Fads2-based retina photoreceptive neuronal lesion model and preparation method thereof

Abstract

The invention provides a retina photoreceptive neuronal lesion model based on fads2 and a preparation method thereof, and relates to the technical field of gene engineering. Wherein the sgRNA comprises a guide sequence which can be specifically combined with a nucleotide sequence as shown in SEQ ID NO.4 in the fads2 gene. The sgRNA can be used for constructing an animal individual highly similar to human retinitis pigmentosa disease through precise targeting and causing specific frame-shift mutation of the zebra fish fads2 gene. As a key tool for preparing the model, the method provides reliable, economic and efficient support for deeply researching the pathological mechanism of diseases and accelerating drug screening.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of genetic engineering, in particular to a fads2-based retinal photoreceptor neuron disease model and a preparation method thereof. BACKGROUND

[0002] The application of genetic engineering technology, especially gene editing technology, makes it possible to accurately simulate human genetic diseases in model organisms. Constructing animal models that can highly reduce the characteristics of human diseases at the genetic and phenotypic levels is crucial for revealing disease mechanisms and developing and evaluating treatment programs. Therefore, using gene editing technology to establish animal models highly related to human diseases is an important direction of modern biomedical research.

[0003] The eye is an important organ for receiving information from the outside world, and its dysfunction seriously affects the quality of life. Retinitis pigmentosa is a major hereditary blinding disease, and the pathological core is the progressive loss of retinal photoreceptor cells. In order to study such diseases, researchers often use animal models. Although rodent models are widely used, their retinal structure is quite different from that of humans, limiting the accuracy of the research. Zebrafish is considered an ideal model for studying visual system diseases due to its highly similar eye structure, especially photoreceptor composition, and strong reproductive ability, making it easy to observe. Studies have shown that the function of fatty acid desaturase 2 (fads2) gene is closely related to maintaining retinal homeostasis.

[0004] However, the existing technology still has obvious deficiencies in simulating retinitis pigmentosa using animal models, especially in simulating the pathological changes caused by defects in the function of specific genes such as fads2. The current animal models are difficult to accurately and stably reproduce the key pathological phenotype of progressive and large-scale photoreceptor cell death in human patients. In addition, the construction method of some models is low in efficiency, or the type of mutation produced is unstable, making it difficult to establish a stable genetic strain that can be used for large-scale and repeatable research, which greatly limits its application value.

[0005] In summary, the current retinal disease research field lacks an animal model that can accurately simulate human diseases caused by fads2 gene mutations. This technical deficiency makes it difficult to explore the pathogenesis of the disease in depth, and also seriously restricts the screening and development process of targeted treatment drugs, resulting in a long and costly research and development cycle for new therapies.

[0006] Therefore, the present application is proposed. SUMMARY

[0007] The primary objective of this invention is to provide a retinal photoreceptor neuron lesion model based on fads2 and its preparation method, wherein the sgRNA can precisely induce fads2 gene mutations to construct zebrafish individuals that are highly similar to human retinal lesions, thereby providing an efficient and economical key tool for related disease research and drug screening.

[0008] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides an sgRNA targeting the zebrafish fads2 gene, the sgRNA comprising a guide sequence capable of specifically binding to the nucleotide sequence shown in SEQ ID NO.4 of the fads2 gene.

[0009] In an optional embodiment, the nucleotide sequence shown in SEQ ID NO.4 is located on exon 10 of the zebrafish fads2 gene; and / or, the nucleotide sequence of the sgRNA targeting the zebrafish fads2 gene is as shown in SEQ ID NO.1.

[0010] Secondly, the present invention provides a primer sequence for constructing an sgRNA template targeting the zebrafish fads2 gene as described in the foregoing embodiments, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3.

