Preparation method and application of tetraploid saccharomyces cerevisiae strain

Abstract

The invention discloses a preparation method and application of a tetraploid saccharomyces cerevisiae strain, and belongs to the technical field of bioengineering. Comprising the following steps: (1) knocking out an HO gene of diploid yeast LFN524, separating haploids through spore production, and identifying mating types of candidate haploid strains to obtain haploid strains with opposite mating types of haploids; (2) respectively culturing haploid strains of different mating types, inducing fusion of the haploid strains, and screening successfully fused diploid strains; and (3) inducing the successfully fused diploid strain to fuse again to obtain the tetraploid saccharomyces cerevisiae strain. The nucleic acid content of the strains 8-3 and 8-4 disclosed by the invention is obviously higher than that of a diploid stock plant, and the nucleic acid content can respectively reach 0.118 g / g-DCW and 0.096 g / g-DCW, which are respectively increased by 63.89% and 33.33%.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a method for preparing and applying a tetraploid Saccharomyces cerevisiae strain. Background Technology

[0002] Ribonucleic acid (RNA), as an important biological macromolecule, is not only a core substance for life activities (such as protein synthesis and gene regulation) but also an industrial product with extremely high economic value. In the wine production industry, the hydrolysis products of RNA, nucleotides and amino acids, contribute to flavor, especially the contents released during autolysis, including 5'-nucleotides (such as 5'-guanylic acid GMP) produced by RNA degradation, as well as various amino acids and peptides. These substances affect the flavor of lees aging. High RNA content usually indicates vigorous metabolic activity and strong protein synthesis capacity within yeast cells, ensuring rapid fermentation initiation and a complete and thorough process, reducing the risk of slow or stalled fermentation. This is particularly important for brewing high-sugar sweet wines or high-alcohol wines, improving the stability of the process. Furthermore, RNA and its hydrolysis products have wide applications in the pharmaceutical, health product, and animal feed additive fields. In the pharmaceutical field, RNA is a key intermediate in the preparation of various antiviral and antitumor drugs (such as vidarabine and cyclocytidine). The single nucleosides or chemically modified nucleoside analogs produced by their hydrolysis are the active ingredients of many drugs that act directly on the genetic material level. In the health supplement industry, nucleotide mixtures, as dietary supplements, are suitable for people in the postoperative recovery period, the elderly, and those with weakened immunity, helping to promote protein synthesis, accelerate tissue repair, and improve the body's resistance to infection. In the field of animal feed additives, nucleotide supplementation can improve "nucleotide malnutrition" in young animals caused by weaning stress or insufficient synthesis capacity, promote intestinal villi development, improve nutrient absorption, thereby accelerating weight gain and improving feed conversion rate.

[0003] Currently, microbial fermentation is the main method for large-scale RNA production. Among many microorganisms, *Saccharomyces cerevisiae* (Saccharomyces cerevisiae) is a popular choice. Saccharomyces cerevisiaeSaccharomyces cerevisiae is widely recognized as one of the most ideal strains for RNA production, primarily due to its recognized safe (GRAS) status, simple and inexpensive culture conditions, and ease of extraction. However, commercially available Saccharomyces cerevisiae strains traditionally used for RNA production are mostly diploid, with RNA content typically between 8% and 12%. Although fermentation process optimization can improve yield to some extent, the increase is limited. Therefore, selecting strains with stronger RNA synthesis capabilities is key to overcoming yield limitations and enhancing industry competitiveness from the source. Existing studies have shown that yeast mutants with slightly increased RNA content can be obtained through conventional mutagenesis and screening, but these methods suffer from limited improvement and unstable genetic traits. Polyploid breeding, especially tetraploid yeast, has the potential to increase intracellular RNA content due to its increased cell volume and generally enhanced biosynthetic capacity. However, in current technologies, polyploid induction usually aims at chromosome doubling itself, and the RNA content of most tetraploid strains is not significantly superior to that of high-yielding diploid parents. Therefore, the research that can screen out tetraploid brewer's yeast with high nucleic acid content is of great practical significance for improving the technical level of nucleic acid fermentation industry, reducing production costs, and enhancing product competitiveness.

