Beauveria bassiana QZ and application thereof

Abstract

The invention relates to the technical field of microorganisms, in particular to beauveria bassiana QZ and application thereof. The collection number of the beauveria bassiana QZ is GDMCC No: 66669. The beauveria bassiana QZ provided by the invention has strong pathogenicity to coffee berry bark beetles, the strain is modified to express and deliver double-stranded RNA-dsDorsal, the pathogenicity is stronger, laboratory data shows that the fatality rate is almost 100% within 8 days, and the lethal ability is improved by 20% compared with that of a non-transgenic strain.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to Beauveria bassiana QZ and its applications. Background Technology

[0002] The coffee berry borer (Hypothenemus hampei Ferrari), abbreviated as CBB, is a pest that primarily damages coffee plants. It is the most serious pest in the world's major coffee-producing regions, with its invasion found in over 70 coffee-growing countries and regions globally. It causes approximately $500 million in economic losses to the global coffee industry annually, affecting the income of over 20 million rural households. In my country, the coffee berry borer was first confirmed to be damaging coffee plants in Xinglong area of ​​Wanning City, Hainan Province in June 2019; in November 2022, it was also found to be infesting coffee plants in Dehong Prefecture, Yunnan Province. Currently, this insect has spread to major coffee-growing areas in my country, including Wanning, Chengmai, Qiongzhong, and Baisha in Hainan Province, and Dehong in Yunnan Province, posing a significant threat to the sustainable development of my country's coffee industry.

[0003] Currently, production mainly relies on chemical pesticides to control coffee bark beetles. However, chemical pesticides not only lead to pesticide resistance in pests but also pollute the environment and disrupt the ecological balance. Beauveria bassiana, as an important biological control fungus, is widely used in pest control. Biological control technology has advantages such as high specificity, sustainability, low resistance to pesticides, harmlessness to humans and animals, and environmental friendliness. To protect the ecological environment and ensure the safety and quality of agricultural products, biological control technology has been widely applied to the control of various crop pests as a new pest control strategy and is receiving increasing attention.

[0004] However, insects' innate immune systems possess a certain degree of disease resistance, which weakens the pathogenicity and infectivity of Beauveria bassiana. Currently, most transgenic Beauveria bassiana strains kill insects primarily by expressing and secreting toxic substances, a method similar to chemical pesticides, which may ultimately lead to resistance issues. Summary of the Invention

[0005] In view of this, the present invention provides *Beauveria bassiana* QZ and its application. The present invention provides *Beauveria bassiana* QZ and its application in controlling the coffee berry borer. The strain is highly pathogenic to the coffee berry borer. The strain was modified to express and deliver double-stranded RNA-dsDorsal, resulting in even stronger pathogenicity. Laboratory data show that the mortality rate is almost 100% within 8 days, which is 20% higher than the non-transgenic strain.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides Beauveria bassiana QZ, with accession number GDMCC No: 66669.

[0008] In some specific embodiments of the present invention, the ITS sequence of the Beauveria bassiana QZ is shown in SEQ ID NO.3.

[0009] The present invention also provides a recombinant strain, which is obtained by inhibiting the expression of the Dorsal gene on the basis of the aforementioned Beauveria bassiana QZ strain.

[0010] In some specific embodiments of the present invention, the nucleotide sequence of the Dorsal has:

[0011] (I) A nucleotide sequence as shown in SEQ ID NO. 6; or

[0012] (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I), and which has the same or similar function to the nucleotide sequence shown in (I); or

[0013] (III) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (I) or (II).

[0014] The present invention also provides a method for constructing the recombinant strain, which involves suppressing the expression of the Dorsal gene by introducing a recombinant expression vector containing the dsDorsal coding sequence based on the Beauveria bassiana QZ strain.

[0015] Preferably, the recombinant expression vector containing the dsDorsal coding sequence includes the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF vector;

[0016] The RNAi expression cassette in the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF vector has the following characteristics:

[0017] (I) A nucleotide sequence as shown in SEQ ID NO.9; or

[0018] (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I), and which has the same or similar function to the nucleotide sequence shown in (I); or

[0019] (III) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (I) or (II).

