High-expression promoter in later development stage of corn and application of high-expression promoter

Abstract

The invention discloses a high-expression promoter in the later development stage of corn and application of the promoter. The nucleotide sequence of the promoter is shown as SEQ ID NO.1 and / or SEQ ID NO.2. It is verified that the promoter drives a target gene to be highly expressed in the later development stage of corn, and the promoter can be used for cultivating different new corn varieties by conducting gene modification on corn.

Description

Technical Field

[0001] This invention belongs to the field of biological breeding technology, and more specifically, relates to a promoter that is highly expressed in the late stage of maize development and its application. Background Technology

[0002] The statements in this section are merely background information related to the present invention and do not necessarily constitute prior art.

[0003] Promoters are DNA sequences that RNA polymerase specifically recognizes and binds to, controlling the initiation time and extent of gene expression (transcription), acting like a "switch" to determine gene activity. Based on transcription patterns and functions, promoters can be classified into three categories: constitutive promoters, tissue- or organ-specific promoters, and inducible promoters. Currently, most promoters used in plant genetic engineering are constitutive promoters, which function in all tissues or organs, enabling the expression of foreign genes in all plant tissues or organs. These promoters cannot control the specialized expression of genes and excessively consume intracellular resources and energy, resulting in unnecessary energy waste.

[0004] As my country's largest crop, maize is an indispensable source of food and feed, and research on its yield has always been of paramount importance. The later stages of maize development are key factors determining yield and grain quality; gene expression patterns during these stages determine grain traits and influence final yield. An increasing number of researchers are analyzing gene expression in maize through transgenic methods or other means. However, the lack of promoters capable of controlling high gene expression in the later stages of maize development has severely hampered progress in gene expression research within maize grains.

[0005] Currently, very few maize late-stage development-specific promoters have been identified and reported. Therefore, it is necessary to find more promoters that can be highly expressed in the late stages of maize development in order to control the expression of target genes in the late stages of maize development. This is of great significance for the regulation of maize grain traits and yield, as well as for breeding improvement research. Summary of the Invention

[0006] To address at least one deficiency or improvement need in the existing technology, this invention provides a promoter for maize kernel-specific expression and its application. The purpose is to provide a promoter that can precisely control the high expression of the target gene in the later stages of maize development, which is of great significance for studying maize kernel traits and breeding new maize varieties.

[0007] To achieve the above objectives, according to one aspect of the present invention, a promoter is provided, the nucleotide sequence of which is shown in SEQ ID NO.1 and / or SEQ ID NO.2.

[0008] Preferably, the promoter drives the target gene to be highly expressed in the later stages of maize development.

[0009] Preferably, the nucleotide sequence of the target gene is as shown in SEQ ID NO.3 or SEQ ID NO.4.

[0010] According to a second aspect of the invention, an expression box is also provided, comprising the promoter as described in claim 1.

[0011] According to a third aspect of the invention, a recombinant expression vector comprising the promoter of claim 1 is also provided.

[0012] According to a fourth aspect of the invention, a host cell is also provided, the host cell containing the above-described expression vector.

[0013] The above-mentioned promoters, expression cassettes, recombinant expression vectors, and host cells are used to improve the moisture content or starch content of maize kernels.

[0014] In summary, compared with the prior art, the above-described technical solutions conceived by this invention can achieve the following beneficial effects:

[0015] This invention is the first to discover and screen promoter sequences located on genes ZmMYBST1 and ZmMYBR43, respectively. These promoters can efficiently drive the high expression of the target gene in the later stages of maize development. Compared with common constitutive promoters such as 35S and Ubi, the promoters of this invention can precisely control the high-efficiency expression of the target gene in the later stages of maize development, thereby regulating the traits of maize kernels without affecting maize yield in the early stages of development. This is of great significance for regulating maize kernels and breeding new maize varieties with different kernel traits. Attached Figure Description

[0016] Figure 1 This diagram illustrates the expression of the ZmMYBST1 gene at different developmental stages of maize kernels, as provided in this invention. The horizontal axis represents different tissues, and the vertical axis represents the expression level.

[0017] Figure 2 This diagram illustrates the expression of the ZmMYBR43 gene at different developmental stages of maize kernels, as provided in this invention. The horizontal axis represents different tissues, and the vertical axis represents the expression level.

[0018] Figure 3 This is a diagram illustrating the in situ hybridization expression pattern of the promoter provided in this embodiment of the invention in 30DAP seeds. The top, middle, and bottom rows are representative slice images of the seed, aleurone layer, and placental bud, respectively. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Furthermore, the technical features involved in the various embodiments of this invention described below can be combined with each other as long as they do not conflict with each other.

[0020] In the description of this invention, it should be understood that the term "maize" refers to any maize plant and includes all plant varieties that can be bred with maize, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in an amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the essential information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide,” “polypeptide,” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of naturally occurring amino acids that can function in a similar manner to naturally occurring amino acids.

[0021] The term "trait" refers to the physiological, morphological, biochemical, or physical characteristics of a plant or a particular plant material or cell. In some cases, this trait is visible to the human eye, such as seed or plant size, or can be measured by biochemical techniques, such as detecting the protein, starch, or oil content of seeds or leaves, or by observing metabolic or physiological processes, such as by measuring tolerance to water deprivation or specific salt, sugar, or nitrogen concentrations, or by observing the expression levels of one or more genes, or by agronomic observations such as tolerance to osmotic stress or yield.