[0004] Chinese patent application CN113881581A discloses "A high-RNA Saccharomyces cerevisiae strain and its application." This method utilizes ambient pressure room temperature plasma mutagenesis (ARTP) to induce mutagenesis in the starting strain, and through response surface methodology optimization, obtains a Saccharomyces cerevisiae strain with an RNA content as high as 15.80%, representing a 70.76% improvement compared to the starting strain. Chinese patent application CN115478024A discloses "A non-GMO high-RNA Saccharomyces cerevisiae strain and its application." This method, through improved breeding techniques, screens out a stable, non-GMO Saccharomyces cerevisiae strain with a higher RNA content than most commercially available strains. Chinese patent application CN101760437A discloses a "high nucleic acid baker's yeast and its preparation method". This method optimizes the culture time, and the obtained baker's yeast contains nucleic acid equivalent to more than 20% of the dry weight of the cell, of which the RNA content reaches more than 9.5%. Chinese patent application CN112175850A discloses "a high nucleic acid-producing industrial brewer's yeast and its application". By adopting the strategy of "overexpression + double knockout", the selected brewer's yeast has increased the nucleic acid content by 8.08%, 12.45% and 16.76% respectively compared with the parent strain, thus improving the nucleic acid content of brewer's yeast.

[0005] Existing technologies mainly focus on increasing the nucleic acid content of diploid Saccharomyces cerevisiae through genetic engineering or non-GMO mutagenesis. However, no published patents have reported a technical solution combining tetraploid breeding with high nucleic acid content. Therefore, there is an urgent need in this field for a new technical solution aimed at specifically preparing a tetraploid Saccharomyces cerevisiae strain that is genetically stable, has excellent growth performance, and significantly exceeds the RNA content of existing diploid production strains, in order to achieve large-scale industrial production. Summary of the Invention

[0006] The purpose of this invention is to provide a method for preparing a tetraploid Saccharomyces cerevisiae strain and its application, so as to solve the problems existing in the prior art.

[0007] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is a method for preparing a tetraploid Saccharomyces cerevisiae strain, comprising the following steps: (1) On diploid yeast LFN524 HO Gene knockout was performed, haploids were isolated through sporulation, and mating type identification was performed on candidate haploid strains to obtain haploid strains with opposite mating types; (2) Haploid strains with different mating types were cultured separately to induce fusion of haploid strains and screen for diploid strains that successfully fused. (3) The diploid strain that was successfully induced to fuse was fused again to obtain the tetraploid Saccharomyces cerevisiae strain.

[0008] The second technical solution of the present invention is a tetraploid Saccharomyces cerevisiae strain prepared by the preparation method.

[0009] The third technical solution of this invention is the application of the tetraploid Saccharomyces cerevisiae strain in the production of ribonucleic acid.

[0010] The fourth technical solution of the present invention is a method for producing ribonucleic acid, which utilizes the tetraploid Saccharomyces cerevisiae strain to ferment and produce ribonucleic acid.

[0011] Based on the above technical solution, the present invention has the following technical effects: The nucleic acid content of strains 8-3 and 8-4 disclosed in this invention is significantly higher than that of the diploid parent strain, reaching 0.118 g / g-DCW and 0.096 g / g-DCW, respectively, representing increases of 63.89% and 33.33%. This is higher than most diploid Saccharomyces cerevisiae strains currently on the market. After verification of its later fermentation performance, it exhibits stable genetic inheritance, classifying it as a tetraploid Saccharomyces cerevisiae. It can serve as a safe core production strain for the industrial production of high-purity ribonucleic acid, nucleotides, and yeast extracts, with wide applications in the food industry, health products, and pharmaceuticals. Furthermore, the unique physiological characteristics of this strain also make it a potential preferred strain for enhancing the flavor and quality of wine. Therefore, this invention possesses both broad industrial application prospects and significant economic value. Attached Figure Description

[0012] Picture 1 A schematic diagram of primer design for Cre-loxp homologous recombination knockout.

[0013] Picture 2 The content of higher alcohols in simulated grape juice was determined by LFN524 and its haploid strains.

[0014] Picture 3 Fluorescence distribution histograms for analyzing the DNA content of different ploidy Saccharomyces cerevisiae strains by flow cytometry (CECA is the diploid control strain, HHLL is the tetraploid control strain, and G2 is the haploid strain).

[0015] Picture 4 The graph shows a comparison of growth curves of yeast strains with different ploidy levels. G2 and G14 are the original haploid strains, G2+G14 is the homodiploid strain, and 8-3 and 8-4 are the homotetraploid strains.

