Accurate and efficient DNA-free gene editing method

By combining a combination of dual sgRNA and helicase with the DNA damage repair regulatory molecule LY294002, precise gene editing was achieved across different pig breeds, solving the problems of random mutations and the safety risks of exogenous DNA in existing technologies, and producing a homozygous DNA-free gene-edited pig population.

CN121801900APending Publication Date: 2026-04-07BEIJING SHOUNONG CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-11
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing gene editing technologies have problems in animal breeding, such as random mutations, safety risks associated with exogenous DNA, and difficulty in quickly obtaining homozygous gene-edited animals, especially in achieving consistent mutation types across different strains.

Method used

A combination of dual sgRNAs, helicase, and the DNA damage repair regulatory molecule LY294002 was used to design specific sgRNAs for precise editing at target sites, and combined with the DNA damage repair regulatory molecule to achieve gene editing of the same mutation type.

Benefits of technology

Precise editing of the same mutation type was achieved in different pig breeds, resulting in a homozygous DNA-free gene-edited pig population. This avoided the presence of exogenous DNA and improved breeding efficiency and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121801900A_ABST
    Figure CN121801900A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene editing, in particular to an accurate and efficient DNA-free gene editing method. According to the gene editing method, a nucleic acid editing composition is adopted to perform gene editing on an organism; the nucleic acid editing composition comprises a first sgRNA, a second sgRNA, helicase and a DNA damage repair regulating molecule, the first sgRNA and the second sgRNA are used for causing preset mutation; the helicase comprises one or more of DDX17, BLM or UPF1, and the helicase comprises one or more of the DDX17, the BLM and the UPF1; and the DNA damage repairing and regulating molecule is LY294002. According to the gene editing method provided by the invention, accurate and efficient mutation of the gene can be realized through the specific nucleic acid editing composition, so that gene editing groups of the same type can be rapidly created, and the gene editing method has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene editing technology, and in particular to a precise and efficient DNA-free gene editing method. Background Technology

[0002] In recent years, bio-breeding technology has fully entered the era of molecular / whole-genome breeding and is rapidly transitioning into the era of gene editing breeding. The emergence and iterative updates of gene editing technology can effectively achieve the editing of specific genomes. In particular, the advent of the third-generation technology CRISPR / Cas9 is currently considered the simplest and most efficient gene editing method. The working principle of CRISPR / Cas9 gene editing technology is that the Cas9 protein cuts the target gene to form a double-strand gap, and then performs targeted repair to achieve the purpose of modifying the gene fragment. However, this repair is uncertain, introducing random insertions and deletions. Since most human genetic diseases and differences in many important traits of animals and plants are caused by single nucleotide variants (SNPs), precise single base correction technology was born out of this urgent need.

[0003] Over the past decade, research has led to the development of several gene editing technologies. One is the CBE single-base editor, based on Cas9 and cytosine deaminase, enabling point mutations of CT / GA within target gene regions. Another is the ABE single-base editor, based on artificially evolved DNA adenine deaminase and Cas9 mutants, achieving point mutations of AG / TC within target gene regions. Subsequently, a PE editor, based on reverse transcriptase and Cas9 mutants, was developed, enabling precise deletion and insertion of various single-base mutations and small fragments. The emergence of novel single-base editors such as CGBE, dual-editing editors, and AYBE, along with new editing systems like Cas12 / 13, has continuously accelerated the development of gene editing technology.

[0004] In the field of plant and animal breeding, CRISPR technology is a more commonly used gene editing method. Researchers have obtained many high-quality crop and livestock breeds based on this technology, especially making considerable progress in the field of pig disease resistance breeding. Studies have produced CD163 gene knockout pigs and conducted challenge experiments to demonstrate that CD163 gene knockout pigs can resist type II PRRSV or HF-PRRSV virus strains. Although CD163 gene knockout can resist different types of PRRSV, the CD163 protein has other important biological functions besides mediating PRRSV infection, such as clearing hemoglobin from plasma, erythrocyte adhesion receptors, and immunomodulatory factors. Therefore, knocking out the CD163 gene may affect other functions in pigs. If only the SRCR5 functional domain of the CD163 gene-encoded protein is deleted, resulting in non-infection by the PRRSV virus, while retaining other functional domains of the CD163 gene-encoded protein, then the gene-edited pigs can be made resistant to PRRSV without affecting other physiological functions. In addition, studies have successfully produced pigs resistant to transmissible gastroenteritis (TGE) by knocking out the viral receptor gene pAPN using CRISPR technology. Other studies have used CRISPR technology to knock out the viral receptor gene ANTXR1, resulting in Seneca virus A-resistant pigs. Still other studies have successfully edited the CD46 gene using CRISPR technology, producing gene-edited cattle resistant to bovine viral diarrhea.

[0005] While CRISPR technology can be used to create gene-edited animals with different traits, these technologies currently have significant technical limitations: 1. The commonly used Cas9-based technology produces gene-edited animals with seemingly random mutations. For example, multiple research teams have generated gene-edited PRRS-resistant pigs with different mutation types, and different breeds (Large White, Landrace, Duroc) also have different mutation types. Although HR technology can achieve consistent mutations, its efficiency is very low. Furthermore, the HR process requires the introduction of a donor vector, resulting in additional DNA sequences in the genome, lacking the advantage of precise mutations and carrying the potential risk of foreign DNA. The latest PE technology, while capable of achieving multiple types of precise mutations, is currently extremely inefficient in large animal cells, severely limiting its application. 2. Commonly used techniques operate on plasmid DNA, resulting in the presence of foreign DNA in the genome of positive animals, posing potential safety issues. 3. It is difficult to quickly obtain homozygous gene-edited animals with the same mutation type in the F0 generation. For example, PRRS-resistant pigs involving random allele mutations can only obtain homozygous gene-edited animals with the same mutation type through later mating in the F1 and F2 generations. The aforementioned technical limitations significantly impact the efficiency of gene-edited biological breeding. Commercially viable gene-edited animals require different animal strains to carry the same mutation type, while simultaneously eliminating the presence of exogenous DNA. Furthermore, establishing such populations is time-sensitive, necessitating the F0 generation, which consists of homozygous edited pigs with the same mutation type. To date, no biological breeding technology system has been developed that can achieve these objectives. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention provides a precise and efficient DNA-free gene editing method.