[0022] "Plant" includes indexes for whole plants, plant organs, plant tissues, seeds, and plant cells, as well as their offspring. Plant cells include, but are not limited to, cells from seeds, suspension cultures, plumules, meristematic regions, callus, leaves, roots, seedlings, gametophytes, sporophytes, pollen, and microspores. "Offspring" includes any subsequent generations of a plant.

[0023] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell.

[0024] Negative or control plants may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetic modification starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.

[0025] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.

[0026] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, rachis, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.

[0027] In the context of nucleic acid amplification, the term "amplification" refers to any process in which an additional copy of a selected nucleic acid (or its transcribed form) is produced. Common amplification methods include replication methods based on various polymerases, including polymerase chain reaction (PCR), ligase-mediated methods such as ligase chain reaction (LCR), and RNA polymerase-based amplification methods (e.g., via transcription).

[0028] Example 1: Obtaining and Cloning the ZmMYBST1 and ZmMYBR43 Promoters

[0029] 1. Maize RNA extraction and RNA sequencing

[0030] Tissue samples from different parts of maize were cryopreserved in liquid nitrogen, and total RNA was extracted using the Huayueyang Plant RNA Extraction Kit (Huayueyang Biotechnology Co., Ltd., catalog number ZH120). Genomic DNA was removed by treatment with RNase-free DNase I (Huayueyang Biotechnology Co., Ltd., catalog number ZH0146).

[0031] After extraction, the samples were run on a 1% agarose gel for analysis, requiring no protein contamination, i.e., no obvious bright bands in the wells of the agarose gel. Nucleic acid concentration was detected using a NanoDrop Spectrophotometer; the concentration was 411 ng / µl for logarithmic phase samples and 227 ng / µl for stationary phase samples, meeting the sequencing requirements of no significant protein contamination and a nucleic acid concentration >60 ng / µl.

[0032] After RNA extraction, Illumina library construction and sequencing were performed.

[0033] 2. Transcriptome analysis and promoter screening

[0034] Cleaned sequencing data were obtained using Cutadapt, and then aligned with a maize reference genome using RSEM v1.3.3 in conjunction with Bowtie v2.4.1 to calculate gene expression levels. The Illumina NovaSeq 6000 platform was used for single-end reads to generate sequencing data.

[0035] like Figure 1 , Figure 2 The figures show the expression levels of the ZmMYBST1 and ZmMYBR43 genes provided in this invention at different developmental stages in maize. The horizontal axis represents different tissues, and the vertical axis represents the expression level. Figure 1 and Figure 2 The results showed that the expression levels of the ZmMYBST1 and ZmMYBR43 genes were among the highest in the later stages of maize kernel development.

[0036] 3. Promoter region screening and PCR amplification of promoter sequences

[0037] By consulting literature or using promoter prediction software, the promoter regions of ZmMYBST1 and ZmMYBR43 were predicted, and a 1000bp sequence in the ZmMYBST1 and ZmMYBR43 genes was finally determined as the promoter sequence. The ZmMYBST1 promoter sequence is shown in SEQ ID NO.1, and the ZmMYBR43 promoter sequence is shown in SEQ ID NO.2. Primers were designed to amplify the promoter sequences by PCR, and the sequences were ligated into the blunt-ended vector pEASY to construct recombinant expression vectors for the promoters of the ZmMYBST1 and ZmMYBR43 genes, respectively.

[0038] 4. Agrobacterium-mediated stable transformation of maize

[0039] 1) Take corn ears that have been pollinated for about 10 days, remove the husks and silks to extract the embryos, ensuring that the diameter of the embryos is 1.5-2mm. Sterilize the ears in 5% sodium hypochlorite for 30 minutes and wash them three times with sterile water.

[0040] 2) Carefully peel off the embryo in a clean bench and place it into a 2.0 mL centrifuge tube containing liquid culture medium.

[0041] 3) Scrape Agrobacterium cells from YEB medium into liquid infection medium and incubate at 28℃ for 1-2 hours until OD550 = 0.35-0.40, then it can be used for infection.

[0042] 4) Wash the embryo twice with liquid infection medium, discard the medium and add 1.5 mL of prepared Agrobacterium, invert and mix 20 times, and let stand in the dark for 5 min.

[0043] 5) Pour the embryos into a petri dish lined with 3 sheets of sterile filter paper. After the bacterial solution is absorbed by the filter paper, transfer the embryos to a co-culture medium and incubate in the dark at 24°C for 3-4 days.

[0044] 6) Transfer the embryos to recovery medium and incubate in the dark at 28°C for 7-10 days.

[0045] 7) Transfer the embryos to the selection medium and culture them in the dark at 28°C. Subculture once every 2 weeks.

[0046] 8) After 2-3 generations of screening, resistant calluses with significant proliferation will appear. These resistant calluses will be isolated and further propagated on the screening medium.

[0047] 9) Select callus in good condition and transfer it to regeneration culture. Culture it in the dark at 28℃ for 10-14 days. During this stage, embryoids will form.