[0020] Preferably, the construction method includes the following steps:

[0021] Step 1: Transform the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF vector into Agrobacterium to obtain Agrobacterium carrying the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF plasmid;

[0022] Step 2: The Agrobacterium carrying the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF plasmid infects the Beauveria bassiana QZ.

[0023] Step 3: Screen for positive transformants to obtain the recombinant strain.

[0024] This invention also provides the application of any of the following in controlling the coffee berry borer:

[0025] (I) the aforementioned Beauveria bassiana QZ; and / or

[0026] (II) The recombinant strains described above; and / or

[0027] (III) The recombinant strain obtained by the construction method.

[0028] Preferably, the coffee bark beetle includes the adult coffee bark beetle.

[0029] This invention also provides a microbial inoculant, comprising any of the following and / or their conidia:

[0030] (I) the aforementioned Beauveria bassiana QZ; and / or

[0031] (II) The recombinant strains described above; and / or

[0032] (III) The recombinant strain obtained by the construction method.

[0033] Preferably, the microbial agent also includes pesticide-acceptable excipients.

[0034] This invention includes, but is not limited to, the following beneficial effects:

[0035] This invention provides a Beauveria bassiana strain QZ and constructs a transgenic Beauveria bassiana capable of expressing and delivering double-stranded RNA (dsRNA) targeting a key gene in the immune system of the coffee berry beetle. Using RNA interference (RNAi) technology, the Dorsal gene of the coffee berry beetle is silenced, thereby weakening its Toll innate immune system and enhancing the pathogenicity of Beauveria bassiana. Furthermore, silencing the Toll innate immune pathway in the coffee berry beetle can also provide other naturally occurring pathogens with more opportunities for infection and pathogenicity, thus achieving a more efficient pest control effect.

[0036] Biological Preservation Instructions

[0037] Biological material: Beauveria bassiana QZ, classified and named Beauveria bassiana, deposited on July 14, 2025 at Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, with accession number GDMCC No: 66669.

[0038] The strain QZ described in this invention is the strain with the accession number GDMCC No: 66669. Attached Figure Description

[0039] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0040] Figure 1 Image A shows the infection of coffee berry beetle by strain QZ; Image B shows the front view of the colony; Image C shows the morphological characteristics of the spores; Image D shows the phylogenetic tree analysis.

[0041] Figure 2 A shows the lethality of Beauveria bassiana; B shows the upregulation of Dorsal expression in coffee bark beetle induced by Beauveria bassiana.

[0042] Figure 3 A shows the activation of the Toll pathway after infection by strain QZ; B shows the silencing of the Dorsal gene after three days of feeding with dsDorsal; C shows the mortality rate of coffee bark beetles after feeding with dsDorsal and strain QZ.

[0043] Figure 4 The pCAMBIAI1303-BbGPD-bar-Bbgpd-RNAi-BbTEF map is shown.

[0044] Figure 5 Lane A shows lanes 1-8: identification of transformants 1-8; Lane 9: trans 2K plus II DNA marker; Lane B shows lane 6: second-round PCR identification and sequencing.

[0045] Figure 6 This study compares the lethality rates of transgenic Beauveria bassiana with those of non-transgenic Beauveria bassiana. Detailed Implementation

[0046] This invention discloses Beauveria bassiana QZ and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0047] The purpose of this invention is to isolate a Beauveria bassiana strain that is lethal to the coffee bark beetle from its body surface and to modify it by transfecting it with double-stranded dsRNA. This modified strain delivers the double-stranded RNA of the coffee bark beetle's immune gene Dorsal, inhibiting the Toll immune pathway and reducing the expression of antimicrobial peptides, thereby enhancing its pathogenicity. This invention can be widely used for the prevention and control of the coffee bark beetle.

[0048] Based on existing research, this invention collected coffee bark beetles from a coffee base in Qiongzhong City, Hainan Province, and isolated and purified the strain on PDA medium. The strain was identified as *Beauveria bassiana* QZ using morphological and molecular biological methods. Furthermore, this invention cultured the QZ strain and determined its pathogenicity to the coffee bark beetle; the lethality after 10 days was 100%. The study also detected a significant increase in the mRNA transcription level of the *Dorsal* gene in the coffee bark beetle after inoculation with this strain, indicating that the strain can activate the Toll immune pathway.

