Thermus thermophilus capable of producing high-activity factors and application of Thermus thermophilus

By subjecting Thermophilic Bacillus to ARTP, UV, and chemical mutagenesis, combined with high-temperature-photorepair activity screening, Thermophilic Bacillus strain ZHH-88 was obtained. This solved the problems of low growth rate and insufficient enzyme yield of Thermophilic Bacillus at high temperatures, and enabled the efficient production of highly active factors for use in cosmetics.

CN121801747APending Publication Date: 2026-04-07HUZHOU ZHIHE BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-17
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing thermophilic bacteria have low growth rates and insufficient biomass at high temperatures. Acetic acid accumulation inhibits growth, and the production of photolyase and heat shock proteins is low, making it difficult to meet the needs of cosmetics.

Method used

Thermostable thermophilic bacteria were treated with ARTP, ultraviolet light, and chemical mutagenesis. Combined with high-temperature-photorepair activity and enzyme-linked reaction screening, enzyme activity and HSP content were determined by high-throughput multi-well plate assay. With the addition of stepwise heat shock-blue light coupled acclimatization, the thermophilic bacteria strain ZHH-88 was obtained, which improved biomass and enzyme activity.

Benefits of technology

The thermophilic bacterium strain ZHH-88 significantly increased the yield of bacterial dry weight, photolyase, and heat shock protein, solving the problem of high activity and high efficiency in the production of cosmetic raw materials, and achieving efficient DNA repair and anti-heat aging functions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121801747A_ABST
    Figure CN121801747A_ABST
Patent Text Reader

Abstract

The invention discloses a thermophilic thermophilic bacterium capable of producing high-activity factors and application, the thermophilic thermophilic bacterium capable of producing the high-activity factors is a thermophilic thermophilic bacterium ZHH-88 and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC M 20252862; the invention further discloses application of the high-activity factor-producing Thermus thermophilus to preparation of active raw materials of cosmetics, medical beauty products or after-sun repair products. The method has the advantages of high thallus dry weight, high CPD photolyase yield and high heat shock protein yield.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of Thermus thermophilus. BACKGROUND

[0002] Thermus thermophilus is an extreme thermophilic bacterium that can grow efficiently at 55-80°C, widely distributed in hot springs, hydrothermal vents and other high-temperature environments. Its genome, membrane lipid and enzyme system are highly "heat adapted": the GC content of DNA is as high as 68-72%, tRNA and rRNA contain a large number of GC base pairs; membrane lipids are mainly long-chain, high-saturation and branched fatty acids, which can maintain a liquid crystal state at high temperatures; the protein surface is rich in charged and aromatic amino acids, and the core is more tightly packed, thereby maintaining conformational stability at high temperatures. Thermus thermophilus has high fermentation rate and high biomass, and can accumulate active substances such as heat-stable SOD, glutathione, B vitamins, polypeptides and nucleic acid derivatives in cells.

[0003] When Thermus thermophilus uses glucose as the sole or main carbon source, the secreted products exhibit three major characteristics: "high-temperature rapid metabolism, low by-products, and high active substances", which can be summarized into the following categories: Organic acids: under the conditions of 55-75°C and micro-aerobic conditions, glucose enters the tricarboxylic acid cycle rapidly through the Embden-Meyerhof-Parnas pathway, but due to the high-temperature regulation of pyruvate dehydrogenase activity, the carbon flow mainly overflows as acetic acid and a small amount of lactic acid; the peak value of acetic acid can reach 1-1.5g / L, and the lactic acid is <0.3g / L. It is worth noting that the acetic acid produced during fermentation often inhibits the growth of Thermus thermophilus, resulting in no further increase in biomass.

[0004] Amino acids and small molecule peptides: the bacteria actively expel glutamic acid, alanine and <3kDa small peptides, with a concentration of 50-200mg / L, which have metal chelation and antioxidant functions, providing raw materials for subsequent "natural moisturizing factors".

[0005] Heat-stable enzymes: glucose induction simultaneously triggers oxidative stress response, and the bacteria secrete: superoxide dismutase (SOD), catalase, glutathione peroxidase, heat shock proteins, and active factors such as photosynthetic enzymes. This type of protein has skin barrier repair and film-forming effects.