[0048] 10) Transfer the induced embryoids to rooting medium and culture at 25°C under light. At this stage, regenerated seedlings will be produced. Once the seedlings grow to 3-5cm, transfer them to glass tubes containing rooting medium and continue to culture at 25°C under light.

[0049] 11) Once the seedlings have grown to 12-15cm, transplant them into the greenhouse.

[0050] Example 2: In situ hybridization experiment of ZmMYBST1 and ZmMYBR43 promoters

[0051] The primers for in situ hybridization probes are shown in Table 1:

[0052] ZmMYBST1in_F1 GGAGACAGTGTCTACTTCTC ZmMYBST1in_R1 cattaatacgactcactatagggACGGAGAAGCTACTTCCAAC ZmMYBST1in_F2 GTAGCTTCTCCGTATTTGCG ZmMYBST1in_R2 cattaatacgactcactatagggCCATGCGTGCCATACAAACT ZmMYBR43in_F1 CCTGGTCAGGAAACGGTGTC ZmMYBR43in_R1 cattaatacgactcactatagggCAGAGCACGGTCAATCTTAC ZmMYBR43in_F2 GCTTCCGCACAGAAACTGCA ZmMYBR43in_R2 cattaatacgactcactatagggGATCAGCACTAACATTATGAG

[0053] Maize kernels from the 30DAP inbred line B104 were fixed in a 4% paraformaldehyde solution (4g paraformaldehyde dissolved in 100mL 1×PBS, pH 6.5–7.0) for mRNA in situ hybridization.

[0054] In vitro transcription: Transcription was performed using an in vitro transcription kit (Roche, catalog number 10999644001). For specific instructions, please refer to the kit's instruction manual.

[0055] Preparation and experimental procedure of in situ hybridization probes:

[0056] In situ hybridization probe 50-100 ng / μL; (T7) anti-sense (Sp6) sense.

[0057] 1. Material fixation: 30DAP kernels of maize inbred line B104 were fixed in 4% paraformaldehyde solution (4g paraformaldehyde dissolved in 100mL 1×PBS, pH 6.5-7.0).

[0058] 2. Dehydration: (preferably at 4℃ with gentle shaking) 30%, 50%, 70% (materials can be stored at 4℃ for up to 6 months in this step), 85%, 90%, 100%, 100%, 100% ethanol, 0.5-1 hour per step. If the seeds are 20-25 days after pollination, the time can be increased to 2-3 hours.

[0059] 3. Transparent: (at room temperature and with gentle shaking) 25% xylene-75% ethanol, 50% xylene-50% ethanol, 75% xylene-25% ethanol, 100% xylene, 100% xylene, 0.5-1 hour per step. If the seeds are 20-25 days after pollination, the time can be increased to 2-3 hours. 50% xylene-50% paraffin (melted), overnight at 42℃.

[0060] 4. Wax impregnation: 100% pure wax, kept at 60℃ for 3 days, with the pure wax being replaced 6 times during this period.

[0061] 5. Embedding: After embedding, the material should be cooled rapidly and stored at 4°C for a short period of time.

[0062] 6. Sectioning: Section to 5μm.

[0063] 7. Spreading the slides: Add DEPC treatment water to the slides, place the wax strip on the water, absorb the excess water after spreading, and bake the slides at 42℃ for 1-2 days.

[0064] 8. Dewaxing and rehydration: 100% xylene at room temperature for 10 minutes, 100% xylene at room temperature for 10 minutes, 50% xylene-50% ethanol at room temperature for 2 minutes; 100% ethanol, 100% ethanol, 90% ethanol, 70% ethanol, 50% ethanol, 30% ethanol, 10% ethanol, H2O, 2 minutes per step at room temperature (prepare the ethanol gradient when 100% xylene is at room temperature for 20 minutes, then preheat the Kbuffer).

[0065] 9. Proteinase K treatment: After preheating the K buffer at 37℃, add PK (stock solution concentration of 10 mg / mL) to a final concentration of 2.5 μg / mL, and treat at 37℃ for 15 minutes. Wash three times with DEPC-treated water at room temperature, 2 minutes each time.

[0066] 10. Acetylation: In 100 mM triethanolamine at pH 8.0 for 10 min. Then add acetic anhydride to a final concentration of 0.25% (m / V), incubate at room temperature for 10 min, repeat 2×SSC, incubate at room temperature for 5 min, twice.

[0067] 11. Dehydration: 10% ethanol, 30% ethanol, 50% ethanol, 70% ethanol, 90% ethanol, 100% ethanol, 100% ethanol, 2 minutes per step at room temperature, dry the slides at 42℃ for about 1 hour. After this step, hybridization can be performed immediately or stored at -20℃ for a period of time. (At this time, prepare 0.3M NaCl-50% formamide to create a humidified chamber and prepare the hybridization solution).

[0068] 12. Hybridization: Hybridization solution A 77.2 μL; Hybridization solution B 22.8 μL (1 μL RNA probe + 17.8 μL LEPC water + 1.5 μL tRNA + 2.5 μL L PolyA), denature at 80℃ for 5 minutes, immediately place on ice, preheat hybridization solution at 42℃, 100 μL / slide, spread evenly on a glass slide, cover with Parafilm membrane, place in a humidified chamber with filter paper saturated with 0.3M NaCl-50% formamide, hybridize overnight at 50-55℃.

