Application of molecular marker in detection of corn ZmNDUFAF7 gene
By cloning the maize ZmNDUFAF7 gene and designing the SNP-ZmNDUFAF7 molecular marker, the problem of unclear mitochondrial complex I assembly factors in plants was solved, enabling rapid and accurate maize breeding assistance and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-20
- Publication Date
- 2026-04-03
AI Technical Summary
In the current technology, the assembly factors of mitochondrial complex I in plants have not been fully identified, resulting in an unclear assembly process of complex I, which affects maize kernel development and lacks effective molecular markers for assisted breeding.
By constructing F2 populations of wild-type maize inbred line W64A and grain defective material dek29, the ZmNDUFAF7 gene was cloned, and a molecular marker SNP-ZmNDUFAF7 was designed to detect the SNP site of the ZmNDUFAF7 gene. Gene types were distinguished by C/T single nucleotide differences. Primers and kits were provided for PCR amplification and enzyme digestion electrophoresis analysis.
It enables rapid, simple, and high-throughput molecular marker-assisted breeding of maize, accurately identifying the ZmNDUFAF7 genotype at any growth stage, helping to distinguish between normal and defective kernel development types, and supporting the breeding process.
Smart Images

Figure CN121780757A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant molecular marker technology, specifically relating to the application of molecular markers in detecting the maize ZmNDUFAF7 gene. Background Technology
[0002] Mitochondria are semi-autonomous organelles enclosed by a double membrane found in most eukaryotic cells, serving as the hub of cellular metabolism and energy metabolism. The mitochondrial respiratory chain, composed of respiratory transport proteins on the inner mitochondrial membrane, is a total electron transfer pathway that orderly transfers electrons removed from metabolites into oxygen, utilizing the energy generated during this process to produce ATP. Besides providing energy for the cell, mitochondria participate in processes such as cell differentiation, cellular signaling, and apoptosis, and have the ability to regulate the cell cycle and cell growth.
[0003] The mitochondrial respiratory chain is primarily composed of four high-molecular-weight membrane protein complexes: NADH: ubiquinone oxidoreductase (complex I), succinate dehydrogenase (SDH, complex II), cytochrome bc1 oxidoreductase (complex III), and cytochrome c oxidase (complex IV). Complex I accepts electrons from the Krebs cycle electron carrier nicotinamide adenine dinucleotide (NADH) and transfers them to coenzyme Q (ubiquinone), which also receives electrons from complex II. Next, coenzyme Q transfers electrons to complex III, which then continuously transfers electrons to cytochrome c (cyt c). Cyt c transfers electrons to complex IV, which uses electrons and hydrogen ions to reduce molecular oxygen to water. These four complexes work together to complete electron transfer and biological oxidation processes. They bind to ATP synthase (complex V) to ultimately complete oxidative phosphorylation (OXPHOS) to produce ATP.
[0004] Mitochondrial complex I, the rate-limiting enzyme in electron transfer, is the largest complex in the respiratory chain, with a total mass of approximately 1 MDa. Previous studies have shown that mitochondrial complex I in mammals and plants is a conserved L-shaped complex composed of peripheral arms and membrane arms. The peripheral arms consist of a apical N module and a basal Q module, embedded in the mitochondrial matrix. The N module is involved in NADH binding and oxidation, while the Q module is responsible for electron transfer to ubiquinone. The membrane arms embedded in the membrane contain the proton pump module (P module), which participates in proton transport. Corresponding to the proximal and distal ubiquinone binding sites, the P module further divides into P... P (Proximal) and P D (Distant) Module. In plants, complex I possesses a specific matrix-facing domain in which five carbonic anhydrases (CAs) have been identified. Therefore, this domain is termed the CA domain and is primarily involved in the assembly of Arabidopsis complex I.
[0005] Complex I consists of 45 and 49 subunits in mammals and plants, respectively. Fourteen core structural subunits are essential for the function of complex I and are highly conserved in all organisms containing complex I. In addition to the 14 core subunits, approximately 25 to 35 additional subunits are required for complex I assembly in different organisms. Complex I assembly proceeds in a multi-step, ordered manner. Besides the structural subunits of complex I, its assembly process requires a large number of assembly factors. Currently, fourteen different exogenous assembly factors have been identified, such as NDUFAF1-7, C3ORF1 / TIMMDC1, INDH / NUBPL, TMEM126B, ECSIT, ACAD9, FOXRED1, and AIF, for the assembly of complex I in mammals. Among them, NDUFAF3-7 is necessary for stabilizing complex I subunits or binding to assembly intermediates in the early stages of complex I assembly. NDUFAF1 / CIA30, C3ORF1 / TIMMDC1, TMEM126B, ECSIT, ACAD9, and INDH / NUBPL are associated with various membrane arm intermediates. NDUFAF2, FOXRED1, and AIF may be involved in the complete assembly or accumulation of complex I. Assembly factors play important roles in the biosynthesis of complex I. However, the exact roles of some assembly factors in the assembly process of complex I remain unclear.