[0006] Photolyase is a class of flavoprotein enzymes that can repair DNA damage caused by ultraviolet light under visible light. Its repair objects are mainly cyclobutane pyrimidine dimers (CPD) and 6-4 photoproducts. If these damages are not corrected in time, mutations, cell apoptosis or skin photoaging will occur. Unlike higher animals, which have lost this enzyme in evolution, extreme microorganisms such as Thermus thermophilus retain efficient and heat-resistant CPD-photolyase, which can maintain activity at about 75°C, providing immediate "on-site repair" for DNA damage in high-temperature environments.

[0007] Heat-shock proteins (HSPs) are a class of molecular chaperones that are synthesized rapidly when cells are subjected to high temperature or other stress, helping proteins to fold correctly, preventing aggregation, repairing or degrading denatured proteins. According to molecular weight, they can be divided into HSP100, HSP90, HSP70, HSP60 and small HSP (sHSP) families. By ATP-dependent or ATP-independent binding to exposed hydrophobic fragments, they help new peptide chains to fold, transport old proteins, and decompose irreparable aggregates, thereby maintaining intracellular protein homeostasis and significantly improving cell tolerance to heat, oxidation, toxins and other stresses.

[0008] Heat-shock proteins are considered as "protein-level molecular chaperones" in the field of cosmetics, and can form a heat-oxidation double protection network on the skin surface. On the one hand, their oligomer structure can wrap and stabilize collagen, enzymes and signal peptides that are susceptible to high temperature, blue light or free radical attack, reducing denaturation and aggregation caused by urban "thermal aging" and light pollution. On the other hand, small HSPs can penetrate the stratum corneum and help repair denatured DNA and mitochondrial proteins in cells, thereby increasing the "self-healing" rate of post-sun and overworked skin. Therefore, they have been developed as core active ingredients in high-end skin care formulations for anti-thermal stress, anti-blue light, post-sun first aid, and medical and aesthetic wound repair.

[0009] Currently, there have been some progress in the research and application of active factors produced by Thermus thermophilus, but the limitations are still relatively large, mainly due to the following reasons: The growth rate of Thermus thermophilus at high temperatures of 55-75°C is only 0.15-0.25 / h, which is much lower than that of Escherichia coli at room temperature. At the same time, the accumulation of product acetic acid inhibits the growth of the strain, resulting in the dry weight of the batch culture bacteria stopping at 4-5 g / L. The lack of biomass base not only limits the total synthesis space of intracellular target proteins, but also increases the cost of subsequent purification, making the "ton-level" fermentation amplification face the dilemma of "no rice in the pot". In addition, high-temperature metabolites such as acetic acid and small peptides in the fermentation broth are prone to non-enzymatic browning with enzymes, further reducing the yield of active substances.

[0010] The CPD-photolyase is an intracellular enzyme, and the specific activity of the wild strain is high under the induction of constant 75 DEG C high temperature, but the volume yield is generally <1 mg / L; the expression thereof depends on FAD embedding, the cofactor is easy to fall off under high temperature, the light penetration is limited, and the enzyme molecular weight is large (about 55 kDa), so there is no secretion pathway, which leads to the "high specific activity and low total amount" as the bottleneck of industrialization, and it is difficult to meet the demand of "active raw materials" for cosmetics.

[0011] The HSP70 is a natural product under high temperature stress, but the expression level of the wild strain under constant 75 DEG C is only 2-3 % of the total soluble protein; although the stepwise heating or heat pulse can be induced, the oxygen mass transfer is insufficient and the energy metabolism is unbalanced, leading to "pulse apoptosis", and the volume yield is <2 mg / L. The large consumption of cofactor ATP and the narrow expression window (<2 h) make the contradiction between "high induction and low recovery" prominent, and it is difficult to meet the demand of "active raw materials" for cosmetics. SUMMARY

[0012] The purpose of the present application is to provide a high-activity factor-producing thermus thermophilus and an application. The present application has the advantages of high bacterial body dry weight, high CPD photolyase and high heat shock protein yield.

[0013] The technical solution of the present application is a high-activity factor-producing thermus thermophilus, which is thermus thermophilus ZHH-88, preserved in China Center for Type Culture Collection, with the preservation number CCTCC M20252862 and the preservation date December 12, 2025, and the preservation address is China. Wuhan. Wuhan University.

[0014] In the aforementioned high-activity factor-producing thermus thermophilus, the method for obtaining the thermus thermophilus ZHH-88 comprises the following steps, 1) obtaining a starting strain, which is a wild-type thermus thermophilus; 2) performing mutagenesis treatment on the starting strain; 3) performing high-throughput screening on the mutagenized starting strain to obtain the high-activity factor-producing thermus thermophilus.