[0007] In a first aspect, the present invention provides a nucleic acid editing composition comprising: a first sgRNA, a second sgRNA, a helicase, and a DNA damage repair regulatory molecule; the first sgRNA and the second sgRNA are used to induce a predetermined mutation; the helicase comprises one or more of DDX17, BLM, or UPF1; and the DNA damage repair regulatory molecule is LY294002.

[0008] To achieve precise editing of target sites, this invention has undergone extensive research and implementation, ultimately resulting in the above-mentioned composition system of dual sgRNA + specific helicase + specific DNA damage repair regulatory molecule. This combination can achieve the same precise editing effect on different gene targets in different pig breeds. Based on this composition, this invention has achieved precise editing of the CD46 and APN genes in Duroc, Large White, and Landrace populations, obtaining different pig breeds with the same mutation type, indicating that it has a certain degree of universality for different genotypes in different pig populations. During the research process, this invention also attempted to understand helicases DDX1, DDX19, DDX4, RECQL and DHX29, DNA damage repair regulatory molecule NU7026, Trichostatin A, MLN4924, NSC 19630, NSC 15520, AICAR, RS-1, SCR7, L755507, B02, STL127685, M3814, PIK-90 and DNA-PK-IN-15, but none of them could achieve precise editing in the same way for different animal strains.

[0009] The LY294002 described in this invention is commercially available.

[0010] Furthermore, the first sgRNA and the second sgRNA were constructed using the following method: (1) For frameshift mutations of the gene to be edited, the first sgRNA and the second sgRNA are designed in the coding region of the gene to be edited, and the distance between them is not a multiple of 3; (2) For the domain mutation of the gene to be edited, the first sgRNA and the second sgRNA are designed in the intron regions flanking the exon where the domain is located, and do not include intron splicing sites; (3) For complete knockout of the gene to be edited, the first sgRNA and the second sgRNA are designed upstream of the promoter and downstream of the terminator of the gene to be edited, respectively.

[0011] The dual sgRNA design method provided by this invention, combined with the aforementioned composition that can precisely achieve gene editing at the target site, enables controllable and precise mutation of the target gene (precise deletion of a small fragment causes a shift frame mutation, resulting in inactivation of the target gene; precise deletion of a medium fragment causes precise deletion of the target gene's specific coding function DOMAIN; precise deletion of a large fragment causes complete deletion of the target gene, resulting in precise loss of function). This allows for the creation of homozygous DNA-free gene-edited pig populations with the same mutation type from different pig breeds.

[0012] Furthermore, the first sgRNA and the second sgRNA comprise either of the following nucleotide sequences: (1) First sgRNA: 5'-GTGCTTCGTTGAGATTCTTTGGG-3', Second sgRNA: 5'-AGGCTCCTACCTGAGGGCATGGG-3'; (2) First sgRNA: 5'-ATGTTTCTTGTCGAGGGAAT-3', Second sgRNA: 5'- GATCATGTTTCTTGTCGAGG-3'.

[0013] Furthermore, it also includes: the Cas9 protein.

[0014] Further, by weight, the nucleic acid editing composition comprises: 10-40 parts of the Cas9 protein, 2-5 parts of the helicase, and 0.08-0.16 parts of the DNA damage repair regulatory molecule.

[0015] Furthermore, the DNA damage repair regulatory molecule is 0.08~0.12 μM.

[0016] In a second aspect, the present invention provides a gene editing system comprising the aforementioned nucleic acid editing composition; Preferably, it further includes: a filter mark; More preferably, the screening marker includes one or more of the following: antibiotic resistance screening marker, reporter gene, cell surface marker, or auxotrophic screening marker; More preferably, the screening marker is EGFP.

[0017] Thirdly, the present invention provides a kit comprising the aforementioned nucleic acid editing composition or the aforementioned gene editing system.

[0018] Fourthly, the present invention provides a gene editing method, comprising: performing a pre-defined mutation of a target gene on an organism using the aforementioned nucleic acid editing composition, or the aforementioned gene editing system, or the aforementioned kit; Preferably, the organism is an animal or a plant; More preferably, the organism is a pig.

[0019] Further, the preset mutation includes: transforming the first sgRNA, the second sgRNA and the helicase mentioned in the aforementioned nucleic acid editing composition into the fibroblast cell line of the organism, and then culturing it in a culture medium containing the DNA damage repair regulatory molecule mentioned in the aforementioned nucleic acid editing composition to obtain a fibroblast mutant; Using the fibroblast mutant as the donor cell, the somatic cell nucleus is transplanted into an enucleated oocyte for culture and development; preferably, the conversion is electroporation, and the electroporation conditions include: electric field strength of 1~2KV / cm and pulse time of 0.75~2ms.

[0020] Fifthly, the present invention provides the use of the aforementioned nucleic acid editing composition, or the aforementioned gene editing system, or the aforementioned kit in any of the following: (1) Gene editing in organisms; (2) Pig breed improvement; (3) Produce commercial pig herds with the same gene mutation on a large scale across different strains; Preferably, (2) includes: improvement of pig breeds in terms of disease resistance; More preferably, the disease includes one or more of transmissible gastroenteritis, reproductive and respiratory syndrome, or classical swine fever.

[0021] More preferably, the strain in (3) includes one or more of Duroc, Big White or Long White.