[0049] The present invention has achieved the following beneficial effects:

[0050] 1. A strain of Beauveria bassiana QZ was provided;

[0051] 2. The bacterium was modified to express and deliver double-stranded RNA-dsDorsal;

[0052] 3. The strain is highly pathogenic to coffee bark beetle, and the modified strain is even more pathogenic. Laboratory data shows that the mortality rate is almost 100% within 8 days, which is 20% higher than that of the non-transgenic strain. This invention is the first transgenic strain for the control of coffee bark beetle.

[0053] Unless otherwise specified, the Beauveria bassiana QZ provided by this invention and the raw materials and reagents used in its application can all be purchased from the market.

[0054] The present invention will be further illustrated below with reference to the embodiments:

[0055] Example 1: Isolation, Identification, and Transgenic Line Construction of Beauveria bassiana

[0056] (1) Isolation and purification of strains

[0057] Coffee bark beetles were collected from a coffee plantation in Qiongzhong City, Hainan Province in 2024. The insects were sterilized by immersing them in 75% ethanol for 30 seconds, then placed on PDA agar plates containing 0.5% chloramphenicol and incubated at 28°C for 2–3 days. After mycelia grew around the insects, the outer mycelia were picked and inoculated into new PDA plates. This process was repeated 3–5 times until a purified strain QZ was obtained. The purified strain QZ was then transferred to slant agar plates containing PDA and incubated at 28°C for 7–15 days. After a large number of conidia were produced, the strain was stored at 4°C.

[0058] (2) Strain identification

[0059] The colonies of strain QZ on PDA medium had a fluffy texture, were milky white on the front and pale yellow on the back, and developed central wrinkles in the later stages of colony growth. Microscopic observation revealed that the conidiophores of strain QZ were clustered on conidiophores, which were spike-like and extended upwards to form a curved conidiophore axis. The conidia were transparent, round or oval, with thin walls and a smooth surface. Preliminary identification suggested a genus *Beauveria*. Using ITS identification primers ITS1 (5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO.1) / ITS4 (5'-TCCTCCGCTTATTGATA-3', SEQ ID NO.2), total DNA was amplified, followed by BLAST alignment and phylogenetic tree construction. The results showed that the ITS sequence showed over 99% homology with *Beauveria bassiana* and 100% coverage with strain BebaHA22A02, with a homology as high as 99%. Figure 1 Therefore, strain QZ was ultimately identified as *Beauveria bassiana* and deposited at the Guangdong Provincial Microbial Culture Collection Center, with the number GDMCC No. 66669.

[0060] The ITS sequence (SEQ ID NO.3) of strain QZ:

[0061] 5'--3'

[0062] (3) Pathogenicity test

[0063] Mature spores were collected from Beauveria bassiana culture medium, rinsed with sterile water, and then prepared into a solution of 1.0 × 10⁻⁶ spores. 8 The concentration of spores was kept uniform and met experimental requirements (CFU / mL). Infection was achieved by direct contact with the spore suspension, with adult coffee bark beetles immersed in the suspension for 2 minutes (control group immersed in sterile water for 2 minutes). The treated insects were cultured at 25°C and 60% humidity. Infection symptoms were observed every 24 hours, and the time of death was recorded to calculate the mortality rate. Results are as follows: Figure 2As shown in Figure A, the survival rate of coffee berry beetles inoculated with this Beauveria bassiana was 0% after 10 days, while the survival rate of the control group inoculated with sterile water was 80%. Three coffee berry beetles were used as a group, and RNA was extracted using the Trazol method and reverse transcribed. Dorsal qPCR primer sequences (qdorsal-F / R: 5´-CACACACGATTCCCATGTGC-3´, SEQ ID NO.4 / 5´-TCCGGATCAGAACGGCAAAA-3´, SEQ ID NO.5) were designed on the NCBI website. RT-qPCR detection was performed under the following conditions. The results showed that this lethal Beauveria bassiana could induce activation of the Toll pathway in coffee berry beetles.