[0011] Thirdly, the present invention provides a method for constructing a retinal photoreceptor neuron lesion model, comprising: The sgRNA and Cas9 mRNA targeting the zebrafish fads2 gene as described in the aforementioned embodiments were mixed and then microinjected into zebrafish single-cell stage fertilized eggs. The fertilized eggs that have undergone microinjection were cultured, and F0 generation zebrafish with mutations in the fads2 gene were screened by gene sequencing. The offspring of the F0 generation zebrafish were screened to obtain zebrafish with stable heritability of the fads2 gene mutation, thus obtaining the zebrafish model of retinal photoreceptor neuron lesions.

[0012] In an optional implementation, the step of screening the offspring of the F0 generation zebrafish to obtain zebrafish with a stably inherited fads2 gene mutation includes: Genomic DNA was extracted from the embryos of the F0 generation zebrafish offspring; Using the genomic DNA as a template, PCR amplification was performed using the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6; Gene sequencing was performed on the PCR amplification products, and zebrafish with stable heritability of the fads2 gene mutation were screened based on the sequencing results.

[0013] In an optional embodiment, the number of zebrafish single-cell stage fertilized eggs microinjected is 200-500; and / or, Before microinjecting the mixture of sgRNA and Cas9 mRNA targeting the zebrafish fads2 gene, as described above, into zebrafish single-cell stage fertilized eggs, the procedure further includes: A PCR reaction was performed using the primer sequences described in the foregoing embodiments to obtain an sgRNA template for in vitro transcription, and then the sgRNA template was transcribed in vitro to obtain the sgRNA.

[0014] Fourthly, the present invention provides a zebrafish model of retinal photoreceptor neuron lesions, which is constructed using the method for constructing a retinal photoreceptor neuron lesion model as described in any of the foregoing embodiments.

[0015] Fifthly, the present invention provides a method for detecting mutations in the fads2 gene in zebrafish, comprising: The zebrafish genome to be tested was used as a template; PCR was performed using a forward primer with the nucleotide sequence shown in SEQ ID NO.5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO.6 to obtain PCR products; The PCR product was sequenced, and the presence of a mutation in the fads2 gene was confirmed based on the sequencing results.

[0016] In a sixth aspect, the present invention provides a kit comprising a zebrafish fads2 gene targeting as described in the foregoing embodiments; and / or a primer sequence as described in the foregoing embodiments; and / or a forward primer with a nucleotide sequence as shown in SEQ ID NO. 5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 6.

[0017] In a seventh aspect, the present invention provides the application of sgRNA targeting the zebrafish fads2 gene as described in the foregoing embodiments in constructing a zebrafish fads2 mutant model of non-alcoholic fatty liver disease.

[0018] This invention provides a retinal photoreceptor neuron lesion model based on fads2 and its preparation method. The advantage of the sgRNA targeting the zebrafish fads2 gene compared to existing technologies lies in its ability to precisely recognize and bind to specific sites on the zebrafish fads2 gene. This high specificity forms the basis for generating effective mutations in this gene using gene editing technology.

[0019] By using this sgRNA, a frameshift mutation can be induced in exon 10 of the fads2 gene, leading to altered function of the Fads2 protein or premature termination of translation. This results in severe loss of retinal visual cells in zebrafish, exhibiting characteristics remarkably similar to retinitis pigmentosa in humans.

[0020] Therefore, this sgRNA is a key tool for constructing animal individuals that highly resemble human diseases. Using such animal individuals prepared with this sgRNA can effectively reduce the cost of pharmacological experiments and drug screening, shorten the research and development cycle, and provide strong support for in-depth research into the pathological mechanisms of retinal diseases and the search for new treatments. Attached Figure Description