[0015] In the aforementioned high-activity factor-producing thermus thermophilus, in step 1), the wild-type thermus thermophilus is obtained from a hot spring in Hainan Island.

[0016] In the aforementioned high-activity factor-producing thermus thermophilus, step 2) comprises the following steps in sequence: 2.a) treating the starting strain with ARTP normal temperature plasma for 35-45 s, power 110-130 w, helium flow rate 9-11 L / min, nozzle distance 1.5-2.5 mm, and temperature ≤40 DEG C; 2.b), irradiating the starting strain with a 12-18w UV-C light source at a distance of 25-35cm for 50-70s; 2.c), placing the starting strain in a nitroso guanidine solution, shaking for 15-25min, the temperature of the nitroso guanidine solution being 50-60℃ and the concentration being 180-220mg / L.

[0017] In the aforementioned high-activity-factor-producing Thermus thermophilus, in step 2.a), the treatment time is 40s, the power is 120w, the helium flow rate is 10L / min, and the nozzle distance is 2mm; In the aforementioned high-activity-factor-producing Thermus thermophilus, in step 2.b), a 15w UV-C light source is used to irradiate the starting strain at a distance of 30cm for 60s; In the aforementioned high-activity-factor-producing Thermus thermophilus, in step 2.c), the shaking time is 20min, the temperature of the nitroso guanidine solution is 55℃, and the concentration is 200mg / L.

[0018] In the aforementioned high-activity-factor-producing Thermus thermophilus, step 3) comprises the following steps in sequence: 3.a), the mutagenized starting strain is placed on an agar plate with a culture medium for preliminary screening, the agar plate containing 0.4-0.6µM cyclobutane pyrimidine dimer-DNA, the preliminary screening conditions being a temperature of 65-75℃ and blue light LED 405nm 15-25W / m 2 irradiation for 40-56h, and the colonies around which transparent halos appear are high-enzyme-activity candidate strains; 3.b), the high-enzyme-activity candidate strains are re-screened in a multi-well plate, each well containing a culture medium and being inoculated, first being incubated at a temperature of 50-60℃ for 5-7h; then being incubated at a temperature of 70-80℃ for 14-18h, and the incubation at a temperature of 70-80℃ being carried out under blue light LED 35-45W / m 2 irradiation; and finally being subjected to at least two heat shock pulse cycles, each heat shock pulse cycle being 75-85℃ for 12-18min and 55-65℃ for 12-18min; the photolyase and heat shock protein in each well being detected, and the dry cell weight of each well being weighed, and the Thermus thermophilus ZHH-88 strain being obtained from the high-enzyme-activity candidate strain corresponding to the optimal dry cell weight.

[0019] In the aforementioned high-activity-factor-producing Thermus thermophilus, the culture medium in steps 3.a) and 3.b) both comprises glucose 4-6g / L, yeast powder 3.5-4.5g / L, and agar 12-18g / L, and the pH is 7-7.4; In the aforementioned high-activity-factor-producing Thermus thermophilus, in step 3.a), the agar plate contains 0.5µM cyclobutane pyrimidine dimer-DNA, the temperature is 70℃, and the blue light LED is 405nm 20W / m2 Irradiation, time 48h; In the step 3.b), first incubate at 55℃ for 6h, then incubate at 75℃ for 16h, during the incubation at 75℃, blue light LED 40 W / m 2 Irradiation; the last heat shock pulse cycle is 2 times, one heat cycle pulse is 80℃ for 15min, 60℃ for 15min.

[0020] In the aforementioned high-activity factor-producing Thermus thermophilus, the high-activity factor-producing Thermus thermophilus is preserved in a glycerol tube to form a glycerol-preserved bacterial liquid, and the OD600 of the glycerol-preserved bacterial liquid is 2.0±0.1; The culture method of the high-activity factor-producing Thermus thermophilus comprises the following steps, The culture medium is configured, and the culture medium comprises glucose 4-6g / L, yeast powder 11-13g / L, peptone 7.5-8.5g / L, NaCl 3-5g / L, KH2PO40.8-1.2g / L, MgSO4·7H2O 0.4-0.6g / L, FeCl3·6H2O 0.008-0.012g / L, and the initial pH of the culture medium is 7.2±0.1; The culture medium is loaded into a shaking flask, and the glycerol-preserved bacterial liquid is inoculated at a ratio of 0.8-1.2% (v / v). After sealing, the culture is divided into two stages. In the first stage, the temperature is 50-60℃, the shaking speed is 180-220rpm, the amplitude is 20-30mm, and the culture is performed for 5-7h. In the second stage, the temperature is 65-75℃, and the culture is performed for 40-56h.

