Method for identifying purity of celery Jinrui 48 hybrid by using InDel molecular marker

By using InDel molecular marker technology and PCR amplification with specific primer QC-T17 followed by agarose gel electrophoresis, the time-consuming, labor-intensive, and environmentally dependent problems of celery seed purity identification were solved, enabling rapid and accurate seed purity identification.

CN121780744APending Publication Date: 2026-04-03TIANJIN ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511958261.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-23
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing methods for identifying the purity of celery seeds are time-consuming and labor-intensive, easily affected by environmental and human factors, and lack rapid and accurate molecular marker identification techniques.

Method used

The purity of the celery hybrid "Jinrui 48" was detected by PCR amplification and agarose gel electrophoresis using InDel molecular marker technology and specific primer QC-T17. Seed purity was determined by the co-dominant characteristic bands of the male and female parents.

Benefits of technology

It enables rapid, accurate, and environmentally unaffected seed purity identification in the laboratory, saving time and effort and improving identification efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780744A_ABST
    Figure CN121780744A_ABST
Patent Text Reader

Abstract

The invention discloses a method for identifying the purity of a celery Jinrui 48 hybrid by using an InDel molecular marker. An InDel primer in the invention can generate a male parent specific marker and a female parent specific marker, and has strong specificity; according to the method disclosed by the invention, the celery 'Jinrui 48' hybrid seeds can be distinguished from other hybrids and male and female parents, and the purity of the hybrid seeds can be rapidly detected; the detection method disclosed by the invention has the advantages of rapidness, accuracy, low cost, convenience in operation and the like, can replace a traditional hybrid seed purity identification method, and has a relatively high commercial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for identifying the purity of the celery hybrid "Jinrui 48" using InDel molecular markers. Background Technology

[0002] Celery (Apium graveolens var. dule) is a very important vegetable crop in my country, rich in nutrients and possessing various pharmacological effects, making it popular among consumers. "Jinrui 48" is a newly developed hybrid celery variety by the Vegetable Research Institute of the Tianjin Academy of Agricultural Sciences. It features a compact plant type, straight petioles, a long and thick first internode, a crisp and tender texture, neat and attractive leaves, rapid growth, and resistance to celery verticillium wilt.

[0003] Seeds are a crucial carrier of a variety, and the quality of a celery variety is primarily reflected in its seed quality. A key indicator of seed quality is purity. If purity does not meet national standards, even the best varieties will not exhibit the expected high yield and quality. Therefore, purity testing is essential before seeds are sold. The traditional method for celery seed purity testing is field plot planting, which involves observing the agronomic morphology of the varietal population to determine purity. This method is currently the most reliable for determining variety authenticity and purity, providing accurate and intuitive results. However, it is labor-intensive, time-consuming, and has a long testing period. Celery trial planting takes at least 60-70 days, and accurate testing requires more than 120 days. Furthermore, it is susceptible to environmental and human factors, and the observer's experience also limits the accuracy of the test. Therefore, developing a rapid and accurate method for seed purity testing has become a common concern for seed research institutions and enterprises.

[0004] Molecular markers are a DNA molecular genetic marker technology that has been developed in recent years. They have advantages such as codominant inheritance, high reliability, high repeatability, and rich polymorphism. Among them, InDel marker detection, as a mature molecular marker detection method, has been recommended by international organizations such as the International Seed Testing Association (ISTA) and the International Union for the Protection of New Varieties of Plants (UPOV) as a method for variety identification at the DNA level and has been widely used both domestically and internationally. However, there are currently very few reports and specific applications of using molecular marker technology for the identification of celery variety seed purity. In order to further improve the breeding efficiency of celery, it is necessary to develop a molecular marker purity identification technology for celery seeds. This invention focuses on the celery hybrid "Jinrui 48". Through genome resequencing and data analysis of parental materials, information on possible InDel sequence differences between parents was obtained. InDel primers were developed and screened as molecular markers for the purity identification of this variety, which can quickly and accurately complete the seed purity identification. Summary of the Invention

[0005] The first objective of this invention is to provide an InDel primer for identifying the purity of hybrid celery seed “Jinrui 48”, which can generate paternal-specific and maternal-specific markers with high specificity.