[0021] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0022] Figure 1 The diagram shows the target site sequence of the fads2 gene, the sequencing results peak diagram including the mutation site, and the schematic diagrams of the wild-type and predicted mutant Fads2 protein structures provided in Embodiment 1 of the present invention. Figure 2 This is a bar chart showing the expression analysis of the fads2 gene in zebrafish juveniles with the fads2 gene mutation, as used in Example 4 of the present invention. Figure 3 This is a schematic diagram of the in situ hybridization analysis of the fads2 gene RNA using fads2 mutant zebrafish juveniles as material in Example 4 of the present invention; Figure 4 This is a schematic diagram of a section used in Example 4 of the present invention for HE staining and morphological observation of the eyeball of a juvenile zebrafish with the FADS2 mutant. Figure 5 This is a schematic diagram of visual cell-specific immunofluorescence analysis of frozen sections of juvenile fads2 mutant zebrafish eyes in Example 4 of the present invention. Detailed Implementation

[0023] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0024] In this embodiment of the application, an sgRNA targeting the zebrafish fads2 gene is provided. The sgRNA contains a guide sequence capable of specifically binding to the nucleotide sequence shown in SEQ ID NO. 4 of the fads2 gene. Specifically, SEQ ID NO. 4 is: 5'-GGAGAGCCACTGGTTTGTTTTGG-3'.

[0025] The aforementioned sgRNA (Single-guide RNA) is an artificially designed nucleic acid molecule. As a whole, it acts as a "navigation tool" specifically designed to precisely locate a particular gene called fads2 within the vast and complex genome of zebrafish.

[0026] The sgRNA molecule contains a crucial functional part called the "guide sequence." This guide sequence is a short nucleotide sequence in the sgRNA molecule responsible for recognizing the target; it can be understood as the "address code" or "GPS coordinates" of the entire navigation tool.

[0027] The "guide sequence" component is defined by the function it can perform, not by its specific, immutable chemical structure. In other words, it defines all guide sequences capable of "finding and binding to the sequence known as SEQ ID NO.4 on the fads2 gene," not just molecules with a specific sequence. Similarly, any guide sequence that can specifically bind to the target SEQ ID NO.4 falls within this definition.

[0028] It's important to note that DNA and RNA molecules are composed of four different nucleotides (bases). These bases adhere to strict pairing rules: adenine (A) pairs with thymine (T) or uracil (U), and guanine (G) pairs with cytosine (C). The "guide sequence" in this sgRNA is designed based on this principle, and its sequence is complementary to the SEQ ID NO.4 sequence on the target fads2 gene. When this sgRNA is introduced into a cell, it binds to a Cas9 protein (a type of molecular scissors) to form a complex. This complex scans the vast genomic DNA within the cell nucleus. Due to the principle of base complementarity, the guide sequence in the sgRNA binds precisely and stably only to the SEQ ID NO.4 sequence on the fads2 gene, which is completely complementary to it. Once binding is successful, it essentially completes the localization, guiding the Cas9 protein to the correct location for subsequent operations.

[0029] Based on its strict sequence complementation mechanism, this sgRNA exhibits high specificity and precision, effectively guiding molecular tools to the pre-defined fads2 gene site, a crucial prerequisite for successfully generating gene mutations. Therefore, this sgRNA is a key initiation tool for constructing animal individuals exhibiting characteristics similar to specific human diseases, thus providing an extremely valuable platform for subsequent scientific research and drug evaluation.

[0030] In some embodiments, the nucleotide sequence shown in SEQ ID NO.4 is located on exon 10 of the zebrafish fads2 gene.

[0031] The above characteristics define the specific location of the sgRNA target (i.e., SEQ ID NO.4) in the fads2 gene. It indicates that this target is not located in any arbitrary region of the gene, but precisely on its 10th exon (Exon 10).

[0032] It is important to note that in gene structure, exons are the coding sequences that will ultimately be translated into proteins. Therefore, if a mutation (such as the addition or deletion of bases) occurs in an exon region of a gene, it is highly likely that the protein encoded by that gene will experience a frameshift error or premature termination during synthesis, resulting in a non-functional or abnormally functioning protein.

[0033] By precisely targeting exons, the chances of successfully disrupting the function of the fads2 gene can be significantly increased. This ensures that gene editing produces an effective biological effect—the loss of function of the fads2 protein—thus providing a basis for creating animal individuals with distinct pathological phenotypes.