[0006] Although 14 assembly factors of mammalian complex I are known, only four complex I assembly factors have been identified in plants to date: INDH, GLDH, CIAF1, and zNDUFAF1. INDH is a conserved iron-sulfur protein essential for the translation of the mitochondrial-encoded complex I subunit and for the assembly of complex I. In Arabidopsis, the lack of INDH leads to severe complex I deficiency, but accumulation of a 650 kDa subcomplex and trace amounts of 400 kDa and 450 kDa intermediates. GLDH, an enzyme involved in the ascorbic acid biosynthesis pathway, was initially identified as a complex I subunit. However, subsequent studies have shown that GLDH binds to 200 kDa, 470 kDa, and 800 kDa assembly intermediates, and may be a linker to P... P and P DThe CIAF1 domain is essential. CIAF1 interacts with the 23 kDa TYKY-1 matrix domain subunit of the Q module, potentially facilitating the insertion of the Fe-S cluster into this subunit. CIAF1 is essential for the assembly of the 1000 kDa complex I holoenzyme in Arabidopsis. zNDUFAF1, an ortholog of human NDUFAF-1 (CIA30), interacts with ZmTIM17-1 and ZmIVD1 to form an MCIA-like complex, essential for the assembly of the membrane arm module of maize mitochondrial complex I. Loss of zNDUFAF1 function severely affects the enzyme activity of mitochondrial complex I and maize kernel development. Besides the four assembly factors mentioned above, the assembly of complex I in plants likely depends on more yet-to-be-identified assembly factors. Several proteins with sequence similarity to known mammalian assembly factors have been identified in plant genomes. However, their roles in complex I assembly remain unclear and require experimental verification. Summary of the Invention
[0007] This invention cloned a novel gene, ZmNDUFAF7, encoding a maize mitochondrial respiratory chain complex I assembly factor, from an F2 population constructed using the wild-type maize inbred line W64A and the grain-deficient material dek29. Sequencing revealed that a single nucleotide polymorphism (SNP) at nucleotide 1369 of the ZmNDUFAF7 gene's open reading frame (OPF) severely affects the gene's function. Loss of ZmNDUFAF7 function impacts complex I assembly, complex I enzyme activity, and mitochondrial morphology and structure, ultimately leading to grain development defects. Furthermore, based on this single nucleotide polymorphism at nucleotide 1369 of the ZmNDUFAF7 gene's OPF, this invention designed a molecular marker to detect the SNP site in the maize ZmNDUFAF7 gene, which can be used for marker-assisted breeding in maize. This molecular marker can be easily, rapidly, and with high throughput applied to marker-assisted breeding practices in maize.
[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0009] This invention provides the application of the molecular marker SNP-ZmNDUFAF7 in detecting the ZmNDUFAF7 gene in maize, characterized in that the molecular marker SNP-ZmNDUFAF7 includes SNP sites;
[0010] In this invention, the nucleotide sequence fragment shown in SEQ ID NO.1 is the ZmNDUFAF7 gene type 1 nucleotide sequence, and the nucleotide sequence fragment shown in SEQ ID NO.2 is the ZmNDUFAF7 gene type 2 nucleotide sequence, and there is a C / T single base mutation between the two;
[0011] The molecular marker SNP-ZmNDUFAF7 is shown in SEQ ID NO.1 or SEQ ID NO.2;
[0012] SEQ ID NO.1:
[0013] GGCGGAATCATTGCGGACGGGCTACTGG C GACTGGTTGGAGACGGGGAAGCCCCGTTCTGGGAAGGCCCCGAGGACCAGGCGGCACCTGTTGGAATGGGCACCAGGTACTTGGCCTAGGCCATTGTCAACAAGAAGCAGGGCACGCCCATTCCGTTCGTGTGAGGGTCCGGCTCGGG;
[0014] SEQ ID NO.2:
[0015] GGCGGAATCATTGCGGACGGGCTACTGG T GACTGGTTGGAGACGGGGAAGCCCCGTTCTGGGAAGGCCCCGAGGACCAGGCGGCACCTGTTGGAATGGGCACCAGGTACTTGGCCTAGGCCATTGTCAACAAGAAGCAGGGCACGCCCATTCCGTTCGTGTGAGGGTCCGGCTCGGG;
[0016] The SNP site is located at nucleotide 1369 of the open reading frame of the maize ZmNDUFAF7 gene.