[0006] A second objective of this invention is to provide a method for identifying the purity of the celery hybrid "Jinrui 48" using InDel molecular markers. This method utilizes the aforementioned InDel primers to quickly, conveniently, accurately, and effectively identify the purity of the celery hybrid "Jinrui 48".

[0007] To achieve the above objectives, the following technical solution is adopted:

[0008] This invention provides a method for identifying the purity of the celery hybrid "Jinrui 48" using specific primers QC-T17, whose single-stranded DNA sequence from 5' to 3' is as follows:

[0009] Upstream primer QC-T17-F: 5'-GCCCTCATCTTATTACACCCTAAAATCC-3' (SEQ ID NO.1):

[0010] Downstream primer QC-T17-R: 5'-TGCTCGATCAAACAAGTTACAGG-3' (SEQ ID NO.2).

[0011] The method for detecting the purity of the celery hybrid "Jinrui 48" provided by this invention can be achieved through the following technical solution: Genomic DNA is extracted from the celery sample to be tested as a template, polymerase chain reaction (PCR) amplification is performed using the specific primers provided by this invention, and the amplified products are then separated and detected by agarose gel electrophoresis. The method includes the following steps:

[0012] (1) Extract DNA from any tissue or organ of the celery sample to be tested;

[0013] (2) Using celery genomic DNA as a template, PCR amplification was performed using the InDel primers described above to obtain the amplification product;

[0014] (3) The PCR amplification products obtained in step (2) were separated by agarose gel electrophoresis using gel electrophoresis.

[0015] (4) Observe the electrophoretic separation results using a gel imaging system and analyze the electrophoretic separation data. Seeds with co-dominant characteristic bands of the parents are identified as true hybrids, while those lacking any characteristic band of either the father or mother are recorded as false hybrids. Seed purity is calculated.

[0016] Preferably, the method for extracting DNA from the parent cauliflower and hybrid seeds in step (1) is the CTAB method.

[0017] Preferably, the PCR amplification reaction in step (2) uses a 10 μL reaction system, comprising: 5 μL of 2×PCRmix; 10 μmol / L of PCR amplification reaction mixture. -1 primers, 0.4 μL; 50 ng·μL -1 Genomic DNA, 1.5 μL; ddH2O, 3.1 μL. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 5 min.

[0018] The seed purity is calculated as follows: Seed purity = Number of true hybrids detected / Total number of seeds detected × 100%.

[0019] The length of the paternal codominant trait band is 205 bp, and its sequence is shown in SEQ ID NO.3. The length of the maternal codominant trait band is 183 bp, and its sequence is shown in SEQ ID NO.4.

[0020] The single-stranded DNA molecule shown in SEQ ID NO.3 or SEQ ID NO.4 above is located on chromosome CM020901.1 of the celery reference genome, or is a single-stranded DNA molecule with one or more nucleotides deleted, added, or mutated from the sequence and having the same function as the sequence.

[0021] Advantages of this invention:

[0022] 1) In the laboratory, the presence of false hybrids in the celery hybrid "Jinrui 48" seeds can be determined directly by detecting the PCR amplification products, which is time-saving, labor-saving and unaffected by the environment.

[0023] 2) Genomic DNA can be extracted from any tissue of celery, including seeds, and then the extracted DNA can be used as a template for separation by agarose gel electrophoresis and detection by a gel imaging instrument. This method is more convenient and faster than polyacrylamide gel electrophoresis and silver staining detection.

[0024] 3) This invention has good specificity, high accuracy, and short detection cycle. Attached Figure Description

[0025] Figure 1 The figures show specific electrophoretic bands obtained using the primers of this invention in samples of the parent and hybrid celery variety "Jinrui 48". In the figure, S212B represents the male parent of the hybrid celery variety "Jinrui 48", Y0111A represents the female parent of the hybrid celery variety "Jinrui 48", and the rest represent the hybrid celery variety "Jinrui 48". a / b / c / d / e represent 5 random samples.