[0021] In the aforementioned high-activity factor-producing Thermus thermophilus, the preservation method of the high-activity factor-producing Thermus thermophilus comprises the following steps: first, the bacterial liquid is cultured under shaking flask conditions until the OD600 is 2.5±0.1; then, 50% (v / v) glycerol is mixed with the bacterial liquid at a ratio of 1:1, and the mixture is stored in a cryogenic tube. After sealing, the mixture is stored in an environment of-80±5℃.

[0022] The aforementioned high-activity factor-producing Thermus thermophilus is used for preparing a cosmetic active raw material.

[0023] Compared with the prior art, the present application provides a non-transgenic, industrializable Thermus thermophilus. Through specific breeding and culture strategies, a diversity mutation library is obtained by using ARTP, ultraviolet and / or chemical mutagenesis, combined with high-temperature-light repair activity, enzyme-linked reaction and / or fluorescence reporter plate for phenotype primary screening, and then through multi-well plate high-throughput determination of enzyme activity / specific activity, HSP content and DCW, combined with stepwise heat shock-blue light coupling domestication, a complex functional strain with high biomass, high light splitting enzyme and high heat shock protein is quickly locked. The strain has relatively high thallus dry weight, high CPD light splitting enzyme and heat shock protein yield. The DCW can be increased from the original level of 4-5 g / L to ≥6 g / L. The light splitting enzyme specific activity can be increased from the original level of <1 mg / L to ≥1350 U / g DCW (equivalent to 5.4-6.75 mg / L). The HSP70 can be increased from the original level of <2 mg / L to ≥20 mg / g DCW. The present application can provide low-cost, high-activity, recordable DNA repair and anti-thermal aging raw materials for the fields of cosmetics, medical beauty and after-sun repair, and has a wide market prospect. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 is a microscope staining diagram of Thermus thermophilus ZHH-88. DETAILED DESCRIPTION

[0025] The present application will be further described below in combination with the drawings and examples, but it is not used as the basis for limiting the present application.

[0026] Example 1: Obtaining method of Thermus thermophilus ZHH-88: 1. Obtaining the starting strain: Thermus thermophilus wild type, obtained from a hot spring in Hainan Island; 2. Mutagenesis treatment: 2.a), ARTP normal temperature plasma treatment of the starting strain, power 120W, helium flow rate 10L / min, nozzle distance 2mm, temperature ≤40℃, treatment time 40s; 2.b), ultraviolet mutagenesis, 15W UV-C light source irradiation, distance 30cm, irradiation 60s; 2.c), chemical mutagenesis, placed in 55℃, 200mg / L concentration of nitroso guanidine (NTG), light shaking for 20min.

[0027] The operation sequence is ARTP→ultraviolet→washing and resuspension, to ensure maximum mutation spectrum; 3), high-throughput screening of the mutagenized starting strain: 3. a) Primary screening plate: medium: glucose 5 g / L, yeast powder 4 g / L, agar 15 g / L, pH 7.2; condition: 70°C, 48 h, blue light LED 405 nm 20 W / m 2 ; indicator: CPD-DNA agar plate (containing 0.5 µM cyclobutane pyrimidine dimer-DNA); the high-enzyme-activity candidate strain is screened on the agar plate after the culture medium is mixed with the mutagenized starting strain; 3. b) 96-well plate re-screening: 200 µL of the medium in 3. a) per well, 2 µL of the high-enzyme-activity candidate strain per well; first incubate at 55°C for 6 h to proliferate rapidly; then incubate at 75°C for 6 h, during which the blue light LED 40 W / m 2 is irradiated to induce photolyase; finally, heat shock pulse, 80°C for 15 min→60°C for 15 min, cycle 2 times to induce HSP70; Detect the photolyase and heat shock protein in each well, and weigh the dry cell weight (DCW) of each well (prior art, also refer to the subsequent experimental examples). Obtain Thermus thermophilus ZHH-88 in the high-enzyme-activity candidate strain corresponding to the optimal cell dry weight, in the corresponding well, DCW≥6 g / L, specific activity of photolyase≥1350 U / g DCW (according to the typical high-temperature photolyase activity 1 mg = 1200~1500 U, the corresponding photolyase volume concentration is about 5.4~6.75 mg / L), HSP70≥20 mg / g DCW.