[0017] This invention also provides the application of the molecular marker SNP-ZmNDUFAF7 in establishing a molecular marker-assisted maize breeding system.
[0018] This invention also provides the application of the molecular marker SNP-ZmNDUFAF7 in detecting maize kernel traits.
[0019] This invention also provides the application of the molecular marker SNP-ZmNDUFAF7 in identifying the ZmNDUFAF7 gene type in maize.
[0020] This invention also provides the application of the molecular marker SNP-ZmNDUFAF7 in the conservation of maize germplasm resources.
[0021] This invention provides a pair of primers for amplifying the molecular marker SNP-ZmNDUFAF7, the nucleotide sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4;
[0022] SEQ ID NO.3:
[0023] GGCGGAATCATTGCGGACGGGCTACTGT;
[0024] SEQ ID NO.4:
[0025] CCCGAGCCGGACCCTCACTCGAACGGA.
[0026] The present invention also provides a kit for detecting SNP sites, the kit comprising the primers described above;
[0027] The SNP site is located at nucleotide 1369 of the open reading frame of the maize ZmNDUFAF7 gene.
[0028] This invention provides a method for predicting the developmental status of maize kernels, the method comprising the following steps:
[0029] (1) Extract genomic DNA from the maize plants to be tested;
[0030] (2) Using genomic DNA as a template, PCR amplification was performed using the above primers to obtain the amplification product;
[0031] (3) The amplification product was digested with Taq I restriction endonuclease to obtain the digested product;
[0032] (4) The enzyme digestion products were analyzed by agarose gel electrophoresis to obtain the detection results;
[0033] When the test results show that the main band is 149 bp, the maize plant under test is considered to be of the type with normal grain development.
[0034] When the test results show that the main band is 177 bp, the maize plant under test is considered to have defects in grain development.
[0035] In the actual operation of this invention, SEQ ID NO.1 is the sequence of SNP-ZmNDUFAF7 amplified in maize ZmNDUFAF7 gene type 1 (W64A normal grain development type), and SEQ ID NO.2 is the sequence of SNP-ZmNDUFAF7 amplified in maize ZmNDUFAF7 gene type 2 (dek29 grain development defect type). Both sequences consist of 177 nucleotides, but there is a C / T single nucleotide variation at nucleotide 29 of the 177 nucleotide fragment between the two. The PCR amplification products of SNP-ZmNDUFAF7 in ZmNDUFAF7 gene type 1 and type 2 were digested with Taq I (restriction site: TCGA) and then analyzed by 3% agarose gel electrophoresis. The results showed that the PCR product of ZmNDUFAF7 gene type 1 (W64A, normal grain development type) was digested with Taq I into 149 bp and 28 bp DNA fragments, mainly showing the 149 bp DNA band. The PCR product of ZmNDUFAF7 gene type 2 (dek29, grain development defect type) could not be digested with Taq I, showing a 177 bp DNA fragment. This SNP molecular marker is beneficial for identifying maize ZmNDUFAF7 gene types and establishing a marker-assisted breeding system, and can be applied simply, rapidly, and with high throughput in breeding practices.
[0036] This invention cloned a gene, ZmNDUFAF7, encoding an assembly factor for the maize mitochondrial respiratory chain complex I, from an F2 population constructed using the wild-type maize inbred line W64A and the grain development defective material dek29. Sequencing revealed a single nucleotide polymorphism (SNP) at nucleotide 1369 of the open reading frame (OPF) of the ZmNDUFAF7 gene, representing a C / T pair. The wild-type inbred line W64A has a C base, while the grain development defective material dek29 has a T base. Utilizing this SNP difference, we developed a molecular marker, SNP-ZmNDUFAF7, to detect the SNP at nucleotide 1369 of the ZmNDUFAF7 gene. The nucleotide compositions shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing were obtained by sequencing type 1 and type 2 SNP-ZmNDUFAF7 PCR amplified fragments, respectively. This marker allows for rapid, high-throughput identification of SNP sites on the ZmNDUFAF7 gene at any stage in maize candidate materials and can be used for marker-assisted breeding of maize.