[0022] The present invention has the following beneficial effects: This invention provides a nucleic acid editing composition consisting of sgRNA, helicase, and DNA damage repair regulatory molecules. This composition possesses precise and rapid gene editing capabilities, enabling accurate deletion of small, medium, and large fragments of target genes without leaving any nucleic acid residue (DNA-free). The nucleic acid editing composition and corresponding gene editing method provided by this invention can efficiently and accurately prepare commercial pig populations with the same mutation pattern in different breeds, and homozygous mutant positive pig populations can be obtained in the F0 generation. This has excellent economic value in the existing pig farming industry and can be extended to cattle, sheep, and other livestock industries, providing important theoretical and technical support for the breeding of new biological varieties. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0024] Figure 1 This is a complete roadmap of innovative biological breeding technology system provided in Embodiment 1 of the present invention.

[0025] Figure 2 This is a schematic diagram of the dual sgRNA design used in Embodiment 1 of the present invention to achieve mutations in different target genes.

[0026] Figure 3 The CD46 gene-edited positive cell clones and gene-edited positive E0 pigs of three different DNA-free strains (Large White, Landrace, and Duroc) with the same mutation type (80bp homozygous deletion) provided in Example 1 of this invention were obtained.

[0027] Figure 4 The APN gene-edited positive cell clones and gene-edited positive E0 pigs of three different DNA-free strains (Large White, Landrace, and Duroc) with the same mutation type (15kb homozygous deletion) provided in Example 1 of this invention were obtained.

[0028] Figure 5 This is a diagram showing the results of the challenge experiment of the TEGV-WH-1 strain provided in Example 2 of this invention. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0030] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0031] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0032] The DMEM culture medium, 0.25% trypsin, PBS buffer, and M199 solution containing 10% (v / v) FBS used in the following examples were purchased from Gibco.

[0033] The shock buffer and shock cup used in the following examples were purchased from LOZA.

[0034] The Cas9 protein and Cas9-EGFP protein used in the following examples were purchased from IDT.

[0035] The Taq Buffer used in the following examples was purchased from Kangwei Century.

[0036] The fusion instrument used in the following examples was purchased from BTX.

[0037] The blood and tissue genomic kits used in the following examples were purchased from QIAGEN.

[0038] The helicase proteins used in the following examples were all supplied by GenScript for the preparation of prokaryotic expression proteins.

[0039] Example 1 In this embodiment, an innovative biological breeding technology method (such as...) Figure 1 (As shown) includes: I. Substances used for CD46 biallelic mutations.

[0040] 1. sgRNA design.

[0041] based on Figure 2 As shown in the sgRNA design rules, this invention selects exon 1 of the CD46 gene as the target site. The sequence of exon 1 (E1 exon) of the CD46 gene is shown in SEQ ID NO.1.

[0042] Eight gRNAs were designed, and their recognition sequences (target sequences of the sgRNAs) are as follows (SEQ ID NO.4-11): gRNA-1: AAGGGATTCTCGGGACGGCAGGG; gRNA-2: AAAGGGATTCTCGGGACGGCAGG; gRNA-3: AAGAAAGGGATTCTCGGGACGG; gRNA-4:AACGAAGCACCTCGAAGAAAAGG; gRNA-5:GGTGCTTCGTTGAGATTCTTTGG; gRNA-6: GTGCTTCGTTGAGATTCTTTGGG; gRNA-7: AGGCTCCTACCTGAGGGCATGGG; gRNA-8:GGCGTTTTGCGCGCTGCGCAAGG.

[0043] 2. Verification of cutting efficiency.

[0044] Cas9 mediates gene knockout in mammalian cells primarily through DNA double-strand breaks, resulting in small base deletions or insertions. These small gene modifications can be detected by T7E1 enzyme digestion. The basic principle is that when a double-strand break occurs at the target site, the cell initiates a DNA repair mechanism, resulting in various types of base deletion or insertion mutants. After PCR amplification of the target sequence, due to the partial deletion or insertion, DNA bubbling occurs during gradient annealing between different molecules. T7E1 specifically recognizes and cleaves these bubbling sites, thus determining whether Cas9 can mediate gene knockout at the target site.

[0045] (1) PCR amplification primers were designed to target the recognition and editing sites of the Cas9-nucleic acid editing vector as follows (SEQ ID NO.12-13): Pig CD-F: CACATAAAGCAAGCAGTAAG, PIG CD-R: GATTCTTACTCCTGCTGTC.

[0046] (2) Preparation of porcine fibroblast cell lines Skin tissue was taken from the ear of a large white pig. After removing the hair from the lower dorsal side of the ear, it was cleaned with a 70% (v / v) alcohol solution. Then, a 1 cm² area was removed from the lower dorsal side of the ear using a blade. 2 The skin samples were placed in DMEM / F12 medium at 0°C and transported back to the laboratory as soon as possible. After washing several times with PBS buffer and 70% (v / v) alcohol solution, the skin was minced into 1mm pieces. 3 Small pieces were washed twice with DMEM medium and then implanted in batches into culture flasks (25cm) containing 1 mL of DMEM medium with 10% (v / v) FBS. 2 After the tissue blocks adhered firmly to the wall, DMEM medium containing 10% (v / v) FBS was added to 6 mL. The cells were cultured at 37°C in a 5% CO2 incubator for 6-7 days, with the medium changed every 2 days. After the cells grew and merged, they were passaged 2-3 times with 0.25% trypsin and then frozen in batches with DMEM medium containing 20% ​​(v / v) FBS and 10% (v / v) DMSO to obtain the isolated porcine fibroblast cell line.

[0047] (3) Electroporation of Cas9-sgRNA into porcine fibroblasts i) Two days before electroporation, 2×10 5 The porcine fibroblast cell lines obtained in (2) above were revived in 6-well plates and 4 ml of DMEM medium containing 10% (v / v) fetal bovine serum (FBS) was added. The plates were then incubated at 37°C in a 5% CO2 incubator.

[0048] ii) After the cells in the 6-well plate have grown to confluence, approximately 1×10 6 Digest cells with 1 ml of 0.25% trypsin solution. Centrifuge at 1000 g for 5 min to pellet the cells. Wash the cell pellet once with PBS buffer. Resuspend the cells in 100 μL of electroporation buffer to obtain a cell suspension.