[0028] The 16S r characteristic gene of Thermus thermophilus ZHH-88 is as follows: tgcaagtcgtgcgggccgcggggttttactccgtggtcagcggcggacgggtgagtaacgcgtgggtgac ctacccggaagagggggacaacccggggaaactcgggctaatcccccatgtggacccgccccttggggtg tgtccaaagggctttgcccgcttccggatgggcccgcgtcccatcagctagttggtggggtaatggccca ccaaggcgacgacgggtagccggtctgagaggatggccggccacaggggcactgagacacgggccccact CCTACGGGAGGCAGCAGTTAGGAATCTTCCGCAATGGGC GCAAGCCTGACGGAGCGACGCCGCTTGGAGG AAGAAGCCCTTCGGGGTGTA AACTCCTGAACCCGGGACGAAACCCCCGACGAGGGGACTGACGGTACC GG GGTAATAGCGCCGGCCAAC TCCGTGCCAGCAGCCGCGGTATA CGGAGGGCGCGAGCGTTACCCGGATT C ACTGGGCGTAAAGGGCGTG TAGGCGGCCTGGGGCGTCCCATGTGAAAGACCACGGCTCAACCGTGGGGGA GCGTGGGATACGCTCAGGCTAGACGGTGGGAGAGGGTG GTGGAA TTC CCGGAGTAGCGGTGAAATGCGCA GATACCGGGAGGAACGCCGATGGCGAAGGCAGCCACCTGGTCCACCCGTGACGCTGAGGCGCGAAAGCGT GGGGAGCAAACCGGATTAGATACC GGGTAGTCCACGCCCTAAACGATGC GCGCTAGGTCTCTGGGTCTC CTGGGGGCCGAAGCTAACGC GTTAAGCGCCGCCTGGGGAGTACGGCCGCAAGGCTGAAACTCAAAGGA ATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTAATT CGAAGCAACGC G AAGA CCTTACCAGG CCTTGACATGCTAGGGAACCCGGGTGAAAGCCTGGGGTGCCCCGCGAGGGGAGCCCTAGCACAGGTGCTG CATGGCCGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTT AAGTCCC GCAACGAGCGCAACCCCCGCCGTTA GTTGCCAGCGGTTTGGCCGGGC ACTCTAACGGGACTGCCC GCGAAAGCGGAGGAAGGAGGGGACGACGT GCTGAGATGC ATGATGATGA TGGAGCTGAA ATGCTGCTGA TGATGCTGCT GATGCTGC GGCAACGGGG AGCTAATCGC AAAAGGTGGG CCCAGTTCGG ATTGGGCTCT GCAACCCGAC CCCATGAAGA CCGGAAATCG CTAATCAGCC ATGCCGCGGT GAATACGTT CCCGGCCTGT GTACACACCG CC CGTCACGCCA TGGGAGCGGC TCTACCCGAA GTCGCCGGGA GCCTACGGGC AGGC Example 2: The cultivation method of Thermus thermophilus ZHH-88, using shake flask cultivation technology.

[0029] Medium composition: glucose 5.0 g / L, yeast powder 12 g / L, peptone 8 g / L, NaCl 4 g / L, KH2PO4 1.0 g / L, MgSO4·7H2O 0.5 g / L, FeCl3·6H2O 0.01 g / L, the initial pH of the medium is 7.2±0.1 (adjusted with 5 M NaOH or 5 M H3PO4).

[0030] The medium was loaded into a shake flask, and the shake flask parameters were as follows: Medium loading volume: 100 mL / 500 mL high-temperature-resistant borosilicate glass shake flask.

[0031] Inoculum: 1% (v / v) glycerol-preserved bacterial solution (OD600≈2.0).

[0032] Culture temperature: 55°C (first stage)→70°C (second stage) Shaker speed: 200 rpm, amplitude 25 mm.

[0033] Seal: air-permeable high-temperature-resistant silicone plug to prevent evaporation contamination.

[0034] Two-stage cultivation procedure: ① Proliferation stage: 55°C, 200 rpm, 6 h; ② Induction stage: temperature increased to 70°C, continued to culture for 48 h.

[0035] The whole process pH is natural and does not need to be adjusted.