[0026] Figure 2 The primers of this invention were used to detect specific electrophoretic bands obtained from the celery hybrid "Jinrui 48" for seed purity identification. S212B represents the male parent of the celery hybrid "Jinrui 48", 01-11 represent the female parent of the celery hybrid "Jinrui 48", and the remaining "1-40" represent the celery hybrid "Jinrui 48" (white arrows indicate fake celery hybrid samples). Detailed Implementation

[0027] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0028] As used throughout the specification and claims, the terms "comprising" or "including" are open-ended and should be interpreted as "comprising but not limited to". The following descriptions are preferred embodiments for carrying out the invention; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of the invention. The scope of protection of this invention is determined by the appended claims.

[0029] Material Specifications

[0030] Celery “Jinrui 48”: This is a celery material independently bred by the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences. It is consistent with the material KB-48 provided by the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences mentioned in the article “Qi Liping, Yan Damin, Yan Huiping, et al. Comparative Experiment of Hybrid Celery Varieties Resistant to Spring Seedling Death, Yangtze Vegetables, 2024(16):44-46”.

[0031] The male parent material S212B (original variety (line) name is Apollo) and the female parent material Y111A (original variety (line) name is Wangsheng, belonging to the celery CMS sterile line) are consistent with the materials mentioned in the article "Gao Guoxun, Wu Feng, Wang Wutai et al. Field identification of celery breeding materials leaf spot disease resistance, Tianjin Agricultural Sciences, 2021.27(7):20-23".

[0032] All the above materials were provided by the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences. The public can obtain them through purchase or donation. The materials are guaranteed to be sold for at least 20 years.

[0033] Example 1: Screening of Molecular Marker Primers

[0034] Based on celery genome information and resequencing data of celery materials, several primer pairs were designed and screened among the parents and F1 generation hybrids of the celery 'Jinrui 48' hybrid. Primer pair QC-T17 with co-dominant differential marker bands was obtained. Using this primer pair as specific primers, amplification was performed using genomic DNA from the male parent material S212B, the female parent material Y111A, and five hybrid plants as templates. The male parent material consistently amplified a 205bp band, the female parent material consistently amplified a 183bp band, and the hybrid materials consistently amplified both 205bp and 183bp bands. Figure 1 The marker exhibits good repeatability, with clear bands located at positions 308340756-3083407960 on chromosome CM020901.1 of celery. The primer pair QC-T17 sequence is as follows:

[0035] Upstream primer QC-T17-F: GCCCTCATCTTATTACACCCTAAAATCC (SEQ ID NO.1);

[0036] Downstream primer QC-T17-R: TGCTCGATCAAACAAGTTACAGG (SEQ ID NO.2);

[0037] The 205bp sequence is:

[0038]

[0039] The 183bp sequence is as follows:

[0040]

[0041] Example 2: Identification of the purity of the celery hybrid "Jinrui 48" using molecular markers.

[0042] Genomic DNA was extracted from the male parent material S212B, the female parent material Y11IA, and the leaves of the celery hybrid “Jinrui 48” using the CTAB method. The specific steps were as follows: 0.1g of young leaves were placed in a 1.5mL centrifuge tube, 50μL of 2% CTAB extraction buffer was added, the mixture was ground, and the volume was brought up to 400μL. The mixture was then incubated in a 65℃ water bath for 30min. 400μL of chloroform:isoamyl alcohol (24:1) was added and the mixture was gently shaken for 5min. Centrifuge at 12000 rpm for 5 min; take 200 μL of the supernatant, add 200 μL of pre-chilled isopropanol, mix well, and incubate at -20℃ for 20 min; centrifuge at 12000 rpm for 10 min; discard the supernatant, add 150 μL of pre-chilled ethanol, gently mix and wash, centrifuge at 10000 rpm for 5 min; discard the supernatant, air dry or blow dry; add 100 μL of distilled water to dissolve the DNA, and incubate at room temperature for 1 h; dilute the DNA to 50 ng / μL with distilled water, and use it as a PCR template or store it at -20℃ for later use.

[0043] Using the aforementioned genomic DNA as a template, PCR amplification of QC-T17 was performed using molecular marker-specific primers to obtain the amplification product. The reaction system consisted of 10 μL of: 5 μL of 2×PCR mix; 10 μmol·L⁻¹ PCR solution. -1 primers, 0.4 μL; 50 ng·μL -1 Genomic DNA, 1.5 μL; ddH2O, 3.1 μL.

