070] Using the recombinase isothermal amplification kit, add Buffer A, specific primers (i.e., LW169+LW170 primer pair), and template (genome of algae or environmental sample) sequentially according to the instructions. Then, add Buffer B to activate the reaction. Place the reaction mixture in a 37°C thermostat, PCR instrument, or other equipment or environment that can maintain 37°C to amplify the DNA fragment to be detected (10 minutes) to obtain the recombinase isothermal amplification product. Store the amplification product at 4°C or -20°C for further detection.

[0071] Prepare a Cas12a-crRNA digestion reaction mixture, including EnGen® Lba Cas12a (NEB), NEBuffer™r2.1 (NEB), crRNA, FQ-ssDNA (5'-FAM-TTATT-3'-BHQ) or FB-ssDNA (5'-FAM-TTATT-3'-Biotin).

[0072] Specific detection based on Cas12a-FQ: The recombinase isothermal amplification product obtained above was added to the prepared Cas12a-crRNA digestion reaction mixture (containing FQ-ssDNA).

[0073] If the reaction system contains specific target DNA for crRNA, single-stranded DNA will also be cleaved, separating the fluorophore from the quencher group, thus releasing a fluorescent signal. The fluorescence signal is detected using a quantitative qPCR instrument at 37°C (signal is collected every minute for 1 hour); in practice, it can also be viewed directly under blue light or a gel imaging system under UV light after the reaction. Figure 8 Real-time quantitative PCR detection of genomes from different algae or environmental samples.

[0074] Since Cas12a can specifically cleave its target DNA after binding to crRNA, and at the same time activate the activity of non-specific cleavage of nearby single-stranded DNA, terminal-modified single-stranded DNA (FB: 5'-FAM-TTATT-3'-Biotin) is added to the reaction system.

[0075] Detection based on Cas12a-FB-LFD: The isothermal amplification product of the recombinase obtained above was added to the prepared Cas12a-crRNA digestion reaction mixture (containing FB-ssDNA). After reacting at 37℃ for 1 hour, 100 uL of HybriDetect assay buffer (TwistDx) was added to the reaction mixture. After mixing, it was incubated at room temperature for 5 minutes. Finally, the lateral flow chromatography strip (TwistDx) was inserted, and the results were checked after 1-2 minutes. Figure 9 Imaging images of Cas12a-FQ sideflow chromatography strips detecting genomes of different algal or environmental samples.

[0076] After real-time quantitative PCR, photos were taken using a smartphone under blue light illumination and images were obtained using a gel imaging system under ultraviolet light conditions; Figure 10 The results of Cas12a-FB-LFD detection of genomes from different algal or environmental samples.

[0077] It should be noted that if the reaction system contains specific target DNA of crRNA, single-stranded DNA will also be non-specifically cleaved by enzymatic nucleases. After the reaction, detection using a lateral flow chromatography test strip showed that uncut single-stranded DNA was trapped at the control line and could not continue to migrate upwards; while cleaved single-stranded DNA could be trapped at the control line, and its 5' end FAM could also be trapped by the anti-FITC antibody at the test line.

[0078] for Figure 8 , Figure 9 and Figure 10 The samples, numbered 1-5, are, in order, NC (negative control, with enzyme-free water used instead of genomic template in the RAA reaction), Chlorella, Scenedesmus, environmental water samples from the Minjiang Estuary, and Polydinium polis.

[0079] Through observation Figure 8 , Figure 9 and Figure 10As can be seen, the specificity detection results of Cas12a-FQ and Cas12a-FB-LFD for the selected RAA2 primer pair (LW169+LW170) and crRNA1 (LW174) were consistent. Only the sample containing *Polygonum polioense* genomic DNA (sample 5) showed a positive result, releasing a strong fluorescent signal or producing a clear band on the test line. These results indicate that the RAA-CRISPR / Cas12a system specifically recognized *Polygonum polioense*, while the other samples were not *Polygonum polioense* and all results were negative, completely consistent with the actual situation. Microscopic observation also revealed no *Polygonum polioense* cells or morphologically similar cells in the environmental water samples of the Minjiang River estuary.

[0080] This invention, through precise primer and crRNA design, effectively distinguishes *Polydinium polonandum* from its closely related species, achieving a significant improvement in avoiding false alarms. The recombinase isothermal amplification primer pair (LW169+LW170) designed in this invention exhibits a 150bp target band only for *Polydinium polonandum* among various algal templates, with no non-specific bands in the amplification product, significantly superior to existing primer systems. The crRNA (LW174) of this invention can guide enzymatic nucleases to significantly enhance fluorescence activation, with signal intensity far exceeding that of existing technologies. Using the screened and optimized primer pair (LW169+LW170) and crRNA (LW174), amplification can be completed within 10 minutes at 37°C, with fluorescence signal development or test strip reading completed within the following hour, suitable for rapid on-site screening. It maintains good performance in real-world samples, is unaffected by background impurities, and is compatible with both fluorescence and test strip detection modes. Furthermore, it does not rely on thermal cycling equipment; only a constant-temperature water bath or portable device is needed for on-site testing, resulting in low cost and short reaction time. The composition, kit, and application of this invention for the specific detection of *Polygonum policosum* offer superior detection effects and application value, overcoming the bottlenecks of existing technologies. It is suitable for multiple scenarios, including ecological risk assessment, and possesses promising industrialization prospects.

[0081] For the various experimental supplies (including but not limited to chemical reagents, biological products, cells, organisms, instruments, etc.) mentioned in this article, the manufacturers, references or detailed preparation methods have been noted for those that are special or difficult to obtain; unless otherwise specified, they are all conventional experimental supplies that could be easily obtained through various means (such as purchase, self-preparation, etc.) before the date of this application.

[0082] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications and improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A composition for the specific detection of *Polydinium porphyria*, characterized in that, include, crRNA with the sequence shown in SEQ ID NO:1; and recombinase isothermal amplification primer pairs with the sequences shown in SEQ ID NO:2 and SEQ ID NO:

3.

2. A reagent kit, characterized in that, It contains crRNA sequences, recombinase isothermal amplification primer pairs, and Cas12a enzyme; The crRNA sequence is shown in SEQ ID NO:1; The sequences of the recombinase isothermal amplification primer pair are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. The application of the kit according to claim 2 in the specific detection of *Polydinium porphyria* in Poland.

4. A method for detecting *Polygonococcus pulcherrima*, characterized in that, include, The recombinase isothermal amplification primer pair was used to perform recombinase isothermal amplification on the test sample; the sequences of the recombinase isothermal amplification primer pair are shown in SEQ ID NO:2 and SEQ ID NO:3; The amplification product was mixed with crRNA, Cas12a enzyme and reporter probe for reaction; wherein the crRNA sequence is shown in SEQ ID NO:1; The test results are read using fluorescence signals or lateral flow chromatography test strips.

Images