[0016] Picture 5 Nucleic acid content of yeast strains with different ploidy levels. Detailed Implementation

[0017] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0018] This invention provides a method for preparing a tetraploid Saccharomyces cerevisiae strain, comprising the following steps: (1) On diploid yeast LFN524 HO Gene knockout was performed, haploids were isolated through sporulation, and mating type identification was performed on candidate haploid strains to obtain haploid strains with opposite mating types; (2) Haploid strains with different mating types were cultured separately to induce fusion of haploid strains and screen for diploid strains that successfully fused. (3) The diploid strain that was successfully induced to fuse was fused again to obtain the tetraploid Saccharomyces cerevisiae strain.

[0019] In some specific implementations, the treatment of diploid yeast LFN524... HO The primers used for gene knockout are shown in SEQ ID NO.1 to SEQ ID NO.4, respectively.

[0020] In some specific implementations, the treatment of diploid yeast LFN524... HO The gene knockout method is as follows: using pUG6SH plasmid as a template, PCR amplification is performed using primers shown in SEQ ID NO.1~SEQ ID NO.2 to obtain knockout frame I; The PCR reaction system consisted of: 2 μL template, 2 μL each of forward and reverse primers, 25 μL 2 × Phanta Max Master Mix, and ddH2O added to a final volume of 50 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, and complete extension for 5 min, with a cycle number of 35. The first transformant was obtained after yeast transformation and transformant verification, followed by sequencing confirmation. HO Yeast transformants with successful allele knockout; Similarly, using plasmid pUG6 as a template, PCR amplification was performed using primers shown in SEQ ID NO.3~SEQ ID NO.4 to obtain knockout box II; knocking out another... HO Alleles were used to screen for positive transformants using validation primers, ultimately obtaining... HO A diploid Saccharomyces cerevisiae strain with completely missing genes.

[0021] In some specific implementation schemes, the method for inducing haploid strain fusion is as follows: pTetra Plasmid-induced fusion of haploid strains.

[0022] The present invention also provides a tetraploid Saccharomyces cerevisiae strain prepared by the preparation method described above.

[0023] This invention also provides the application of the tetraploid Saccharomyces cerevisiae strain in the production of ribonucleic acid.

[0024] This invention also provides a method for producing ribonucleic acid, which utilizes the tetraploid Saccharomyces cerevisiae strain to ferment and produce ribonucleic acid.

[0025] To address the issues of genetic instability, low growth and metabolic rate, and low nucleic acid yield in tetraploid brewer's yeast on the market, a screening laboratory has been conducted to eliminate these problems. HOHaploid genes were synthesized to obtain haploid strains with different mating types. Fusing haploid strains with opposite mating types yielded a hybrid strain with the desired mating type. a / α Diploid strain. (Through plasmid) pTetra-new By changing the mating type of diploid strains and screening for... a / a and α / α The mating-type diploid strains were fused with opposite mating-type diploid strains to obtain strains 8-3 and 8-4. Flow cytometry confirmed that the yeast strains were homotetraploid. RNA content was measured using the perchloric acid method, ultimately yielding two tetraploid Saccharomyces cerevisiae strains, 8-3 and 8-4, with high nucleic acid content. The nucleic acid content of these two strains was significantly higher than that of the diploid parent strain and also higher than that of most diploid Saccharomyces cerevisiae strains currently on the market. Subsequent fermentation performance verification confirmed stable genetic inheritance, confirming them as tetraploid Saccharomyces cerevisiae. This can be applied to the industrial production of relatively safe ribonucleic acid, nucleotides, and yeast extracts. These products can be widely used in the food, health product, and pharmaceutical industries. Simultaneously, it can also serve as a potential core strain for wine production, possessing broad market application prospects and significant economic value.

[0026] The strain was obtained by the following method: by knocking out a haploid strain previously prepared in the laboratory (from diploid LFN524). HO After obtaining the gene, data analysis was performed to screen two haploid strains, G14 and G2, which produce low levels of higher alcohols and have opposite mating types, for subsequent experiments. The mating type of G2 was... MATa The mating type of G14 is MATα Furthermore, resistance verification experiments were conducted, and G2 and G14 were verified to be G418 resistant by plate coating combined with PCR, which did not affect subsequent plasmid processing. pTetra For use, resistance excision experiments are not required. Purified strains G2 and G14 with different mating types were fused, and the successfully fused diploid strain G2+G148 was identified and screened using MAT-PCR. Yeast transformation was then used to... pTetra Plasmid was transferred into G2+G14 8, inducing plasmid transfer. HO Gene expression was assessed by streaking single clones onto YPD-NAT plates. After the single clones grew, the mating type of the obtained strains was verified by PCR experiments. Conversely, the conjugating diploid cells fused with each other. Homologous tetraploid strains 8-3 and 8-4 were obtained by sorting using a flow cytometer. RNA content was determined by perchloric acid method, and DNA content was determined by DNA extraction method.