[0036] The end point indicators are as follows: OD600: 4.5±0.2, DCW: ≈2 g / L, Photolyase specific activity: ≥ 1 350 U / g DCW, HSP70: ≥ 20 mg / g DCW, Acetic acid: <0.6 g / L, No particles remain, can be directly used for seed tank inoculation or glycerol tube preservation.

[0037] Example 3: Preservation method of Thermus thermophilus ZHH-88, first cultivate under shake flask conditions to a bacterial liquid OD600=2.5±0.1 (70°C, 54h), then mix 50% (v / v) sterile glycerol with the bacterial liquid 1:1, final concentration 25% (v / v) glycerol. Store in cryotubes, 1 mL of the mixture is stored in a 2 mL cryotube. Double-layer high-temperature silicone plug, Parafilm seal, long-term storage at -80°C environment. When used, recover at room temperature and cultivate in a shake flask.

[0038] Experimental Example 1: Detection method of photolyase and heat shock protein in step 3.b) of Example 1.

[0039] I. Purpose of the experiment: To detect the content of heat shock protein 70 and photolyase in Thermus thermophilus samples and understand the expression level of enzymes in the strain.

[0040] II. Experimental principle: In this experiment, the double antibody sandwich ELISA (enzyme-linked immunosorbent assay) technique was used to determine the content of heat shock protein 70 and photolyase in Thermus thermophilus samples. The solid-phase antibody (photolyase antibody) was coated on the microplate, the photolyase in the sample was combined with the solid-phase antibody, and then combined with the HRP-labeled photolyase antibody to form an "antibody-antigen-enzyme-labeled antibody" complex. After adding the color developing agent TMB, it is converted to blue under the catalysis of HRP enzyme, and it is converted to yellow after adding the stop solution. The color depth is positively correlated with the content of photolyase in the sample. The absorbance (OD value) was determined by the enzyme label instrument at 450 nm wavelength, and the concentration of photolyase in the sample was calculated according to the standard curve.

[0041] III. Materials and instruments: 3.1 Reagents: Heat shock protein 70 enzyme-linked immunoassay kit (96T) and photolyase enzyme-linked immunoassay kit (96T); 30-fold concentrated washing solution, enzyme-labeled reagent, enzyme-labeled coating plate, sample diluent, color developing agent A liquid, color developing agent B liquid, stop solution, standard (400 ng / L), standard diluent; 3.2 Instruments and equipment: Enzyme label instrument, pipette and gun head, plate washer, constant temperature box (37°C), centrifuge, vortex mixer; 3.3 Sample: Thermus thermophilus culture solution.

[0042] Four, experimental method: 4.1 Sample preparation: collect the culture solution of Thermobifida fusca, centrifuge at 2-8°C for 20 minutes (3000 rpm), carefully collect the supernatant, take the supernatant for detection, and the rest is stored at -20°C for standby; 4.2 Standard preparation: prepare gradient standards according to the kit instructions: No. 5 standard (200 ng / L): 150 μl of original standard + 150 μl of standard diluent; No. 4 standard (100 ng / L): 150 μl of No. 5 standard + 150 μl of standard diluent; No. 3 standard (50 ng / L): 150 μl of No. 4 standard + 150 μl of standard diluent; No. 2 standard (25 ng / L): 150 μl of No. 3 standard + 150 μl of standard diluent; No. 1 standard (12.5 ng / L): 150 μl of No. 2 standard + 150 μl of standard diluent; 4.3 Detection steps: Set up blank wells, standard wells and sample wells, add 50 μl of each concentration standard to the standard wells, add 40 μl of sample diluent to the sample wells first, then add 10 μl of sample (the final dilution of the sample is 5 times), incubate at 37°C for 30 minutes, dilute the 30-fold concentrated washing solution with distilled water 30 times, wash the plate 5 times, each time for 30 seconds, add 50 μl of enzyme-labeled reagent to each well (except for blank wells), incubate at 37°C for 30 minutes, wash the plate 5 times, each time for 30 seconds, add 50 μl of color developing agent A and 50 μl of color developing agent B to each well, develop color at 37°C for 10 minutes in the dark, add 50 μl of stop solution to each well, and measure the OD value of each well at 450 nm wavelength (complete within 15 minutes).

[0043] Experimental Example 2: Thermus thermophilus ZHH-88 fermentation determination.

[0044] I. Equipment and basic parameters: 5 L borosilicate glass jacketed tank, working volume 3 L.

[0045] Defoaming: electrode type, 10% polyether defoamer (pre-sterilized).