[0069] 13. Wash slides: 40 mL of 2×SSC preheated to 37℃ for 20 minutes at room temperature, three times.

[0070] 14. RNase A treatment: Preheat RNase buffer to 37℃, add RNase A to a final concentration of 25 μg / mL, place the slide in the buffer and incubate at 37℃ for 30 minutes. (Add 100 μL of 10 mg / mL RNase A to 40 mL of RNase buffer).

[0071] 15. Wash RNase A: Wash twice with RNase buffer preheated at 37°C for 10 minutes.

[0072] 16. Low / High Strict Washing: 2×SSC (650mL) at room temperature for 30 minutes, 0.5×SSC at 55℃ for 30 minutes. Stir with a small rotor at low speed during washing.

[0073] 17. Wash slides: 1×PBS at room temperature for 5 minutes (this step can be done overnight at 4°C).

[0074] 18. Blocking: Block in 0.5% blocking solution at room temperature for 60 minutes. (Prepare fresh with Blocking Reagent and 1×PBS).

[0075] 19. Wash slides: 1×PBS at room temperature for 5 minutes.

[0076] 20. Antibody incubation: anti-DIG-AP (1:500 dilution) (1μL anti-DIG-AP + 50μL 10mg / mL BSA + 450μL 1×PBS) incubate at room temperature for 60-120 minutes with filter paper saturated with 1×PBS in a humidified chamber.

[0077] 20. Washing: 1×PBT (650ml) at room temperature for 10 minutes, three times. Stir with a small rotor at low speed during washing.

[0078] 21. Develop film: 1×TNM50 for 5 minutes at room temperature.

[0079] 22. Color development: Develop 2% NBT / BCIP (prepared with TNM50) in the dark at room temperature for at least 30 minutes.

[0080] 23. Termination: The reaction is terminated in TE.

[0081] 24. Examine under a microscope, add glycerin to prevent drying, and take a photograph.

[0082] 25. Mounting: Treat the slide sequentially with 30%, 50%, 70%, 85%, 95%, and 100% ethanol at room temperature for 2 minutes each. Then treat twice with xylene at room temperature for 5 minutes each time. Add neutral resin, carefully cover with a coverslip, and wash away any resin that overflows around the edges of the slide with xylene.

[0083] After baking the slides at 26°C and 42°C for 2 days, they can be examined under a microscope and photographed. The hybridization signal was observed using a microscope (Nikon, SMZ25).

[0084] The results are as follows Figure 3 As shown, the ZmMYBST1 and ZmMYBR43 promoters provided by this invention are mainly expressed in the later stages of maize development (indicated by arrows), with specific expression sites in the embryo, aleurone layer, and placental bud. The results indicate that the promoters provided by this invention are specific promoters that are highly expressed in the later stages of maize development.

[0085] Those skilled in the art will readily understand that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0086] SEQ ID NO.1