[0037] Compared with existing technologies, the co-separated SNP molecular markers provided by this invention can distinguish between type 1 and type 2 of the ZmNDUFAF7 gene, and genotyping can be performed at any stage of maize growth and development. The bands of this SNP marker show significant differences, and the different types of the ZmNDUFAF7 gene can be clearly distinguished using 3.0% agarose gel electrophoresis. This method is accurate, time-saving, and labor-saving, and can be used for the detection of different types of the ZmNDUFAF7 gene in the process of marker-assisted breeding of maize. Attached Figure Description
[0038] Figure 1 Enzyme digestion electrophoresis image (3% agarose gel) of PCR amplification products of molecular marker SNP-ZmNDUFAF7 in homozygous mutant and wild-type homozygous materials of maize W64A, dek29 and F2 populations.
[0039] In the figure, P1 represents the wild-type W64A with grain development; P2 represents the dek29 with grain development defects; "-" represents the ddH2O control; 1-10 represent 10 different homozygous mutant genotypes in the F2 population obtained by crossing dek29 with W64A; 11-15 represent 5 different homozygous wild-type genotypes in the F2 population obtained by crossing dek29 with W64A. Detailed Implementation
[0040] The present invention will be further described in detail below with reference to specific embodiments. These embodiments are only for explaining the present invention and are not intended to limit the scope of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used are commercially available unless otherwise specified. Conditions should be as described in Molecular Cloning (Molecular Cloning: A Laboratory Manual, edited by Sambrook, New York: Cold Spring Harbor Laboratory Press, 1989) or Plant Molecular Biology – A Laboratory Manual (edited by Melody S. Clark, Springer-verlag Berlin Heidelberg, 1997), or as recommended by the manufacturer.
[0041] Example
[0042] 1. Phenotypic analysis of mutants and wild types
[0043] This study used a seed development defective material, dek29. Homozygous dek29 seeds were significantly smaller and softer; the seed coat was whitish and wrinkled with a collapsed apex; the endosperm was reduced and opaque, and its 100-seed weight was only 23% of the wild type. The dek29 mutant embryo was small and developmentally delayed, but it could slowly catch up with the wild type in later stages of development. Furthermore, the mutant embryo had intact tissues with all organs present and no defects. Transmission electron microscopy results showed that the dek29 mutant seeds had less starch and protein bodies in their cells, delayed development, and significantly larger cells.
[0044] 2. Construction and genetic analysis of the ZmNDUFAF7 gene mapping population
[0045] Using maize inbred line W64A as the genetic background, F1 seeds were obtained by crossing dek29 with W64A. After self-pollination of the F1 generation, an F2 population exhibiting phenotypic segregation was obtained. The number of normal kernels and developmentally defective kernels in the F2 population was counted, and the segregation ratio was determined to be approximately 3:1, consistent with the inheritance pattern of mutant traits controlled by a single recessive nuclear gene. This indicates that the kernel developmental defect phenotype of dek29 is controlled by a single recessive nuclear gene.
[0046] 3. Genomic DNA extraction
[0047] Total DNA was extracted from leaves of individual plants in the W64A, dek29, and F2 segregating populations using the TPS method. The method was as follows:
[0048] (1) Soak mature seeds in ddH2O for 30 min to soften the seed coat. Use a blade to cut off part of the endosperm with the seed coat removed, put it into a 2.0 mL centrifuge tube, add 300 μL of TPS extraction solution and a sterilized steel ball.
[0049] (2) Place the centrifuge tube on the tissue homogenizer and vibrate at a frequency of 30 Hz for 1 min. Invert the tubes and repeat once.
[0050] (3) Remove the centrifuge tubes and place them in a 65 ℃ oven for 10 min;
[0051] (4) Centrifuge at 12000 rpm for 15 min, and transfer the supernatant to a clean 1.5 mL centrifuge tube;
[0052] (5) Add 0.7 times the volume of isopropanol, place at −20 °C, and let stand for 2 min;
[0053] (6) Centrifuge at 12000 rpm for 10 min, discard the supernatant, add 1 mL of 70% ethanol, invert and wash the precipitate, centrifuge at 12000 rpm for 1 min, discard the supernatant, and repeat twice;
[0054] (7) Allow the precipitate to air dry at room temperature, then add 20 μL of 1×TE buffer containing 0.1 mg / mL RNase and dissolve the DNA in a 37°C oven. Store the dissolved DNA sample at -20°C for later use.