[0046] II. Medium (g / L): Glucose 5.0, Yeast extract 12.0, Peptone 8.0, NaCl 4.0, KH2PO4 1.0, MgSO4·7H2O 0.5, FeCl3·6H2O 0.01, initial pH 7.2±0.1, sterilized at 121℃ for 20 min.

[0047] III. Seed preparation: Inoculum: 10 % (v / v), initial OD600≈0.25.

[0048] IV. Fermentation control (single-point thermostatic): Temperature control mode: single-point thermostatic 70℃ Agitation: 150 rpm, Aeration: 1 vvm air (3 L / min), Dissolved oxygen: no control, only record trend (from 80 %→ naturally down to about 30 %); pH: high-temperature glass electrode, set 7.2±0.1 (5 M NaOH / 5 M H3PO4 automatic adjustment).

[0049] V. Harvest and assay: 48 h stop agitation, naturally cool to 30℃, stop aeration, collect cells at 4℃ 8 000×g for 10 min; Resuspend in PBS→ heat sink at 55℃ for 15 min→ ice bath→ 12 000×g for 20 min→ 0.22 µm filtration.

[0050] Detection: DCW, CPD photolyase (ELISA), HSP70 (Western blot), acetic acid.

[0051] VI. Results: OD600: 13.2±0.3, DCW: 6.0±0.2 g / L, Specific activity of photolyase: 1350±72 U / g DCW, HSP70: 20±3.2 mg / g DCW, Acetic acid: 0.3 g / L.

[0052] Example 3: Fermentation assay of Thermus thermophilus (wild type).

[0053] I. Equipment and basic parameters: 5 L borosilicate glass jacketed tank, working volume 3 L.

[0054] Antifoam: electrode type, 10 % polyether antifoam agent (pre-sterilized).

[0055] II. Medium (g / L): Glucose 5.0, Yeast extract 12.0, Peptone 8.0, NaCl 4.0, KH2PO4 1.0, MgSO4·7H2O 0.5, FeCl3·6H2O 0.01, initial pH 7.2±0.1, sterilized at 121℃ for 20 min.

[0056] III. Seed preparation: Inoculum: 10 % (v / v), initial OD600≈0.25.

[0057] IV. Fermentation control (single-point thermostatic): Temperature control mode: single-point thermostatic 70℃, Agitation: 150 rpm, Aeration: 1 vvm air (3 L / min), Dissolved oxygen: no control, only record trend (from 80 %→ naturally down to about 30 %).

[0058] pH: high-temperature glass electrode, set 7.2±0.1 (5 M NaOH / 5 M H3PO4 automatic adjustment).

[0059] V. Harvest and assay: 48 h stop agitation, naturally cool to 30℃, stop aeration; 4℃ 8 000×g 10 min collect bacteria; Resuspend in PBS→ 55℃ heat sink for 15 min→ ice bath→ 12 000×g 20 min→ 0.22 µm filter; Detection: DCW, CPD photolyase (ELISA), HSP70 (Western blot), acetic acid.

[0060] VI. Results OD600: 6.8±0.2, DCW: 2.9±0.1 / g L, Specific activity of photolyase: 180±15 U / g DCW, HSP70: 2.0±0.2 mg / g DCW, Acetic acid: 0.8 / g L.

Claims

1. A thermophilic bacterium producing highly active factors, characterized in that: The thermophilic bacterium that produces highly active factors is thermophilic bacterium ZHH-88, which is deposited at the China Center for Type Culture Collection, accession number CCTCC M 20252862.

2. The thermophilic bacteria producing highly active factors according to claim 1, characterized in that: The method for obtaining the thermophilic bacterium ZHH-88, Includes the following steps, 1) Obtain the starting strain, which is a wild-type thermophilic fungus; 2) Mutagenesis treatment of the starting strain; 3) High-throughput screening was performed on the mutagenized starting strains to obtain thermophilic bacteria that produce high-activity factors.

3. The thermophilic bacteria producing highly active factors according to claim 2, characterized in that: In step 1), the wild-type thermophilic bacteria were obtained from hot springs on Hainan Island.

4. The thermophilic bacteria producing highly active factors according to claim 2, characterized in that: Step 2) includes the following steps in sequence: 2.a) Use ARTP room temperature plasma to treat the starting bacterial strain for 35-45 seconds, with a power of 110-130w, a helium flow rate of 9-11 L / min, a nozzle distance of 1.5-2.5mm, and a temperature ≤40℃; 2.b) Irradiate the starting strain with a 12-18W UV-C light source at a distance of 25-35cm for 50-70 seconds; 2.c) Place the starting strain in a nitrosoguanidine solution and shake for 15-25 minutes. The temperature of the nitrosoguanidine solution should be 50-60℃ and the concentration should be 180-220 mg / L.