[0027] Example 1 Knockout HO Methods for knocking out the haploid gene (1761bp, Gene ID: 851371): Knock out the 5' ends of the upstream and downstream primers of the frame. HO The homologous arms of the gene are (AATCCATATCCTCATAAGCAGCAATCAATTCTATCTATACTTTAA); the 3' end is the amplification primer sequence for Loxp-KanMX-Loxp or Loxp-HygR-Loxp, (TACCACAACTCTTATGAGGC). The homologous arms of the knockout frame for the first knockout are... HO The upstream and downstream sequences of the gene's open reading frame (ORF); the homologous arms of the knockout frame for the second knockout are respectively... HO The upstream and downstream sequences within the gene's ORF are optimized to prevent recombination between the second knockout frame and the first, thus improving knockout efficiency.

[0028] Using pUG6SH plasmid as a template, PCR amplification was performed using primers HK1-F / HK1-R to obtain knockout frame I.

[0029] Table 1 HO Gene knockout primers

[0030] The PCR reaction system consisted of: 2 μL template, 2 μL each of forward and reverse primers, 25 μL 2 × Phanta Max Master Mix, and ddH2O added to a final volume of 50 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, and complete extension for 5 min, with a cycle number of 35.

[0031] The first transformant was obtained after yeast transformation and transformant verification, followed by sequencing confirmation. HO Yeast transformants with successful allele knockout.

[0032] Similarly, using plasmid pUG6 as a template, PCR amplification was performed using primers HK2-F / HK2-R to obtain knockout frame II. The above steps were repeated to knock out the other frame using the same method. HO Alleles were used to screen for positive transformants using validation primers, ultimately obtaining... HO A diploid Saccharomyces cerevisiae strain with completely missing genes.

[0033] Example 2 Screening method for obtaining two haploid strains with opposite mating types: The already knocked HOThe diploid yeast LFN524 was isolated as a haploid through sporulation. Small colonies were randomly selected for purification and DNA extraction. After preliminary microscopic examination, mating type identification of candidate haploid strains was performed using MAT-PCR. Two mating types were found in the haploid strains. MATa Type and MATα The haploid mating type of sporulation is random; a band at 544 bp indicates it is... MATa If there is a band at 404 bp, then it is... MATα If there are bands at both 404 bp and 544 bp, then it is... MATa / α Type. The isolated haploids were subjected to grape juice fermentation experiments. The maternal parent LFN524 was a low-yielding higher alcohol strain. Fermentation revealed that haploids G2 (524-7) and G14 (524-11) had the lowest higher alcohol yields, and these two haploids were opposite mating type haploid strains.

[0034] Example 3 Preparation of tetraploid brewer's yeast: Knocked HO Haploid strains of the gene were screened to obtain two haploid strains G2 with opposite mating types. MATa ), G14 MATα The purified strains G2 and G14, with different mating types, were inoculated into YPD liquid medium and cultured overnight at 30°C and 180 rpm / min to activate the strains. The activated strains were then transferred to 10 mL of YPD liquid medium and cultured at 30°C with shaking until OD reached [value missing]. 600 The inoculum concentration was approximately 0.8. Two strains were inoculated into 10 mL of YPD liquid medium at a 2% (v:v) inoculum ratio and incubated statically at 30°C for 12 h, followed by incubation at 30°C and 100 rpm / min for 12 h. One mL of the bacterial culture was serially diluted to an appropriate concentration and spread onto YPD solid medium. The culture was incubated at 30°C for 2-3 days until single colonies appeared. The successfully fused diploid strains were identified and screened using MAT-PCR. The yeast was then transformed... pTetra The plasmid was transferred into the strain, and the cells were cultured in YPRG medium for 1 hour to induce HO gene expression. Then, the cells were transferred to YPD medium and cultured for 6 hours to silence HO gene expression, stabilizing the cell mating type. A / a and α / α diploid strains were screened using MAT-PCR. The diploid strains with opposite mating types were then subjected to the same fusion operation to obtain tetraploid Saccharomyces cerevisiae strains 8-3 and 8-4.