[0055] 4. Coarse localization of the dek29 gene
[0056] The F2 generation seed population obtained by crossing dek29 with W64A was subjected to 3000 microarray analysis. The microarray analysis results roughly mapped the dek29 gene to a physical region of 119.5 Mbp on chromosome 8, from 37.412 Mbp to 156.906 Mbp.
[0057] 5. Development of molecular markers based on maize genome resequencing
[0058] 227 primer pairs were designed and developed using the reference sequence of maize B73 (http: / / www.maizeGDB.org). Using dek29 and W64A DNA as templates, these 227 SSR primer pairs were polymorphically screened, yielding 22 polymorphic primer pairs. These polymorphic primers were used for fine mapping of the dek29 gene.
[0059] 6. Fine mapping of the dek29 gene
[0060] By combining single-kernel exchanges from a population of 3900 accessions (1900 mutant kernels and 2000 wild-type kernels from F2 and F3 generations of dek29), the candidate genes for the dek29 mutant were narrowed down to a 728 kb region between molecular markers N-3 and K-18. Using information from the maizeGDB database, we identified 15 genes within this 728 kb region. Transcriptional analysis revealed that 4 of these genes were not expressed in maize kernels, while the remaining 11 genes showed no difference in transcriptional expression between the wild-type and dek29 mutants. Sequencing analysis showed that 9 of the 11 genes expressed in maize kernels exhibited no sequence differences in the CDS region; therefore, the 4 non-expressed genes and the 9 genes with no sequence differences in the CDS region could be excluded. In two genes with sequence differences in the CDS region, a 6 bp deletion was found in the CDS region of Gene6. However, comparison of cDNA sequencing results from multiple strains showed that this site was not conserved, and insertions or deletions were also found in other wild-type inbred lines. In another gene, Gene16 (Zm00001d011245), a single nucleotide difference of C (cytosine) to T (thymine) occurred at nucleotide 1369 of its open reading frame. For details, please refer to the marker in the sequence shown in SEQ ID NO.1 or SEQ ID NO.2. This single nucleotide difference caused the codon CGA, which originally encoded arginine, to mutate into the stop codon TGA. This mutation caused the translation of the protein to be prematurely terminated at amino acid 457.
[0061] 7. Dek29 gene confirmation analysis
[0062] To confirm that Gene16 (Zm00001d011245) is indeed the candidate gene for dek29, we constructed a functional complementation vector and performed transgenic functional complementation verification. Using EcoRI and HindIII as end enzyme sites, we cloned the 2.0 kb promoter region upstream of Zm00001d011245. Then, using BamHI and PstI as end enzyme sites, we cloned the 1.5 kb full-length CDS fragment of the Zm00001d011245 gene. After sequencing confirmation, the promoter and CDS fragments were ligated into the functional complementation vector pHB, respectively. The sequenced and correct functional complementation vector was transformed into Agrobacterium competent cells, and the positive clone of Agrobacterium was used to infect the maize inbred line pBpA. After obtaining the T0 generation with positive transgenic identification, these mature plants were crossed with ears from dek29 heterozygous plants to obtain the F1 generation. Self-pollination of the F1 generation yielded the F2 generation with phenotypic segregation. Genotyping of F2 generation transgenic kernels was performed. Kernels with wild-type homozygous genotype - transgenic negative, mutant homozygous genotype - transgenic positive, and mutant homozygous genotype - transgenic negative were selected and germinated in vermiculite under 25 ℃ maize light incubator conditions with regular watering. Phenotyping was observed after 12 days. Results showed that the phenotype of the mutant homozygous genotype - transgenic positive seedlings was basically identical to that of the wild-type homozygous genotype - transgenic negative seedlings, with similar plant height and number of lateral roots. However, the mutant homozygous genotype - transgenic negative seedlings differed significantly from the former two, indicating that the transgenic seedling phenotype had largely been corrected. In addition to the significant phenotypic correction in seedlings, the phenotype of the transgenic maize kernels also showed significant correction. Externally, the endosperm size and embryo size were not significantly different from the wild type. Genotyping confirmed that these were mutant homozygous genotype - transgenic positive kernels, indicating that the transgenic maize kernels also showed significant phenotypic correction. The above results confirm that Gene16 (Zm00001d011245) is the dek29 gene we wanted to clone. Bioinformatics analysis shows that Dek29 encodes an S-adenosyl-L-methionine (SAM)-dependent methyltransferase, which is a direct homolog of human NDUFAF7. Therefore, we named it ZmNDUFAF7.