[0034] In some embodiments, the nucleotide sequence of the guide sequence is as shown in SEQ ID NO.4.

[0035] In some embodiments, the nucleotide sequence of the sgRNA targeting the zebrafish fads2 gene is shown in SEQ ID NO. 1.

[0036] The above defines the complete chemical structure of the entire sgRNA molecule. A complete sgRNA includes not only the "guide sequence" responsible for target recognition (i.e., SEQ ID NO.4), but also a structure called the "scaffold sequence." SEQ ID NO.1 is the full-length sequence containing both of these parts. Specifically, SEQ ID NO.1 is: 5'-GGAGAGCCACTGGTTTGTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3'.

[0037] In this embodiment, a primer sequence for constructing an sgRNA template targeting the zebrafish fads2 gene as described in the foregoing embodiments is provided, comprising a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.3. The specific nucleotide sequences include: (1) SEQ ID NO.2: 5'- TAATACGACTCACTATAGGAGAGCCACTGGTTTGTTGTTTTAGAGCTAGAAATAGC -3'; (2) SEQ ID NO.3: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'.

[0038] The primer sequences described above are used as a crucial tool to construct (i.e., mass-produce) a DNA template in the laboratory using polymerase chain reaction (PCR) technology. This DNA template sequence encodes the aforementioned sgRNA. In short, the primer sequences are the tools for creating the necessary "mold" for producing sgRNA.

[0039] This application provides a method for constructing a retinal photoreceptor neuron lesion model, comprising: Step S1: Mix the sgRNA and Cas9 mRNA targeting the zebrafish fads2 gene as described in the aforementioned embodiments, and then microinject them into zebrafish single-cell stage fertilized eggs.

[0040] This step is the starting point of the entire method, providing two core components for gene editing: sgRNA and Cas9 mRNA (as the instruction code for "molecular scissors"), which are injected directly into the earliest stage of zebrafish life, namely the single-cell fertilized egg, through a specific fine needle.

[0041] This step is based on CRISPR / Cas9 gene editing technology. The sgRNA guides the Cas9 protein, translated from Cas9 mRNA, precisely to the target site on the fads2 gene. The Cas9 protein then cuts the DNA double strand at that site. The cell's own DNA repair mechanisms often make small errors (such as adding or deleting a few bases) when repairing this break, leading to the disruption of the gene's function. Injection during the single-cell stage is crucial because it ensures that the gene change is integrated into the organism's first cell, so that all tissues and organs subsequently developed from this cell carry the gene mutation.

[0042] Step S2 involves culturing the microinjected fertilized eggs and screening for F0 generation zebrafish with mutations in the fads2 gene through gene sequencing.

[0043] It's important to note that gene editing success is not 100%, therefore not all injected fertilized eggs will develop the expected gene mutation. This step is a "quality control" process for the first batch of zebrafish to grow (called the F0 generation). By extracting their DNA and performing gene sequencing, individuals whose fads2 gene has indeed been successfully edited are identified. This is a screening and verification step. Its purpose is to precisely identify the "founder" fish carrying the target gene mutation from a large number of treated individuals; these fish form the basis for establishing subsequent stable strains.

[0044] Step S3: Screen the offspring of the F0 generation zebrafish to obtain zebrafish whose fads2 gene mutation can be stably inherited, thus obtaining the zebrafish model of retinal photoreceptor neuron lesions.

[0045] The aforementioned F0 generation mutant individuals are often "chimeras," meaning that some cells in their bodies have the mutation while others do not. To obtain a valuable animal model for research, this gene mutation must be stably passed on to the next generation. This step involves breeding the selected F0 generation zebrafish and then screening their offspring (F1 generation) again. If individuals carrying the mutation are found in the offspring, it proves that the mutation has entered the reproductive cells (sperm or egg) of the F0 generation fish and is heritable. These offspring that can stably inherit the mutation are the final "models" obtained and can be used for scientific research.