[0049] iii) Add 3 μg of expression vectors sgRNA1-sgRNA8 prepared in step 1 to 100 μL of the cell suspension obtained in step (2) above and mix with 5 μg of Cas9 protein respectively. After mixing, transfer the mixture into an electroporation cuvette.

[0050] iv) Electrolyze the cells with an electric field strength of 1.2 kV / cm and a pulse duration of 1 ms.

[0051] v) The electrolyzed cells were transferred into 60 mm cell culture dishes; 4 ml of DMEM culture medium containing 10% (volume percentage) fetal bovine serum was added, and the cells were cultured in a CO2 incubator. After the cells recovered their growth status, Cas9-sgRNA1-transgenic porcine fibroblasts, Cas9-sgRNA2-transgenic porcine fibroblasts, Cas9-sgRNA3-transgenic porcine fibroblasts, Cas9-sgRNA4-transgenic porcine fibroblasts, Cas9-sgRNA5-transgenic porcine fibroblasts, Cas9-sgRNA6-transgenic porcine fibroblasts, Cas9-sgRNA7-transgenic porcine fibroblasts, and Cas9-sgRNA8-transgenic porcine fibroblasts were obtained.

[0052] (4) PCR amplification Genomic DNA was extracted from porcine fibroblasts transfected with Cas9-sgRNA1 to sgRNA8 48 h after electroporation obtained in (3) above and from the isolated porcine fibroblast (WT) cell line prepared in (2) above.

[0053] Using genomic DNA as a template, PCR amplification was performed using F and R, which were designed and synthesized as described above (1), to obtain PCR products.

[0054] (5) PCR products were subjected to gradient annealing. The PCR product obtained in (3) above was purified and recovered by column purification, and the concentration of the PCR product was determined. The PCR product was then subjected to gradient annealing to obtain the gradient annealed PCR product.

[0055] The gradient annealing systems described above are shown in Table 1 below: Table 1 shows the gradient annealing system.

[0056] The gradient annealing procedure described above is shown in Table 2: Table 2 shows the gradient annealing procedure for PCR products.

[0057] (6) The PCR products obtained by gradient annealing in (5) above were digested with T7E1 enzyme. The digestion system is shown in Table 3 below: Table 3 shows the enzyme digestion system.

[0058] Reaction procedure: The enzyme digestion reaction shown in Table 3 was carried out in a constant temperature incubator at 37℃ for 1 hour to obtain the enzyme digestion product.

[0059] The enzyme digestion products were detected by polyacrylamide gel electrophoresis (PAGE) using an 8% polyacrylamide gel. After electrophoresis, the PAGE gel was stained with EB. The grayscale of the enzyme digestion bands was analyzed using ImageJ software to preliminarily determine the CMV-Cas9 digestion efficiency, which is the ratio of the intensity of the PCR master band to the intensity of the digested band.

[0060] The results showed that in porcine fibroblasts, all six gRNAs in the Cas9-sgRNA system corresponding to the eight gRNAs (gRNA1, gRNA2, gRNA3, gRNA4, gRNA5, and gRNA6) at the CD46 site had recognition and cleavage activity. The cleavage efficiencies, as analyzed by biological grayscale analysis software, were 20.1%, 13%, 15%, 25%, 18%, and 30%, respectively.

[0061] II. Using DNA-free complexes with precisely edited mutation types, three strains of porcine fetal fibroblasts were prepared with positive clones containing homozygous 80bp precisely deleted CD46 target genes.

[0062] (a) Preparation of DNA-free complexes with precisely edited mutation types 1. Obtaining helicase protein To achieve DNA-free editing, this invention utilizes the Cas9 protein (Cas9-EGFP protein form) and the helicase protein (DDX17).

[0063] The Cas9-EGFP protein was mixed with the sgRNA prepared in the above steps and then prepared for use in vitro. The helicase protein was aliquoted and prepared for use. The DNA-free, precisely edited complex of the same mutation type mainly includes the Cas9-EGFP protein described above, a selected pair of sgRNAs (gRNA-6: GTGCTTCGTTGAGATTCTTTGGG; gRNA-7: AGGCTCCTACCTGAGGGCATGGG), porcine helicase DDX17, and the small molecule LY294002. For electrotransfection, the Cas9-EGFP protein, the selected pair of sgRNAs, the porcine helicase DDX17, and the small molecule were added to the porcine PEF cell culture medium for 24 hours. After 24 hours, the small molecule was no longer used.

[0064] (ii) Transfection of DNA-free complexes with precisely edited mutation types 1. Two days before transfection, digest the isolated porcine fibroblast cell lines (Large White, Landrace, and Duroc) obtained in step 1, section 2, with trypsin to form single cells. Add 1×10⁻⁶ cells to each cell. 6 Each porcine fibroblast single cell was transferred to a culture flask (100 mL), and 4 mL of DMEM culture medium containing 10% (v / v) fetal porcine serum was added. The flask was then cultured at 37°C and 5% CO2 until the logarithmic growth phase.

[0065] 2. After completing step 1, take porcine fibroblasts in the logarithmic growth phase, digest them with 1 mL of 0.25% trypsin, then centrifuge at 1000g for 5 min and collect the precipitate.

[0066] 3. After completing step 2, take the precipitate, wash it once with PBS buffer, and then resuspend it with 100 μL of electroporation solution to obtain a cell suspension.

[0067] 4. Take cell suspension (containing 1×10⁻⁶ cells) 6 (1 cell), add the DNA-free, precisely edited complex of the same mutation type obtained in step (I) above (20 μg CAS9-EGFP protein, 5 μg sgRNA and 3 μg DDX17) to the cell suspension above.

[0068] Cells were electrocuted with an electric field strength of 1.2 kV / cm and a pulse duration of 1 ms.

[0069] 5. After completing step 4, transfer the electrolyzed cells into a culture flask (100mL), add 4mL of DMEM culture medium containing 10% (v / v) fetal porcine serum (containing 0.1μM LY294002), and perform flow cytometry sorting after 24h to select single cells with green fluorescence.

[0070] (III) Single-cell cloning and genotyping of the three strains (1) The transfected cells were sorted by conventional flow cytometry to separate the green cells, and the individual cells were injected into 96-well plates for monoclonal culture.