[0063] 6. Development and identification of molecular markers for detecting SNP sites in the maize ZmNDUFAF7 gene
[0064] A single nucleotide difference (C-T) occurs at nucleotide 1369 of the open reading frame of the ZmNDUFAF7 gene between wild-type materials with normal grain development and mutant materials with grain development defects. Based on this nucleotide difference, a molecular marker for detecting the SNP site in the maize ZmNDUFAF7 gene was developed and named SNP-ZmNDUFAF7.
[0065] The SNP-ZmNDUFAF7 primers (specific sequences shown in SEQ ID NO.3 and SEQ ID NO.4) were used to amplify the W64A and dek29 genomic DNA by PCR. The PCR amplification reaction system was as follows:
[0066] Genomic DNA 5 ng, primers 0.2 µmol / L, dNTPs 200 µmol / L, 1× buffer, 0.25 U GXL DNA polymerase, total reaction volume 10 µL, made up to the nearest 10 µL with dd H2O. Amplification program: 95 ℃ for 150 s; 35 cycles: 95 ℃ for 15 s, 60 ℃ for 15 s, 72 ℃ for 15 s; 72 ℃ for 300 s.
[0067] The amplified PCR product was digested with Taq I (with TCGA as the restriction site). The digestion reaction system was as follows:
[0068] 8 µL of PCR product, 0.5 U of Taq I restriction enzyme, 1× enzyme digestion buffer, total reaction volume 10 µL, make up the difference with dd H2O if necessary.
[0069] After 2 h of enzyme digestion, 1 μL of loading buffer was added to the digestion product, mixed well, and then 3 μL of the digestion product was analyzed by 3% agarose gel electrophoresis.
[0070] The PCR product of ZmNDUFAF7 gene type 1 (W64A normal grain development type) was digested with Taq I into 149 bp and 28 bp DNA fragments, mainly showing a 149 bp DNA band; the PCR product of ZmNDUFAF7 gene type 2 (dek29 grain development defect type) could not be digested with Taq I and showed a 177 bp DNA fragment.
[0071] DNA from homozygous mutant and wild-type seeds obtained by crossing dek29 with W64A was amplified by PCR, digested with enzymes, and analyzed by electrophoresis using SNP-ZmNDUFAF7 primers. The results showed that the developmentally defective seeds all showed a 177 bp electrophoretic band of the dek29 mutant type (type 2), while the normally developing seeds all showed a 149 bp electrophoretic band of the W64A wild type (type 1).
[0072] The SNP molecular markers of this invention have high stability and can rapidly and with high throughput detect SNP sites of the maize ZmNDUFAF7 gene at any stage of candidate materials, thereby distinguishing between the two types of the maize ZmNDUFAF7 gene.
[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description and ideas, and it is neither necessary nor possible to exhaustively describe all implementation methods here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.
Claims
1. Molecular marker SNP-ZmNDUFAF7 in the detection of maize ZmNDUFAF7 Applications in genes, characterized by, The molecular marker SNP-ZmNDUFAF7 includes SNP sites; The molecular marker SNP-ZmNDUFAF7 is shown in SEQ ID NO.1 or SEQ ID NO.2; The SNP site is located in maize. ZmNDUFAF7 At nucleotide 1369 of the gene's open reading frame.
2. Application of molecular marker SNP-ZmNDUFAF7 in establishing a molecular marker-assisted maize breeding system.
3. Application of molecular marker SNP-ZmNDUFAF7 in detecting maize kernel traits.
4. Molecular marker SNP-ZmNDUFAF7 in the identification of maize ZmNDUFAF7 Applications in gene types.
5. Application of molecular marker SNP-ZmNDUFAF7 in maize germplasm resource conservation.
6. A pair of primers for amplifying the molecular marker SNP-ZmNDUFAF7, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO.3 and SEQ ID NO.
4.
7. A kit for detecting SNP sites, characterized in that, The kit includes the primers as described in claim 6; The SNP site is located in maize. ZmNDUFAF7 At nucleotide 1369 of the gene's open reading frame.
8. A method for predicting the developmental status of maize kernels, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the maize plants to be tested; (2) Using genomic DNA as a template, PCR amplification is performed using the primers described in claim 6 to obtain the amplification product; (3) The amplification product was digested with Taq I restriction endonuclease to obtain the digested product; (4) The enzyme digestion products were analyzed by agarose gel electrophoresis to obtain the detection results; When the test results show that the main band is 149 bp, the maize plant under test is considered to be of the type with normal grain development. When the test results show that the main band is 177 bp, the maize plant under test is considered to have defects in grain development.