[0046] This step is based on Mendel's laws of inheritance. By screening offspring, not only can the heritability of the mutation be confirmed, but homozygous mutants can also be selected, thereby establishing an animal model strain with stable genotype and consistent phenotype.

[0047] The preparation method presented in this embodiment integrates mature biological technologies, providing a systematic process from gene editing and initial screening to establishing stable genetic strains, thus exhibiting strong reproducibility. This process has a clear objective: by precisely targeting the fads2 gene, it can reliably construct animal models that are genetically highly similar to human retinal diseases. This combination of systematicity, high relevance, and reliability ensures that the final model has extremely high value in studying disease mechanisms and drug screening.

[0048] In some embodiments, step S3, screening the offspring of the F0 generation zebrafish to obtain zebrafish whose fads2 gene mutation can be stably inherited, includes: Step S31: Extract genomic DNA from the F0 generation zebrafish offspring embryos.

[0049] This step is the preparation stage for the screening process. It involves separating and purifying the complete genetic material—genomic DNA—from the offspring embryos of F0 generation zebrafish using physical and chemical methods.

[0050] Any genetic testing requires obtaining pure genetic material. DNA in cells is mixed with other biological macromolecules (such as proteins and RNA), and these impurities must be removed through extraction steps to obtain the "raw materials" that can be used for subsequent analysis.

[0051] Step S32: Using the genomic DNA as a template, perform PCR amplification using the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6.

[0052] This step is the core amplification stage of the screening process. It utilizes polymerase chain reaction (PCR) technology to precisely locate and massively replicate the small DNA fragment containing the fads2 gene mutation site from the extracted massive amount of genomic DNA.

[0053] The high specificity of PCR technology relies on a pair of primers (SEQ ID NO.5 and NO.6). These primers are designed to bind only to specific sequences flanking the fads2 gene mutation site throughout the zebrafish genome. This precise "targeting" ensures that the PCR reaction amplifies only the target fragment, avoiding the amplification of other unrelated genes. Due to the exponential amplification characteristic of PCR, the target fragment can be replicated millions or even billions of times after dozens of cycles, reaching a detectable quantity.

[0054] Step S33: Perform gene sequencing on the PCR amplification products and screen out zebrafish whose fads2 gene mutations can be stably inherited based on the sequencing results.

[0055] This step is the final "reading" and verification stage of the screening process. It involves feeding the DNA fragments amplified in the previous step into a sequencer to precisely read the sequence of each base.

[0056] Gene sequencing is the "gold standard" for reading DNA sequences. By comparing the sequenced data with the wild-type (unmutated) fads2 gene sequence, it is easy to see whether there are any mutations such as additions, deletions, or modifications of bases. If the expected mutation is found in the sequencing results of an F1 embryo, it irrefutably proves that this mutation has been stably inherited by its F0 parent's germ cells (sperm or egg).

[0057] In some embodiments, the number of zebrafish single-cell stage fertilized eggs microinjected is 200 to 500. For example, it can be 200, 300, 400, 500, etc.

[0058] In some embodiments, before microinjecting the sgRNA and Cas9 mRNA targeting the zebrafish fads2 gene as described above into zebrafish single-cell stage fertilized eggs in step S1, the method further includes: A PCR reaction was performed using the primer sequences described in the foregoing embodiments to obtain an sgRNA template for in vitro transcription, and then the sgRNA template was transcribed in vitro to obtain the sgRNA.

[0059] First, using a specific primer pair (SEQ ID NO.2 and NO.3), a specific DNA sequence is replicated in large quantities using polymerase chain reaction (PCR) technology. This replicated DNA sequence is the DNA template for sgRNA, which can be understood as the "blueprint" or "mold" for manufacturing sgRNA.

[0060] This step is based on the principle of PCR. Primer pairs bind precisely to both ends of a DNA molecule containing the sgRNA coding sequence, defining the scope of replication. Under the action of DNA polymerase, this specific fragment is amplified exponentially, thereby obtaining a massive amount of pure DNA template in a short time.