[0071] (2) When the cell fusion rate in the 96-well plate reaches 90%, half of the cells are digested and used for cell clone genotyping, while the remaining half are cultured in the well plate.

[0072] (3) When the cell fusion rate in the 48-well plate reaches 90%, half of the cells are digested and used for cell clone genotype identification, while the remaining half are cultured in the well plate.

[0073] (4) After centrifuging the cells used for genotyping at 1000g for 5min, discard the supernatant and add 10-20μL of cell lysis buffer (50mM KCl, 2.5mM MgCl2, 10mM Tris-HCl, 0.45% NP40, 0.45% Tween 20 and 0.2mg / mL proteinase K) according to the amount of cell precipitate.

[0074] (5) Take 3 μL of cell lysate as a template for PCR identification, and use primer pair composed of primer P1 and primer P2 (designed and synthesized based on porcine CD46 gene) for PCR amplification.

[0075] Pig CD-F: 5'-CACATAAAGCAAGCAGTAAG-3', Pig CD-R: 5'-GATTCTTACTCCTGCTGTC-3'.

[0076] The reaction system consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTP, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O.

[0077] Reaction program: 94℃ for 5 min; 94℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min, store at 4℃.

[0078] A 714bp band was obtained.

[0079] (6) The above PCR amplification products are purified and sequenced. The PCR products are ligated into the pMD-19t plasmid vector, transformed into competent E. coli cells, and multiple single colonies (single-cell clones) are selected for sequencing. The sequencing results are compared with the first exon of the wild-type CD46 gene to obtain detailed mutation information, which can determine whether the cell line is mutated and the type of mutation.

[0080] (7) The results are as follows: Three strains of single-cell clones were identified (Big White, Changbai and Duroc).

[0081] Among the 45 single-cell clones of the Large White strain, there are 3 gene mutation clones with homozygous deletion of 80bp biallelic gene: the gene with this mutation is named CD46 biallelic gene 80bp precise deletion gene, and the cells containing this mutant gene are named CD46 biallelic gene 80bp precise deletion porcine fibroblast mutant.

[0082] Among 30 single-cell clones of the Changbai strain, there are 2 gene mutation clones with homozygous deletion of 80bp biallelic gene: the gene with this mutation is named CD46 biallelic gene 80bp precise deletion gene, and the cells containing this mutant gene are named CD46 biallelic gene 80bp precise deletion porcine fibroblast mutant.

[0083] Among 55 single-cell clones of the Duroc strain, there were 2 gene mutation clones with homozygous deletion of 80bp biallelic gene: the gene with this mutation was named CD46 biallelic gene 80bp precise deletion gene, and the cells containing this mutant gene were named CD46 biallelic gene 80bp precise deletion porcine fibroblast mutant.

[0084] The CD46 biallelic mutant gene is a biallelic gene of CD46 with 80 bp deletion in the first exon of both chromosomes, while the other nucleotide sequences remain unchanged. The deleted 80 bp sequence is shown in SEQ ID NO.2.

[0085] Compared to the wild-type CD46 gene, the two strands of the CD46 biallelic mutant gene have a deletion of -80 / -80 bp in the first exon. The sequences of the first exon before and after the deletion region are unchanged, but due to the deletion, the terminator appears prematurely, so CD46 terminates prematurely, resulting in loss of protein function.

[0086] (iv) Preparation of edited pigs with precise 80bp deletion of CD46 biallelic gene in three strains 1. Take the large white pig fibroblast mutant, landrace pig fibroblast mutant and Duroc fibroblast mutant with 80bp deletion of CD46 biallelic gene obtained in Example 1, which are in the logarithmic growth phase, and digest them with 0.25% trypsin for 5 min to obtain single cells, which will be used as donor cells in subsequent operations.

[0087] 2. Collect ovaries from adult Large White pigs at the slaughterhouse. After washing three times in PBS at 37°C, extract follicles with a diameter of 2-8 mm using a 0.7 mm needle. Collect uniformly shaped and densely structured cumulus-oocyte complexes (COCs). Wash twice with maturation solution (M199 + 10% FBS + 0.01 U / mL bFSH + 0.01 U / mL bLH + 1 µg / mL estradiol). Then, place 50-60 COCs / well into a four-well plate containing maturation solution and culture for 18-20 hours at 38.5°C in a 5% CO2 incubator. After maturation, place the mature oocytes into a tube containing 0.1% hyaluronidase and shake for 2-3 minutes. Then, gently blow with a glass tube to completely separate the cumulus cells from the oocytes. Select oocytes with intact morphology, uniform cytoplasm, and extrusion of the first polar body as cytoplasmic acceptors (enucleated oocytes).

[0088] Oocytes with the first polar body were transferred into an operating solution consisting of M199 + 10% (v / v) FBS + 7.5 µg / mL cytosolic acid B. Under a 200x microscope, a small incision was made in the zona pellucida above the polar body using a glass needle. The first polar body and the chromosomes in the oocyte below it were then removed using a glass tube with an inner diameter of 20 µm. The oocytes were then washed three times in M199 solution containing 20% ​​(v / v) FBS and placed in an incubator for later use.

[0089] 3. Transfer the donor cells obtained in step 1 into the zona pellucida of the enucleated oocytes obtained in step 2. First, place them in Zimmerman's solution (100 mL Zimmerman's solution consists of 0.9854 g sucrose, 10.7 mg magnesium acetate tetrahydrate, 1.8 mg calcium acetate monohydrate, 7.4 mg dipotassium hydrogen phosphate, 3.1 mg reduced glutathione, 1.0 mg porcine serum albumin, and water) for equilibration for 3 min. Then, place them in a fusion tank and rotate the oocytes to bring the donor cells into contact with the enucleated oocytes prepared in step 2 and perpendicular to the electric field. Simultaneously, fuse them in a DC pulse field with a field strength of 2.5 kV / cm, with a pulse duration of 10 μs, a pulse number of 2 pulses, and a pulse interval of 1 s. Quickly transfer them into M199 solution containing 10% (v / v) FBS and culture at 37°C and 5% CO2 for 30 min to obtain the reconstructed embryo.