[0087] ATGTGCCTGGTCTAAAAAAAGAAGTATTTATGTGTATTGTGTGTATACC

[0088] ATTTATACTGAGTGAAATTGTGTTTAGTTTCTACGTCCAAAGATCCTAA

[0089] ATTTATACCAAACAAGTAGAAAAGTGACACAACAAACACTTCGATAC

[0090] CAATTTTGTCACAGTTCTTTGCCCCGTCGAAGACCTACCTGCACCGTC

[0091] GACCTCCTATAGCCACGACGCCACCAGGTAAAGGCCAACCTAACCT

[0092] TAGGACGTTAGAAGAGATGAAGGACATATTTCTGCTATCATGACGACT

[0093] CGACAAATTTTGTGTTCATGTTGATTTGGACGTTTTTTGCCAAAACGA

[0094] ATCTCACAAAAATAGACTAAGAAGAAAAATGTTTGAGTGACAGAAAC

[0095] CAATTTTAAGGTGAAACGAGGCATCCCACTGAGCGATGCACTGGGAA

[0096] GTGGGAACTAAGTTAGGAACACTTGTTCCAGAAGAAAAGAAATATAC

[0097] CTCCATGTCCTGAAACAGATGGGAAACGAACAAGATCGAGTGGTTGG

[0098] CCATTGCTCAGTGTGTCAGACGGTGAAACGGGCAGGAAAATGAAGTT

[0099] GAAAACGAAACCACAGGAGACCAGAGGCGAGCGCGCACGCGGCCCG

[0100] CAACTGTGTCCACTGGATAAACGGCCAGGCACAGAGGAGAGGAACC

[0101] AGTCAGGAAGGGAGGCGTGCCCCACAAGCCGCTGCCCGAGTCCCCC

[0102] ACGCACACGTATTTCCGCGCAAGAATATCCGCCACGTGGACGGCCCA

[0103] CGCTCGCCGACCACCTTAACCAATCACCACTCAACAGTTGAGTTTAAC

[0104] CCCGCCTCCTCTCCTCTCCCCTCCCCTCCCTTCTTCATCTCTTCTCCTC

[0105] ACAAGGCTTCCTCCCACCACCTCCAGTCCTCCACCGGACCACCACCT

[0106] CCAGTCCTCCACCGGACCACCACCTCCACCACTCCTCTCTCAGAACA

[0107] CGCGCAAACCGCTCGAACCCTAGCTGGTGGCGGGAGGCGGAGGTGG

[0108] CTCCGGG

[0109] SEQ ID NO.2

[0110] GCAGACGTTCGGCCCCTGGCCACGGACCATCCGCATCTCCGCAGAGA

[0111] GCACCGCCATCGGTTCTCATCGTACTGATTGGCGACCGGATCGGCGCT

[0112] AATTTTAGGATTACTAGCTTCTTAAAAACTAAGAAGCTGAACTCTCCT

[0113] AGTTAAAAGATAAAAAACTGGTTTTTTAAAAACTGGGTTCTTTTAAATA

[0114] AGACCTAAGCCTCGTTACATAAGAGCAACTCCAATAGTTATGTAAATTT

[0115] TAGCTCTCTAAATCACAGATTTAAGAGTTGCTAAAATAGCTTTTGGAG

[0116] TAAAAAATGTGAGTTCTCCAATAGTTCTCTAAATATAGGTTGTAATTT

[0117] TGTTTTGTATTTATCCACATAAAAATAAGTCACAAAAACTATAATATG

[0118] CAGTCAACATTTTTGTTTAGTGAGTTGTTAATGGTTGCCAAATGTAG

[0119] AGAGAAAATGGGGTTAGATGACAAGTTGTTAAATTTAGAAGTTCATT

[0120] TAGAGAACTATTGGGAAATAGTTTTCATGTTAACTAGCTAAATTATTGA

[0121] TTTAGAAAGTGTTTTTAGAGAACCACTGGAGTTGCTCTAAGGAAAGAA

[0122] ACGTATCGTCCAGATCTTAAACAGGAAATGGACACGATCGCAGGTT

[0123] GGTTCGCCTTTGCTCAATTTGTCAGTAAATGGTCCGAGGACCCGGCGA

[0124] TTGAGAACAAATCGGAAGGAGGCTGACGGCAGGCAGAGTGGAGCCA

[0125] GCCAGGAAGCGAGGCGTGCCCCACAAGCCGCTGCCCGAGTCCCCCA

[0126] CGCACACGTATATCCCCGCGAGAATATCCGCCACGTGGACGGCCCACG

[0127] CTCGCCGACCAGCTTAAGCAATCACCACTTAACAGTTGAGTTAACCCT

[0128] CTCCCCTCCATTCATCACCTCCTCTCCTCACACGGCTTCCTCGCACCG

[0129] GCTCCGGTCCTCCTCCCATCACCATCACCACCGTCGTTCCTCTCACGA

[0130] GTCCCGACACACGCAAACCGCACGAACCCTGGCTGGCGGCGGGSEQ ID NO.3

[0131] TCCCTTCTTCATCTCTTCTCCTCACAAGGCTTCCTCCCACCACCTCCAG

[0132] TCCTCCACCGGACCACCACCTCCAGTCCTCCACCGGACCACCACCTC

[0133] CACCACTCCTCTCTCAGAACACGCGCAAACCGCTCGAACCCTAGCTG

[0134] GTGGCGGGAGGCGGAGGTGGCTCCGGGATGACGCGGCGGTGCTCGC

[0135] ACTGCAGCCACAACGGGCACAACTCGCGGACGTGCCCCAACCGCGG

[0136] GGTCAAGATCTTCGGGGTGCACCTCACCGATGGCTCGGCCATCCGCA

[0137] AGAGCGCGAGCATGGGGAACCTCTCCCTCCTCTCCGCGGGATCCACC

[0138] AGCGGCGGCGCGTCCCCCGCCGACGGGCCCGACCTCGCCGACGGCG

[0139] GCGGGGGCTACGCCTCCGACGACTTCGTCCAGGGGTCGTCCTCCGCC