[0035] Example 4 Determination of growth curves of yeast strains with different ploidy: Inoculate the yeast culture into YPD medium at an inoculation ratio of 2% (v:v) and incubate at 30°C and 180 r / min until OD. 600The value was 1, and then it was transferred to a 100 ml / 250 ml conical flask and cultured at the same temperature and rotation speed. Samples were taken every 4 hours, and the absorbance was measured at 600 nm with blank culture medium as a control.

[0036] As shown in the figure, tetraploid strains 8-3 and 8-4 grew the fastest, entered the logarithmic growth phase the earliest, and finally reached the largest biomass. Diploid strains G2+G14 grew faster than haploid strains G2 and G14, entered the logarithmic growth phase earlier than haploid strains, and reached a higher maximum biomass than haploid strains.

[0037] Example 5 Determination of nucleic acid content in yeast strains with different ploidy levels: Total RNA was determined using the perchloric acid method. Yeast strains of different ploidy were inoculated into YPD medium and cultured overnight at 30°C, then transferred to 100 ml of YPD medium and incubated until OD. 600 The target cell count was 1. The cells were then divided equally into two 50ml centrifuge tubes. One tube was used to measure stem cell weight, and the other to measure RNA content. Both tubes were centrifuged at 10,000 rpm for 5 minutes to collect cells. The tube used for dry weight measurement was placed in an 80℃ oven overnight to measure stem cell weight. The tube used for RNA content measurement was resuspended in 5ml of 0.5 mol / L perchloric acid, incubated in a 70℃ water bath for 20 minutes, centrifuged, and the absorbance of the supernatant at 260 nm was measured. The RNA content was calculated using the following formula: ; Where A260 is the absorbance of the supernatant at 260 nm, N is the dilution, and 0.03125 is the absorbance of the supernatant at OD260. 600 The value is 1.0, representing the RNA content in the test solution, where M is the weight of the stem cells.

[0038] DNA content was extracted using a kit and determined using a NanoDrop spectrophotometer.

[0039] By measuring the DNA and RNA content of the five strains, the total nucleic acid content in the figure shows that the nucleic acid content of tetraploid 8-3 (0.118 g / g-DCW) is significantly higher than that of other strains, and the nucleic acid content of tetraploid 8-4 (0.096 g / g-DCW) is significantly higher than that of haploid and diploid strains.

[0040] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A method for preparing a tetraploid Saccharomyces cerevisiae strain, characterized in that, Includes the following steps: (1) On diploid yeast LFN524 HO Gene knockout was performed, haploids were isolated through sporulation, and mating type identification was performed on candidate haploid strains to obtain haploid strains with opposite mating types; (2) Haploid strains with different mating types were cultured separately to induce fusion of haploid strains and screen for diploid strains that successfully fused. (3) The diploid strain that was successfully induced to fuse was fused again to obtain the tetraploid Saccharomyces cerevisiae strain.

2. The preparation method according to claim 1, characterized in that, The diploid yeast LFN524 HO The primers used for gene knockout are shown in SEQ ID NO.1 to SEQ ID NO.4, respectively.

3. The preparation method according to claim 2, characterized in that, The diploid yeast LFN524 HO The gene knockout method is as follows: using pUG6SH plasmid as a template, PCR amplification is performed using primers shown in SEQ ID NO.1~SEQ ID NO.2 to obtain knockout frame I; The PCR reaction system consisted of: 2 μL template, 2 μL each of forward and reverse primers, 25 μL 2 × Phanta Max Master Mix, and ddH2O to a final volume of 50 μL. The PCR reaction program was as follows: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 2 min, and complete extension for 5 min, with a cycle number of 35. The first transformant was obtained after yeast transformation and transformant verification, followed by sequencing confirmation. HO Yeast transformants with successful allele knockout; Similarly, using plasmid pUG6 as a template, PCR amplification was performed using primers shown in SEQ ID NO.3~SEQ ID NO.4 to obtain knockout box II; knocking out another... HO Alleles were used to screen for positive transformants using validation primers, ultimately obtaining... HO A diploid Saccharomyces cerevisiae strain with completely missing genes.

4. The preparation method according to claim 1, characterized in that, The method for inducing haploid strain fusion is as follows: pTetra Plasmid-induced fusion of haploid strains.

5. The tetraploid Saccharomyces cerevisiae strain prepared by the preparation method according to any one of claims 1-4.

6. The application of the tetraploid Saccharomyces cerevisiae strain as described in claim 5 in the production of ribonucleic acid.

7. A method for producing ribonucleic acid, characterized in that, Ribonucleic acid was produced by fermentation using the tetraploid Saccharomyces cerevisiae strain described in claim 5.

Images