[0090] 4. Take the reconstructed embryo obtained in step 3 and add CR1aa culture medium with a concentration of 5 μM calcium ion carrier A23178 (100 mL of CR1aa culture medium consists of 0.67 g sodium chloride, 0.023 g potassium chloride, 0.22 g sodium bicarbonate, 2 mg sodium pyruvate, 100 μl phenol red and water) for 5 min; discard the liquid phase and add CR1aa culture medium containing 5 μg / mL cytosine B and 10 μg / mL actinomycin for 5 h (the purpose is to activate the reconstructed embryo); discard the liquid phase and add CR1aa culture medium containing 5% (v / v) FBS, and culture at 37℃ and 5% CO2 for 48 h. Observe the cleavage rate and observe the blastocyst development rate (about 80%) after 7-8 days to obtain transgenic cloned blastocysts.

[0091] 5. The morphologically superior transgenic cloned blastocysts cultured for 7 days in step 4 were transferred into the uterine horns of recipient sows of the same age (3 recipient sows from each breed were transferred). Ultrasound examination of the recipient sows was performed on day 30 post-transfer to confirm conception; the pregnancy rate was 66.7%.

[0092] 6. Pregnant sows were fed using conventional feeding methods. After 90 days, the pregnant sows gave birth normally, and somatic cell cloned breeding pigs were obtained (i.e., CD46 bis-allelic knockout pigs, with 3 pigs from each breed being identified and numbered #1-9).

[0093] III. Molecular Detection of DNA-Free CD46 Gene-Edited Pigs with Precise 80bp Deletion of the CD46 Gene from Three Different Strains (Duroc, Large White, and Landrace) to Resist Atypical Swine Fever F0 Generation. Three gene-edited cloned pigs from each strain were selected for molecular identification. Genomic DNA was extracted from ear tissues of both the gene-edited pigs and control pigs using a blood and tissue genomics kit. Using this DNA as templates, PCR amplification was performed using primers P1 and P2 (Pig CD-F: CACATAAAGCAAGCAGTAAG; PIG CD-R: GATTCTTACTCCTGCTGTC). The PCR amplification products were then purified and sequenced.

[0094] Sequencing results showed that the wild control pigs had a wild-type genotype (CD46+ / +) based on the CD46 gene, while the gene-edited pigs of the three strains #1-9 had a CD46 biallelic mutant genotype (CD46- / -) based on the CD46 gene, with the mutation patterns being exactly the same.

[0095] Compared to the wild-type CD46 gene, the two strands of the CD46 biallelic mutant gene have a deletion of -80 / -80 bp in the first exon. The sequences of the first exon before and after the deletion region are unchanged, but due to the deletion, the terminator appears prematurely, so CD46 terminates prematurely, resulting in loss of protein function.

[0096] Figure 3 The results show that pigs #1-9 are currently alive and developing normally to age 2 (A is the phenotypic graph). B is the nucleic acid test result. C is the sequencing alignment result.

[0097] Example 2 The innovative biological breeding technology system used in this embodiment is the same as that used in the CD46 edited pig example above. The only differences are in the design of target genes and target sites, screening of target gRNAs, identification of positive cells in the three strains, and identification of positive pigs in the three strains. Therefore, only the above core differences are shown in detail.

[0098] I. Substances used for APN biallelic mutations 1. Expression vector Cas9-sgRNA This study selected the entire sequence between the ATG and TAA of the APN gene as the deletion target sequence. The sequence of the APN gene is shown in SEQ ID NO.3. This invention designs a 15kb sequence for targeted deletion, and designs sgRNA upstream of ATG and downstream of TAA.

[0099] Six gRNAs were designed, and their recognition sequences (target sequences of the sgRNAs) are as follows (SEQ ID NO.14-19): gRNA-1: ATGTTTCTTGTCGAGGGAAT; gRNA-2: GATGGATCATGTTTCTTGTC; gRNA-3: GATCATGTTTCTTGTCGAGG; gRNA-4: ATGTTTCTTGTCGAGGGAAT; gRNA-5: GATGGATCATGTTTCTTGTC; gRNA-6: GATCATGTTTCTTGTCGAGG.

[0100] Single-chain oligonucleotides were synthesized according to the designed sequences, and the synthesis methods are as follows (SEQ ID NO.20-31): gRNA-F1: CACCGATGTTTCTTGTCGAGGGAAT; gRNA-R1: AAACATTCCCTCGACAAGAAACATC.

[0101] gRNA-F2: CACCGGATGGATCATGTTTCTTGTC; gRNA-R2: AAACGACAAGAAACATGATCCATCC.

[0102] gRNA-F3: CACCGGATCATGTTTCTTGTCGAGG; gRNA-R3: AAACCCTCGACAAGAAACATGATCC.

[0103] gRNA-F4: CACCGGATCATGTTTCTTGTCGAGG; gRNA-R4: AAACCCTCGACAAGAAACATGATCC.

[0104] gRNA-F5: CACCGGATCATGTTTCTTGTCGAGG; gRNA-R5: AAACCCTCGACAAGAAACATGATCC.

[0105] gRNA-F6: CACCGGATCATGTTTCTTGTCGAGG; gRNA-R6: AAACCCTCGACAAGAAACATGATCC.

[0106] The efficiency verification of gRNA is performed using the same steps as described above, and will not be repeated here.

[0107] The cleavage efficiency results showed that in porcine fibroblasts, all six gRNAs corresponding to the Cas9-sgRNA system targeting the APN site (gRNA1, gRNA2, gRNA3, gRNA4, gRNA5, and gRNA6) had recognition and cleavage activity. According to biological grayscale analysis software, their cleavage efficiencies were 20.1%, 13%, 15%, 25%, 18%, and 30%, respectively.