[0140] AGCCGCGATCGAAAGAAAGGTCAGCTACCGCCCGATCTCCACCCCTC

[0141] GATCATCCACCCGCTACCGCCCGATGCAGAACCCTAGATAATCCATCC

[0142] TTCCAGCTCCTCCAAGCTTTTCCACCCCTCTTAATCTTTTTAGATGCAC

[0143] CTAGTGCTCGTTGATTAGGTGCCTGTAAGTTTTAGGAAACGGGTACGA

[0144] CTCCAGAGAGAGAACATTAATGGTGGTACAACTACCACACTGCGAGT

[0145] ACGACTATTCTATGGATATTGTACTAGTTGACTCGATACGTATGGTACTC

[0146] GAAACTCGAGTTCAACCCCTAACTGGTACAATGACCACCTATGGAGG

[0147] CCCTGTACTGTTTTAGTTAGGCCATGCGGATGCTTTAAGAAGCTCATCT

[0148] ATAGAAACTTTTAGAATATGGGTTATGCATTGTTCCAATCAGCGGCATC

[0149] AGTTGATTTTGATGAAATTTGTCACGGGTTTGCGACGCTGAATAGCTG

[0150] TGGAGGACTGGAGGTATAGAGAGATGCGTAGTCAGAGGTATAGGGCT

[0151] GCGTTATCAGGAAGGATCTGCCGAGCAATTGAAACTGCTGCGCTAACT

[0152] GCTGACGCGTAGTCTTATGTATGCCATACATGCGCCAATGGCCAAGGT

[0153] CTGGTGTAAATGTGCTACTGCACTGGGATGTAATTACTATTACGCAGTG

[0154] CCAAGTAACGGCTGTCCATACTTGATAAGGAGACACGTTTTTTCACAT

[0155] GTTATGGGGAAATAAAAATAAAATGCTTGATAAATGACTACCAATGTT

[0156] CTGCAAGTTTTATCTCTATTGTTATTATTGCTGCTGATTCTTGTGAGATT

[0157] TTTTATGCGAACAATGATAGCTAGATCTTGGTTTACACTTGGTGGTGGG

[0158] TGGTAGCTGTTTTAGTTTGAGTCAACTGGCACCTTCTTCAGATTATGCC

[0159] CTTTTTTAGCTCTCCTCTGATTTCGTGCTGTTTGGCTATTCTTCTATTTG

[0160] TCAATGGCACCCTTCCTATATGATTTGTTCAACAGCAAAGTGGCGGTG

[0161] CTAACTTTTACCATGCTCTGTTAATATGCTGCTGTTGATTCATTTCAGTT

[0162] CACTGTCTTCTTGTAGCTACACATATTGCTGCCTGCCTTCATGGCTGCA

[0163] TTTTGGGCTTTCTATGCCATGTTGCTGATTAAGGTTGCTCTGACAGGTG

[0164] TTCCTTGGACTGAAGAAGAACACCGGAGGTTTTTGCTGGGATTACAA

[0165] AAGCTCGGGAAAGGGGATTGGCGAGGAATTTCTCGTAATTTTGTGGTC

[0166] TCAAGAACACCTACTCAAGTAGCAAGTCATGCTCAAAAGTATTTTATA

[0167] CGCCAATCAAATATGAGCAGAAGGAAGAGAAGGTCTAGCCTTTTCGA

[0168] CATGGTTCCTGATGAGGTAACTTGCTTTGGTCTTAGTCTTCATTTCTACA

[0169] CAAATATTGCTTGCTATGGCCTTGTTTTATACCTATGCATGTGTTGTAAC

[0170] TACATTATTGCTCTTTTTGTAGTAATATTTATCATATTACTTATACTAGT

[0171] GCAACTTTTTGGATCTAGTTCTGCAGCTTGTATGTTTTCCTGGCAGTCA

[0172] CTGTTTGCTGTTTAAACAGAGTGTAAATGGTAAAAGGCTAACTGTGCC

[0173] ATTTAGGCCGTAACGTTCCATTAAATGGTTGGACCGTTGAAACCATAA

[0174] AAAATTGTCTGAACAGCTTAAACAGAATAAAGTTAAACATGAGTTAAT

[0175] GGGCTAAATTGCCGTTTAACTCACCGTTTAGTCAATAGGTAGATTATAA

[0176] CAATCACAGTGGCACCAAATTAATTGACATTGTAATTTAACTCACCGTT

[0177] TAGTTAATAGGAGGATTATAACTATCACATTGTCCTGTTTAGTAGAGTT

[0178] CGACTTCTTGATTCGTTTAGAGTGATTTAGAAGTGATTTTGTTGGGGAT

[0179] AAAACGCAGATCGGTCAGGGTGGGATTTTTTAGCCGTTTGGCTGTCTA

[0180] GGAGCGATTCTCACAGAGAATATGGAGCTGTGAGCGCTTCCTTGTGGC

[0181] TTGTGCTTTGCATATAATTTGTGAACTGTGTTCTGTTTGTTTTACAGTC

[0182] CATGGACCTTCCGCCCCTTCCTGGAAGTCAAGAACCAGAGACCTCAA

[0183] TGTTAAATCAACCGCCACTGCCTCCTGCTGTGGAGGAGGAGGTGGAA

[0184] TCGATGGAGTCAGATACTTCTGCTGTCGCAGAGAGTTCTGGAGCTTCT

[0185] GCTCTCATGCCCGAGAGTTTACAGCCTACCTATCCGATGATTGTTCCAG

[0186] CTTATTTCTCGCCGTTCTTGCAATTCTCAGTTCCTTTCTGGCCAAATCA

[0187] GGAAGATGGAGGCGATCTTCCCCAAGAAACACACGAGATTGTCAAGC

[0188] CTGTTGCAGTTCATTCCCAGAATCCAATTAATGTTGATGAACTCGTGG

[0189] GCATGTCAAAGCTAAGCATATGGGAGCATGGTCAGGAGACAGTGTCT

[0190] ACTTCTCTGTCGCTAAATCTGCTAGGGGGTCAAAATAGGCAGTCGGCT

[0191] TTCCATGCAAACCCTCAAACAAGAGCTCAAGCCTGATCATCCCCTACC