[0064] Table 1 RT-qPCR detection conditions

[0065]

[0066] Example 2: Construction of dsDorsal transgenic lines

[0067] (1) Target screening

[0068] Coffee beetle in OD 600 The beetles were fed with a 2.0 μg / mL Beauveria bassiana spore suspension for 2 min, followed by feeding. The control group was fed with ddH2O for 2 min, followed by feeding. After three days, 50 surviving beetles were sent for transcriptome sequencing. Results showed that the Toll pathway was significantly activated in Beauveria bassiana infection, with elevated levels of the key transcription factor Dorsal. Figure 3 (A). Feeding *Bark beetle* with a 0.01 mmol sucrose solution containing 500 ng / µl of dsDorsal (whose target sequence is the RNAi sequence shown in SEQ ID NO. 7) for 3 days resulted in the most significant decrease in Dorsal transcription levels. Figure 3 (B) Feeding with dsDorsal (500 ng / µl) and strain QZ (1.0 × 10⁻⁶) 8 Four days after exposure to a fungal spore mixture containing CFU / ml, all coffee berry borers died. Figure 4 The results (C) indicate that inhibition of Dorsal can promote the pathogenicity of Beauveria bassiana, therefore Dorsal was selected as the target gene.

[0069] Coffee bark beetle Dorsal sequence (SEQ ID NO.6):

[0070]

[0071] (2) Construction of transgenic lines delivered with dsRNA

[0072] Agrobacterium-mediated transformation of pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF vector

[0073] 1) Take LBA4404 competent cells stored at -80℃ and place them on ice for a short time until they partially melt and are in an ice-water mixture state, then insert them into ice.

[0074] 2) Add 0.1 μg of plasmid DNA (pCAMBIAI1303-BbGPD-bar-Bbgpd-RNAi-BbTEF, plasmid map as shown) to 100 μl competent cells. Figure 4 As shown), mix thoroughly by stirring the bottom of the tube with your hand, and then place it on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes in sequence.

[0075] 3) Add 700 μl of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2-3 hours.

[0076] 4) Centrifuge at 6000 rpm for 1 min to collect the bacteria. Take about 100 μl of supernatant, gently pipette and resuspend the bacterial block, and spread it on LB agar plates containing the corresponding antibiotics (50 μg / ml kanamycin, 20 μg / ml rifampin). Invert the plates and incubate them at 28℃ for 2-3 days.

[0077] 5) Pick positive clones and add them to 10 ml LB medium (50 μg / ml kanamycin, 20 μg / ml rifampin), and incubate at 28°C with shaking until OD. 600 At approximately 0.8, the bacterial cells were collected by centrifugation, and resuspended in 10 ml of PDB (As 20 mg / L) to obtain Agrobacterium tumefaciens culture carrying the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF plasmid.

[0078] Agrobacterium infection of Beauveria bassiana

[0079] 1) Punch holes in Beauveria bassiana QZ and inoculate it into potato dextrose agar (PDA) medium. Incubate at 25°C until the mycelium covers the entire plate (multiple inoculation points reduce incubation time).

[0080] 2) Obtain fresh mycelium by punching holes, and add the mycelium to the Agrobacterium tumefaciens culture carrying the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF plasmid prepared in the previous step, and co-culture at 25℃ for 48h.

[0081] 3) After co-culturing, blot off excess Agrobacterium on sterile filter paper and spread evenly onto a PDA plate containing 500 μg / ml glufosinate and 200 μg / ml cephalosporin. Incubate at 25°C until the mycelium begins to show obvious extension, approximately 2-3 weeks.

[0082] 4) Transfer the resistant colonies to fresh PDA plates containing 500 μg / ml glufosinate and 200 μg / ml cephalosporin and incubate at 30°C.

[0083] T-DNA integration verification

[0084] 1) Take a portion of the resistant transformant hyphae, grind them with liquid nitrogen, and extract the tissue genomic DNA.

[0085] 2) Primer design and synthesis

[0086] Table 2 Primer Sequences

[0087]

[0088] 3) Screening and identification: The target bands in lane 6 were recovered and sequenced using BbTEF-YZR. Comparative analysis confirmed that transformants 6, 7, and 8 were positive transformants, capable of detecting the Dorsal sequence (…). Figure 5 (A). The suspected positive transformant in lane 6 was identified by a second round of PCR using primers ITS1 and ITS4, and lanes 6, 7, and 8 were further confirmed as positive transformants. Figure 5 (B)

[0089] RNAi sequence (SEQ ID NO.9):