[0108] To further confirm that the mutation edited by the CMV-Cas9 system is in the target region, genomic DNA was extracted from highly active Cas9-sgRNA1 transgenic porcine fibroblasts as a template, amplified using F and R primers, and the resulting PCR product was recovered and subjected to TA cloning and sequencing.

[0109] Sequencing results were compared with wild-type APN gene sequences, confirming that the sgRNA underwent the expected mutation at the target site. In subsequent experiments, sgRNA1 and sgRNA3 were selected as the target gene editing sgRNAs.

[0110] II. Single-cell clone preparation and genotyping of three strains 1. The preparation and identification process of cell clones is the same as that in Example 1, except that the identification primers are different. PCR amplification is performed using primer pair composed of primers P1 and P2 (designed and synthesized based on the porcine APN gene) (SEQ ID NO.32-33).

[0111] Primer P1: 5'-AACATTTCTCAAATCTGG-3'; Primer P2: 5'-TTTCATGTAGAAGTAGAAGGT-3'.

[0112] The reaction system consisted of 20 μL of 1.0 μL DNA template, 0.4 μL primer P1 (10 μM), 0.4 μL primer P2 (10 μM), 0.4 μL dNTP, 0.3 μL LA DNA polymerase, 2.0 μL 10× PCR Buffer, and 15.5 μL ddH2O.

[0113] Reaction program: 94℃ for 5 min; 94℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min, 35 cycles; 72℃ for 5 min, store at 4℃.

[0114] A 714bp band was obtained.

[0115] The PCR amplification products were purified and sequenced. The PCR products were ligated into the pMD-19t plasmid vector, transformed into competent E. coli cells, and multiple single colonies (single-cell clones) were selected for sequencing. The sequencing results were compared with the wild-type APN gene to obtain detailed mutation information, thereby determining whether the cell line was mutated and the type of mutation.

[0116] 2. The results are as follows: Three strains of single-cell clones were identified (Big White, Changbai and Duroc).

[0117] Among the 70 single-cell clones of the Large White strain, there are 3 gene mutation clones with homozygous deletion of 15kb biallelic gene: the gene with this mutation is named APN biallelic gene 15kb precise deletion gene, and the cells containing this mutant gene are named APN biallelic gene 15kb precise deletion porcine fibroblast mutant.

[0118] Among the 32 single-cell clones of the Changbai strain, there are 3 gene mutation clones with homozygous deletion of 15kb biallelic gene: the gene with this mutation is named APN biallelic gene 15kb precise deletion gene, and the cells containing this mutant gene are named APN biallelic gene 15kb precise deletion porcine fibroblast mutant.

[0119] Among 55 single-cell clones of the Duroc strain, there are 3 clones with a 15kb biallelic deletion gene mutation. The gene with this mutation is named the APN biallelic deletion 15kb gene, and the cells containing this mutant gene are named the APN biallelic deletion 15kb porcine fibroblast mutant.

[0120] Compared to the wild-type APN gene, the two strands of the APN biallelic mutant gene have a -15kb / -15kb deletion (i.e., a full-length deletion). There are no changes in the sequences before and after the deletion region. However, due to the deletion of ATG-TAA, the entire gene-encoded protein is missing, and there are no truncated residual proteins. Therefore, it has the effect of resisting infectious gastroenteritis.

[0121] III. Preparation and Identification of Pigs with Precise 15kb biallelic Deletion of APN Gene from Three Strains The method for obtaining gene-edited positive pigs from three strains was the same as in Example 1, except for the identification primers. Three gene-edited cloned pigs from each strain were used for molecular identification. Genomic DNA was extracted from the ear tissues of the gene-edited pigs and control pigs using a blood and tissue genomics kit. Using this DNA as a template, PCR amplification was performed using primers P1 and P2 (primer P1: 5'-AACATTTCTCAAATCTGG-3'; primer P2: 5'-TTTCATGTAGAAGTAGAAGGT-3'). The PCR amplification products were then purified and sequenced.

[0122] Sequencing results showed that the wild control pigs had a wild-type genotype (APN+ / +) based on the APN gene, while the gene-edited pigs of the three strains #1-9 had an APN biallelic mutant genotype (APN- / -) based on the APN gene, with the mutation patterns being exactly the same.

[0123] Compared to the wild-type APN gene, the two strands of the APN biallelic mutant gene have a full-length -15kb / -15kb deletion, with no changes in the sequences before and after the deletion region. However, due to the deletion of ATG-TAA, the entire gene-encoded protein is missing, and there are no truncated residual proteins, thus achieving the efficacy against infectious gastroenteritis.

[0124] Figure 4The results show that pigs #1-9 are currently alive and developing normally to age 2 (A is the phenotypic graph). B is the nucleic acid test result. C is the sequencing alignment result.

[0125] IV. Detection of virus-edited pigs with precise 15kb deletion of APN biallelic gene. 1. The challenge experiment was conducted in accordance with the challenge method and disease-determining criteria of the "Quality Standard of Porcine Reproductive and Respiratory Syndrome Inactivated Vaccine (NVDC-JXA1 strain)" standard of the National Engineering Research Center for Veterinary Drugs.

[0126] In the challenge experiment, three Landrace and three Large White APN-edited pigs (obtained in step three) and three wild-type Landrace and Large White pigs of similar age were selected for the live challenge experiment (both experimental and control group piglets were PRRSV neutralizing antibody negative). Wild-type piglets were selected as the control group based on the weight, sex, breed, and date of birth of the experimental group pigs. The pigs were transported to the National Engineering Research Center for Veterinary Drugs in Luoyang, Henan Province, for the PRRSV live challenge experiment. After arrival, the pigs' body temperature, mental state, and feeding behavior were monitored to determine if they had adapted to the new environment. Once the pigs had fully adapted, the challenge experiment began, with a duration of 21 days.

[0127] For each pig breed, the experiment was set up in two groups, including two virus-inoculated groups and their respective contact groups (blank controls). Three APN-edited pigs inoculated with the virus formed the first group; three wild-type pigs inoculated with the virus formed the second group. The two groups were kept isolated from each other. Virus strain: Primarily the currently prevalent HP-PRRSV was selected, with a challenge dose of 10... 3 TCID50.