[0192] AGCACAGAAACTGCATTTTAGATGGAATCCTGGGCAAAATAAGCTTTG

[0193] CTCTTTTTTCTTCTTCTAAATTTAAGATCACTGAGTCATAAGGTCACTG

[0194] GTTCGAAGTAGCTTCTCCGTATTTGCGGGGAAAGCCTGCCCTGGTTTC

[0195] TCTCCTTCATCAGACCCCACTCATATGGGAGCCTTCAATATTGTCTTTT

[0196] TTATATTTAAGATTGACCGTGCTCGGTAGCTTGTATCATGTGCTGTAA

[0197] GTTATGCTATGTATGAATGTACCTGTAGTTTGTATGGCACGCATGGTATG

[0198] CCACTCTTATGTTAGCAAAGTCATTAATGTTAGTGCTGATCTTTATGGT

[0199] TGTAATTTTATAAACTTCTAAAAAAAAGTAAGCCAGTTCTTTTCAAC

[0200] TG

[0201] SEQ ID NO.4

[0202] GCACCGGCTCCGGTCCTCCTCCCATCACCATCACCACCGTCGTTCCTC

[0203] TCACGAGTCCCGACACACGCAAACCGCACGAACCCTGGCTGGCGGC

[0204] GGGATGACGCGGCGGTGCTCGCACTGCAGCCACAACGGGCACAACTC

[0205] GCGGACGTGCCCCAACCGCGGGGTCAAGATCTTCGGGGTGCGCCTCA

[0206] CCGATGGCTCGGCCATCCGCAAGAGCGCAAGCATGGGGAACCTCTCC

[0207] CTCCTCTCCGCGGGGTCAACCAGCGGCGGCGCGTCGCCCGCCGACGG

[0208] GCCCGACCTCGCCGACGGCGGCGGGGGCTACGCCTCCGACGACTTCG

[0209] TCCAGGGGTCGTCCTCCGCCAGCCGCGAGCGTAAGAAAGGTCAGTTA

[0210] CCGCCCGATCTCTGCCCCCTCCTCTCGAATCGATCATCCACCCGCTACC

[0211] ACTCGATGCAGAACCCTAGATAATAGATCCTTCCAGCTCTAACCAGCT

[0212] CCAAGTTTTTCCATTCATTTCTCTCCTGCCTACTCGGCTTACTCTTTTTA

[0213] GATGCACCTAGTGGCTAGTGCTCACTGATTAGGTACCTGTAAGGTTGG

[0214] GAAACGGGTACTGCACCGGCTGAGAGAAAATCATTAATGGTAATACC

[0215] ACACTGTGCTGAGTACTACTATTGTATCGATATTGTACTAGTTGAGTTG

[0216] ATACATATGGTACTCGAATTCAGCCCCTGACTGGTGCAAGGACCACCT

[0217] GCCCTATGTCGTTTGACTGGGTCATGGGGATAATTTAACAAACTCAGC

[0218] TCTAGAAACTTTTAGAAAATGGGTTATGGATTGCTCCAAGCAGTGGTG

[0219] TCAGTTGATTTTGATGAAATTTGTCACTGATTCGTTATGCTGAATGGCT

[0220] GTAGAGGCATAGAGGGCTGCGTAATCAAAGGTACAGGGCTGCGTAAT

[0221] CAGGAAGGATATGCCGAGCAATTGAAACCGCTGCGCTAACTGCTGAA

[0222] ACGTTGTCTTATGTATGCCATACATGTGCTAATGGTCACGGTCTGGTGTGT

[0223] AATGTGCTACTGCACTGGGATGTAATTACTATTACACAGTGCCATATTC

[0224] CGGCTGCCCATACTTGATAAGGAAACAAGTTTTTTCATATGTTATGGGG

[0225] AAAAATCAAATGCTTGATACATGAATACCAATGTTCTGCAAGTTTTATC

[0226] TTTATTGTTAATTATTGCTGCTGATTCTTGTGAGATTTTTACACGAACA

[0227] GTGATATCTAGTTCTTGGGTTACACTTGGTGGTGGGTGGTAGGTGTTTT

[0228] AATGTAAGTCAAGTGGCAAGAAAAGGGCAAACACAGTGCCGGAGGC

[0229] TCCCACATGAGTGGGGTCTGCGGAAGGGATAAACCGAGGCAATCCTG

[0230] TAGGGTCTAAGAAAAGAGTAAAACTGAGTCAAACCTTCCCCCATAAA

[0231] TACAGAGAGGTTGTTTCAAACTCGGACTGGGTGACTCATGAGACAGC

[0232] TCTCACCACTACACTAGGCCTGCCCTTCAATGTAAGTCAAGTGGCACC

[0233] TTCTGCATATTATGCCCATCTCTGTTCTGATTTTGTGCTGTTTGGCTAGT

[0234] CCTCTGTTTGTCGATGACACCCTACCTATATGATTTGTTTAACAGCAAG

[0235] GTGGTGATGCTAACTTTTACCATAGTCTGTTAATATGCTGCTGTCCATT

[0236] CCTTTCTGTTCACTGGTTTCTTGTTGCTTCACATATTGCTGCCTACCTG

[0237] CATGGCTGCATTGCTGATTGAGGTTGCTCTTACAGGTGTTCCTTGGAC

[0238] TGAAGAAGAACACCGGAGGTTTTTGCTGGGATTACAAAAGCTTGGGA

[0239] AAGGTGATTGGCGAGGGATTTCTCGTAATTTCGTGGTCTCAAGAACAC

[0240] CTACTCAAGTAGCAAGTCATGCTCAAAAATATTTTATACGTCAATCAAA

[0241] TATGAGCAGAAGGAAGAGAAGGTCTAGCCTTTTTGACATGGTGCCTG

[0242] ATGAGGTAACTTGCTTGATTTACCTTGATTGCTTGCTTTTGCCTTGTTT

[0243] TGTACTCATACATGTGTTGTAACTACACTATTGCTTTTTTTGTAATAAAT

[0244] ATCATATTACTTATACTTGTGCAACATTTTGGATCTAGTTCAGTCGCTTG