[0044] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 570℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 5 min.

[0045] The PCR amplification products were separated by agarose gel electrophoresis, and the electrophoresis results were observed using a gel imaging system. Alternatively, a kit can be prepared using specific primers and other PCR components to identify whether the celery seeds being tested are from the celery hybrid variety "Jinrui 48". Seed purity was calculated using the following method:

[0046] Seed purity = Number of true hybrids detected / Total number of seeds detected × 100%.

[0047] Among them, the celery hybrid "Jinrui 48" could simultaneously amplify two bands, 205bp and 183bp, while the maternal material only amplified the 183bp band, and the paternal material only amplified the 205bp band. Molecular marker identification results showed that of the 40 materials to be identified, 39 amplified both 205bp and 183bp bands, indicating they were hybrids; one amplified only the 183bp band, which was a progeny obtained from self-pollination of the maternal material Y111A of celery "Jinrui 48," and was a false hybrid. Figure 2 ).

[0048] Example 3: Identification of the purity of the celery hybrid "Jinrui 48" using traditional field methods.

[0049] The celery material used in Example 1 was sown and raised into seedlings, then transplanted into the field and cultivated under normal management. After approximately 75 days, the material was compared with the male and female parent materials based on comprehensive traits such as leaf shape, leaf color, growth vigor, plant size, characteristics, and color to determine whether the material to be tested was a celery hybrid. The results obtained after multiple comparisons were as follows: out of 40 materials to be tested, 39 were hybrids; 1 plant had the same phenotype as the female parent material Y111A of celery “Jinrui 48”, indicating it was another hybrid offspring of the female parent material, not a “Jinrui 48” hybrid. This demonstrates that the results of detecting the purity of seed hybrids using the molecular markers of this invention are completely consistent with the field identification results. Therefore, the molecular markers of this invention can quickly and effectively identify the purity of the “Jinrui 48” hybrid.

[0050] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. The application of InDel molecular marker primers in identifying the purity of celery "Jinrui 48" hybrid seeds, characterized by: The InDel molecular marker primer sequences are as follows: Upstream primer QC-T17-F: 5'-GCCCTCATCTTATTACACCCTAAAATCC-3'; Downstream primer QC-T17-R: 5'-TGCTCGATCAAACAAGTTACAGG-3'.

2. A method for identifying the purity of hybrid celery seed "Jinrui 48", characterized in that: Includes the following steps: (1) Extract DNA from any tissue or organ of the celery sample to be tested; (2) Using celery genomic DNA as a template, PCR amplification was performed using the InDel molecular marker primers described in claim 1 to obtain the amplification product; (3) The PCR amplification products obtained in step (2) were separated by agarose gel electrophoresis using gel electrophoresis. (4) Observe the electrophoretic separation results using a gel imaging system and analyze the electrophoretic separation data. Hybrid seeds that simultaneously possess the dominant trait bands of both parents are identified as true hybrids. Seeds lacking either the trait band of the father or mother are classified as false hybrids, and their seed purity is calculated.

3. The method according to claim 2, characterized in that: The method for extracting DNA from the parent cauliflower and hybrid seeds in step (1) is the CTAB method.

4. The method according to claim 2, characterized in that: The PCR amplification reaction in step (2) specifically uses a 10 μL reaction system, including: 2×PCR mix, 5 μL; 10 μmol·L⁻¹ -1 primers, 0.4 μL; 50 ng·μL -1 Genomic DNA, 1.5 μL; ddH2O, 3.1 μL.

5. The method according to claim 2, characterized in that: The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ final extension for 5 min.

6. The method according to claim 2, characterized in that: The seed purity is calculated as follows: Seed purity = Number of true hybrids detected / Total number of seeds detected × 100%.

7. The method according to claim 2, characterized in that: The length of the paternal codominant trait band is 205 bp, and its sequence is shown in SEQ ID NO.

3. The length of the maternal codominant trait band is 183 bp, and its sequence is shown in SEQ ID NO.4.