[0128] 2. Design of live pig challenge experiments, clinical data collection, and sample collection This project references the challenge methods and criteria for identifying diseased pigs in the "Quality Standards for Inactivated Porcine Reproductive and Respiratory Syndrome Vaccine (NVDC-JXA1 strain)" provided by national third-party testing institutions such as the National Engineering Research Center for Veterinary Drugs.

[0129] Specifically as follows: The main strain selected was TEGV-WH-1.

[0130] Challenge dose: Referencing the viral load in naturally infected pigs and the challenge dose used in vaccine testing, 10... 5 TCID50.

[0131] Number of pigs challenged: For each breed of pig, 3 gene-edited positive pigs and 3 wild-type control pigs.

[0132] Judgment criteria: 14 days after challenge, clinical symptoms (mainly diarrhea in piglets), nasal viral shedding, viremia, serum antibodies, daily weight gain and survival were assessed.

[0133] Sample collection: Blood samples were collected on days 0, 3, 5, 7, 10, 14, and 21 post-infection to separate serum. The serum was aliquoted into four portions and stored at -80°C. If any pigs became ill and died during the experiment, they were immediately dissected, and the lesions observed and recorded. Two samples of tissue from organs with visible lesions, such as intestines, were taken. One sample was stored at -80°C, and the other was fixed in a 4% paraformaldehyde solution and stored at room temperature. Pigs that did not develop symptoms and died were euthanized 21 days post-infection, dissected, and samples were collected in the same manner.

[0134] Collect relevant data (see details) Figure 5 ): In the figure, A shows the survival rate of the experimental and control groups after challenge; B shows the small intestine of the experimental and control groups after challenge; and C shows the antibody level detection results of the experimental and control groups after challenge. The results for APN-edited pigs in the figure are the combined results of all strains. The results show that the gene-edited pigs had no clinical symptoms of diarrhea after challenge, all survived, and serum tests showed no TEGV virus or antibodies, indicating that the APN gene-edited pigs prepared in this invention are completely resistant to transmissible gastroenteritis.

[0135] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nucleic acid editing composition, characterized in that, include: First sgRNA, second sgRNA, helicase, and DNA damage repair regulatory molecules; The first sgRNA and the second sgRNA are used to induce a predetermined mutation; The helicase includes one or more of DDX17, BLM, or UPF1; the DNA damage repair regulatory molecule is LY294002.

2. The nucleic acid editing composition according to claim 1, characterized in that, The first sgRNA and the second sgRNA were constructed using the following method: (1) For frameshift mutations of the gene to be edited, the first sgRNA and the second sgRNA are designed in the coding region of the gene to be edited, and the distance between them is not a multiple of 3; (2) For the domain mutation of the gene to be edited, the first sgRNA and the second sgRNA are designed in the intron regions flanking the exon where the domain is located, and do not include intron splicing sites; (3) For complete knockout of the gene to be edited, the first sgRNA and the second sgRNA are designed upstream of the promoter and downstream of the terminator of the gene to be edited, respectively.

3. The nucleic acid editing composition according to claim 1 or 2, characterized in that, The first sgRNA and the second sgRNA comprise either of the following nucleotide sequences: (1) First sgRNA: 5'-GTGCTTCGTTGAGATTCTTTGGG-3', Second sgRNA: 5'-AGGCTCCTACCTGAGGGCATGGG-3'; (2) First sgRNA: 5'-ATGTTTCTTGTCGAGGGAAT-3', Second sgRNA: 5'- GATCATGTTTCTTGTCGAGG-3'.

4. The nucleic acid editing composition according to any one of claims 1-3, characterized in that, Also includes: Cas9 protein.

5. The nucleic acid editing composition according to any one of claims 1-4, characterized in that, The nucleic acid editing composition comprises, by weight, 10-40 parts of the Cas9 protein, 2-5 parts of the helicase, and 0.08-0.16 parts of the DNA damage repair regulatory molecule.

6. A gene editing system, characterized in that, Includes the nucleic acid editing composition according to any one of claims 1-5; Preferably, it further includes: a filter mark; More preferably, the screening marker includes one or more of the following: antibiotic resistance screening marker, reporter gene, cell surface marker, or auxotrophic screening marker; More preferably, the screening marker is EGFP.

7. A reagent kit, characterized in that, Includes the nucleic acid editing composition according to any one of claims 1-5, or the gene editing system according to claim 6.

8. A gene editing method, characterized in that, include: The nucleic acid editing composition according to any one of claims 1-5, the gene editing system according to claim 6, or the kit according to claim 7 is used to perform a pre-defined mutation of the target gene in an organism. Preferably, the organism is an animal or a plant; More preferably, the organism is a pig.

9. The gene editing method according to claim 8, characterized in that, The preset mutation includes: transforming the first sgRNA, the second sgRNA and the helicase described in any one of the nucleic acid editing compositions of claims 1-5 into the fibroblast cell line of the organism, and then culturing it in a culture medium containing the DNA damage repair regulatory molecule described in any one of the nucleic acid editing compositions of claims 1-5 to obtain a fibroblast mutant; Using the fibroblast mutant as donor cells, the somatic cell nucleus was transplanted into enucleated oocytes for culture and development; Preferably, the conversion to electro-electricity is carried out under the following conditions: electric field strength of 1~2KV / cm and pulse duration of 0.75~2ms.

10. The use of the nucleic acid editing composition according to any one of claims 1-5, or the gene editing system according to claim 6, or the kit according to claim 7, in any of the following: (1) Gene editing in organisms; (2) Pig breed improvement; (3) Produce commercial pig herds with the same gene mutation on a large scale across different strains; Preferably, (2) includes: improvement of pig breeds in terms of disease resistance; More preferably, the disease includes one or more of transmissible gastroenteritis, reproductive and respiratory syndrome, or classical swine fever; More preferably, the strain in (3) includes one or more of Duroc, Big White or Long White.