[0245] TATGTGTTACTGACACTCATTGTTGCCTGTTTAAACATTGTGTAAATGG

[0246] TAAAAGGCCAGCTGTGTCATTTAGGCCTTAAACGTTCCATCAAATGGT

[0247] TGGACTGTTTAAACTGTACGGTCTAAATGGCTTAAACATGATTAAATG

[0248] GTTTAATTGCTGTTTAACTCACTGTTTATTCAACAGGCAGATTACAAC

[0249] TATCGCATTGGCACCATACTAATTAACATTGTAAGAGTGGAATTTAGTT

[0250] CCTTTCCTCAATTTTTTTTGCTAGGATACATATTTTTTACATATGTAAAT

[0251] GTGTATACTTTCTGGTATATGTATGTTTGACTTTTGCATACATAAAATAT

[0252] GTATATTTTAGTGGTACTATACAAAAGCGTTTAGATCGTTTAACTCAGT

[0253] TTAAACACCGTCTAAACAGTGAACACTGGGTGACCAACTGTTTACTGT

[0254] TTAGCATTTAGATAACACTGGTGACGGTTATGCGCAGTGTCCTATCCTT

[0255] GATCTCATTAGGTAGTTCTTACGGCCTGTTTGGTAGAGCTTTATTTGTT

[0256] GATTCTTAATTCTAGCAATTTTGATGGGGAAGTAGGTCAGAAGTGATT

[0257] TAGAGTGATTCTGGTGGGGATTAAATGAAGTGGTGGAGAGGAATTTTC

[0258] TGTAGCCATTTGGCTGTCCAGGAGTGATTCTCACAAGAATCTGGAGCT

[0259] GGGAGCAATTACTAGTGCTTTGCATATAATTTGAACTGAGCTGTGCTCT

[0260] GTTTGTTTTACAGTCCATGGACCTTCCACCCCTTCCTGGAAGTCAAGA

[0261] GCCAGAGACCTCAGTGTTAAATCAACCACCACTGCCTCCCCCTGTGG

[0262] AGGAGGAGGAGGAGGTGGAATCGATGGAGTCAGATACTTCTGCTGTT

[0263] GCGGAGAGTTCTGCAGCTTCAGCTCTTATGCCCGAGAGTTTACAGCCT

[0264] ACCTATCCGATGATTGTTCCAGCTTATTTCTCACCGTTCTTGCAATTCT

[0265] CAGTTCCTTTCTGGCCAAATCAGGAAGATGGAGGTGATCTGCCTCAA

[0266] GAAACGCACGAGATTGTCAAGCCCTGTTGCAGTTCATTCCAAGAATCC

[0267] AATTAATGTTGATGAACTTGTGAGCATGTCAAAGCTAAGCATAGGGA

[0268] GCCTGGTCAGGAAACGGTGTCTACTTCTCTGTCGTTAAATCTGCTGGT

[0269] GGGTCAAAATAGGCAGTCGGCCTTCCATGCAAATCCTCAAACGAGGG

[0270] CTCAAGCTTGATCCCGCTTCCGCACAGAAACTGCATTAAGAAGGATTC

[0271] CCTCTCTTTTTTTTTTCTATATGTAAGATTGACCGTGCTCTGTAGCTTGT

[0272] ATCATGTTGTAAGTTATGCTATGTATGAATGTACCTGTTGTTTGTCTGGC

[0273] ACGCATGACATGCCACTCATGATAACAAACTCATAATGTTAGTGCTGAT

[0274] CTTTATGGTTGTAATGTTGTAAACTTTTCTGAGAGAAAAAAACGTACT

[0275] AGCCAGTTGTTTTC

Claims

1. A promoter, characterized in that, The nucleotide sequence of the promoter is shown in SEQ ID NO.1 and / or SEQ ID NO.

2.

2. The promoter as described in claim 1, characterized in that, The promoter drives the target gene to be highly expressed in the later stages of maize development.

3. The promoter as described in claim 2, characterized in that, The promoter drives the target gene to be highly expressed in the embryo, aleurone layer, and placental bud.

4. The promoter as described in claim 2, characterized in that, The nucleotide sequence of the target gene is shown in SEQ ID NO.3 or SEQ ID NO.

4.

5. An expression box, characterized in that, It includes the promoter as described in claim 1.

6. A recombinant expression vector, characterized in that, It includes the promoter as described in claim 1.

7. A host cell, characterized in that, The host cell contains the expression vector as described in claim 3.

8. The use of the promoter according to claims 1 to 3, the expression cassette according to claim 4, the recombinant expression vector according to claim 5, and the host cell according to claim 6 in improving maize kernel traits.

Images