[0061] The DNA template obtained in the previous step is then used in a reaction called "in vitro transcription." This step is based on the central dogma of molecular biology: the process by which genetic information flows from DNA to RNA (transcription). In this reaction, a tool enzyme called RNA polymerase "reads" the sequence information on the DNA template and, guided by it, synthesizes a corresponding RNA molecule. Since the DNA template encodes sgRNA, the final product of this reaction is the desired biologically active sgRNA molecule.

[0062] In this embodiment of the application, a zebrafish model of retinal photoreceptor neuron lesions is provided, which is constructed using the method for constructing a retinal photoreceptor neuron lesion model as described in any of the foregoing embodiments.

[0063] This application provides a method for detecting mutations in the zebrafish fads2 gene, including: (1) The zebrafish genome to be tested was used as a template.

[0064] This step requires extracting the complete genetic material, or genomic DNA, from the zebrafish being tested (either embryo or adult) as the raw material for subsequent analysis. Genetic mutations are changes at the DNA sequence level; therefore, to detect such changes, it is necessary to first obtain DNA containing all genetic information as a template.

[0065] (2) PCR reaction was performed using the forward primer with nucleotide sequence as shown in SEQ ID NO.5 and the reverse primer with nucleotide sequence as shown in SEQ ID NO.6 to obtain PCR products.

[0066] This step is the core of the detection process: target identification and amplification. Within the vast zebrafish genome, a specific pair of "probes" (SEQ ID NO.5 and NO.6 primers) are used to precisely locate and massively replicate the small DNA segment containing the potential mutation site of the fads2 gene using PCR technology.

[0067] (3) Sequencing the PCR product and confirming whether there is a mutation in the fads2 gene based on the sequencing results.

[0068] This step is the final "reading" and judgment step in the detection. The pure and abundant fads2 gene fragment obtained in the previous step is sent to a sequencer to accurately read its nucleotide sequence. Gene sequencing is the "gold standard" for reading DNA sequences. By comparing the sequenced sequence with the known wild-type (normal, unmutated) fads2 gene sequence, any additions, deletions, or substitutions of bases can be clearly identified. If the sequence differs, it can be confirmed that the zebrafish's fads2 gene has a mutation.

[0069] In this application embodiment, a kit is provided, comprising a zebrafish fads2 gene targeting sequence as described in the foregoing embodiments; and / or a primer sequence as described in the foregoing embodiments; and / or a forward primer with a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.6.

[0070] In this application embodiment, the application of sgRNA targeting the zebrafish fads2 gene as described in the foregoing embodiments is provided in the construction of a zebrafish fads2 mutant model of non-alcoholic fatty liver.

[0071] The present invention will be further illustrated below with specific embodiments. However, it should be understood that these embodiments are merely for the purpose of more detailed illustration and should not be construed as limiting the present invention in any way.

[0072] Example 1 In this embodiment, gRNA was obtained.

[0073] Experimental methods: 1. Based on the CRISPER / Cas9 knockout principle, design and synthesize sgRNA sequences containing the fads2 gene target site sequence, where the fads2 gene target site is as follows: Figure 1 As shown in the figure (the underlined part in the gene sequence is the target sequence, and the four bases in the box: TTTG is the specific sequence of the deletion mutation), preferably, the target sequence of the gRNA is located on exon 10 of the fads2 gene, and the site sequence is the nucleotide sequence shown in SEQ ID NO.4.

[0074] SEQ ID NO.4: 5'-GGAGAGCCACTGGTTTGTTTGG-3'; the sgRNA has the nucleotide sequence as shown in SEQ ID NO.1; wherein, SEQ ID NO.1 is: 5'-GGAGAGCCACTGGTTTGTTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3'.