5. The thermophilic bacteria producing highly active factors according to claim 4, characterized in that: In step 2.a), the processing time is 40s, the power is 120w, the helium flow rate is 10 L / min, and the nozzle distance is 2mm. In step 2.b), the starting strain is irradiated with a 15W UV-C light source at a distance of 30cm for 60s. In step 2.c), the shaking time is 20 min, the temperature of the nitrosoguanidine solution is 55℃, and the concentration is 200 mg / L.

6. The thermophilic bacteria producing highly active factors according to claim 2, characterized in that: Step 3) includes the following steps in sequence: 3.a) The mutagenic starting strain was subjected to initial screening on agar plates containing 0.4-0.6 µM cyclobutanepyrimidine dimer-DNA. The initial screening conditions were: temperature 65-75℃, blue LED 405 nm 15-25W / m 2 Irradiate for 40-56 hours, and collect colonies with a transparent halo around them as candidate strains with high enzyme activity; 3.b) Take high enzyme activity candidate strains from a multi-well plate for re-screening, place culture medium in each well and inoculate, and incubate at 50-60℃ for 5-7 hours; Then, cultivate at 70-80℃ for 14-18 hours. During cultivation at 70-80℃, the blue LED output is 35-45 W / m. 2 Irradiation; Finally, perform at least two heat shock pulse cycles, with each heat cycle pulse consisting of 75-85℃ for 12-18 minutes and 55-65℃ for 12-18 minutes. Photolyase and heat shock protein in each well were detected, and the dry weight of cells in each well was weighed. Thermostats ZHH-88 was obtained from the candidate strain with high enzyme activity corresponding to the optimal cell dry weight.

7. The thermophilic bacteria producing highly active factors according to claim 6, characterized in that: The culture media in steps 3.a) and 3.b) both consist of 4-6 g / L glucose, 3.5-4.5 g / L yeast extract, 12-18 g / L agar, and pH 7-7.

4. In step 3.a, the agar plate contains 0.5 µM cyclobutanepyrimidine dimer-DNA, the temperature is 70°C, and the blue LED is 405nm at 20 W / m. 2 Irradiation time: 48 hours; In step 3.b), the LED is first incubated at 55°C for 6 hours, then at 75°C for 16 hours. During incubation at 75°C, the blue LED has a power output of 40 W / m. 2 Irradiation; finally, two heat shock pulse cycles, each consisting of a pulse at 80°C for 15 minutes and a pulse at 60°C for 15 minutes.

8. The thermophilic bacteria producing highly active factors according to claim 6, characterized in that: The thermophilic bacteria that produce highly active factors are preserved in glycerol tubes to form a glycerol-preserved bacterial solution with an OD600 of 2.0 ± 0.

1. The method for culturing the thermophilic bacteria that produce highly active factors includes the following steps: Prepare a culture medium containing 4-6 g / L glucose, 11-13 g / L yeast extract, 7.5-8.5 g / L peptone, 3-5 g / L NaCl, 0.8-1.2 g / L KH2PO4, 0.4-0.6 g / L MgSO4·7H2O, and 0.008-0.012 g / L FeCl3·6H2O. The initial pH of the culture medium is 7.2 ± 0.

1. Fill the culture medium into a shake flask, inoculate with glycerol preservation culture at a ratio of 0.8-1.2% (v / v), seal the flask, and culture in two stages. In the first stage, the temperature is 50-60℃, the shaking speed is 180-220rpm, the amplitude is 20-30mm, and the culture time is 5-7h. In the second stage, the temperature is 65-75℃ and the culture time is 40-56h.

9. The thermophilic bacteria producing highly active factors according to claim 8, characterized in that: The method for preserving the thermophilic bacteria that produce highly active factors involves first culturing the bacterial solution under shake flask conditions until the OD600 of the bacterial solution reaches 2.5±0.1, then mixing 50% (v / v) glycerol with the bacterial solution at a 1:1 ratio, storing it in a cryovial, sealing it, and storing it at -80±5℃.

10. The application of the thermophilic bacteria producing highly active factors as described in claim 1 as an active ingredient in the preparation of cosmetics, medical aesthetic products, or after-sun repair products.