[0090] CCATCATATGCCTTTGGCTTTGTTATCAGTTTATGCAAGAACAAACTATGAACGTTACCATTAAAATTGTTTAGTCTAACTGACTGATGTTTTTTGGGAGTGGATGTTATTGGATGGTGAAGTGGAAGTAGCCCCATCATTCAATGATGCATTACACTCTGGAATGATGCACTG CGGTGAAATTGATGCAATCGGTGTCAAATTTTCATGTATAAAACTTTGATTGGCCATTGCATAATCTACATAAGGGGACATATTTAGAACCATATGTTTGAAAATTTCGATAACTTACCGCTGGGTTGCATTTCGAATGGATCTAAAGTTAACATTTGGTTTACGTCCACTGTCTGG

[0091] (3) Silencing effect and pathogenicity detection of transgenic lines

[0092] Both the QZ strain and the dsDorsal strain were treated with 1.0 × 10⁻⁶. 8 CFU / mL was inoculated into coffee bark beetles, and survival was recorded every 12 hours. The final results showed that all non-transgenic strains died after 10 days, while all dsDorsal transgenic strains died within 8 days. This result indicates that the pathogenicity of the transgenic strain was increased by 20%. Figure 6 A). Simultaneously, recently deceased insect bodies were collected, and qRT-PCR was used to detect the ITS levels of *Beauveria bassiana* as a measure of its infection and proliferation level. The transcription of *Dorsal* was also examined. Results showed that the proliferation level of *Beauveria bassiana* transgenic with *dsDorsal* was significantly higher than that of non-transgenic *Beauveria bassiana*, and the mRNA transcription level of *Dorsal* in *Coffee Beetle* was significantly lower than that in *Coffee Beetle* infected with non-transgenic strains. Figure 6 B). This indicates that Beauveria bassiana transgenic with dsDorsal can effectively inhibit the activation of Dorsal, helping it to replicate and proliferate, thus enhancing its pathogenicity.

[0093] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Beauveria bassiana QZ, characterized in that, Its accession number is GDMCC No: 66669.

2. A recombinant strain, characterized in that, The recombinant strain was obtained by inhibiting the expression of the Dorsal gene on the basis of Beauveria bassiana QZ as described in claim 1.

3. The recombinant strain according to claim 2, characterized in that, The nucleotide sequence of the Dorsal has: (I) A nucleotide sequence as shown in SEQ ID NO. 6; or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I), and which has the same or similar function to the nucleotide sequence shown in (I); or (III) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (I) or (II).

4. The method for constructing the recombinant strain as described in claim 2 or 3, characterized in that, Based on the Beauveria bassiana QZ as described in claim 1, the expression of the Dorsal gene is suppressed by introducing a recombinant expression vector containing the dsDorsal coding sequence.

5. The construction method as described in claim 4, characterized in that, The recombinant expression vector containing the dsDorsal coding sequence includes the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF vector; The RNAi expression cassette in the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF vector has the following characteristics: (I) A nucleotide sequence as shown in SEQ ID NO.9; or (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I), and which has the same or similar function to the nucleotide sequence shown in (I); or (III) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (I) or (II).

6. The construction method as described in claim 4 or 5, characterized in that, Includes the following steps: Step 1: Transform the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF vector into Agrobacterium to obtain Agrobacterium carrying the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF plasmid; Step 2: The Agrobacterium carrying the pCAMBIA1303-BbGPD-bar-Bbgpd-RNAi-BbTEF plasmid infects Beauveria bassiana QZ as described in claim 1; Step 3: Screen for positive transformants to obtain the recombinant strain.

7. Any of the following applications in controlling the coffee berry borer: (I) Beauveria bassiana QZ as described in claim 1; and / or (II) The recombinant strain as described in claim 2 or 3; and / or (III) The recombinant strain obtained by the construction method according to any one of claims 4 to 6.

8. The application as described in claim 7, characterized in that, The coffee bark beetle includes the adult coffee bark beetle.

9. A microbial inoculant, characterized in that, Includes any of the following and / or their conidia: (I) Beauveria bassiana QZ as described in claim 1; and / or (II) The recombinant strain as described in claim 2 or 3; and / or (III) The recombinant strain obtained by the construction method according to any one of claims 4 to 6.

10. The microbial agent as described in claim 9, characterized in that, The microbial agent also includes pesticide-acceptable excipients.

Images