[0075] 2. Synthesize PCR primers for constructing a synthetic sgRNA template. The synthesized primer sequences include the forward primer sequence as shown in SEQ ID NO.2 and the reverse primer sequence as shown in SEQ ID NO.3. (1) SEQ ID NO.2: 5'-TAATACGACTCACTATAGGAGAGCCACTGGTTTGTTGTTTTAGAGCTAGAAATAGC -3'; (2) SEQ ID NO.3: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3'.

[0076] 3. Using the primers synthesized in step 2, PCR was performed with pMD19T-gRNA as the template for the PCR reaction. The PCR product was purified and recovered to prepare an in vitro transcription template for gRNA. To obtain the gRNA template, perform PCR amplification using the following reaction system: Table 1. Reaction System

[0077] Prepare a 200 μL PCR system. The PCR program is as follows: 94 ºC for 5 min; 94 ºC for 30 s; 60 ºC for 30 s; 72 ºC for 30 s, 30 cycles; 72 ºC for 10 min. The PCR product purification and recovery steps are as follows: (1) Column equilibration step: Add 500 μl of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0078] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.

[0079] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), place at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.

[0080] (4) Add 600 μl of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.

[0081] (5) Repeat step (4).

[0082] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.

[0083] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μl of elution buffer EB to the middle of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution.

[0084] 4. The gRNA in vitro transcription template obtained in step 3 is transcribed in vitro using T7 transcriptase, and the gRNA is purified and recovered.

[0085] T7 RNA transcriptase was used to transcribe gRNA in vitro. The components were then added to the following mixture and thoroughly combined: Table 2. Reaction System

[0086] After reacting at 37 ºC for 1 hour, the synthesized gRNA was purified. The specific steps are as follows: (1) DNase I treatment: Add 2.5 μL 10X buffer and 2 μL DNase I, and react at 37 ºC for 15 min to remove DNA template; (2) Then use SigmaSpin TM Purification was performed using the Sequencing reaction clean-up kit: the purification column was placed in a 2 mL collection tube and centrifuged at 2800 rpm for 15 s; (3) Twist off the bottom sealing column of the tube, then discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 min; (4) Place the purification column into a new RNase-free EP tube and discard the collection tube; (5) Add the gRNA synthesis solution to the purification column and centrifuge at 2800 rpm for 4 min; (6) Collect the column buffer, perform electrophoresis to detect and determine the concentration, and then place it in a container. Store in a refrigerator at 80°C for later use.

[0087] Example 2 In this embodiment, Cas9 mRNA is synthesized.

[0088] Experimental methods: The specific steps for synthesizing Cas9 mRNA are as follows: 1. The plasmid containing the full-length Cas9 sequence optimized with zebrafish codons was linearized by restriction endonuclease digestion and purified using the GeneJET PCR Purification Kit for use as a transcription template.

[0089] The purification and recovery steps for PCR products are as follows: (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400×g) for 1 min, discard the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0090] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of binding solution PB, and mix thoroughly.

[0091] (3) Add the solution obtained in the previous step to an adsorption column CB2 (place the adsorption column in the collection tube), place at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 30-60 sec, discard the waste liquid in the collection tube, and place the adsorption column CB2 into the collection tube.

[0092] (4) Add 600 μL of washing solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, discard the waste liquid in the collection tube, and put the adsorption column CB2 into the collection tube.

[0093] (5) Repeat step (4).

[0094] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much of the washing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry it thoroughly to prevent residual washing solution from affecting the next step of the experiment.

[0095] (7) Place the adsorption column CB2 into a clean centrifuge tube, add 30-50 μl of elution buffer EB to the center of the adsorption membrane, and incubate at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution. Use the Ambion mMessage mMachine in vitro transcription kit to synthesize Cas9 mRNA in vitro. The reaction system is as follows: Table 3. Reaction System

[0096] After the reaction system is prepared, mix it well and incubate it in a water bath at 37 ℃ for 2 hours.

[0097] Follow these steps to purify and recover Cas9 mRNA: (1) Add 1 μL of the DNase provided in the kit to the reaction system, mix well, and incubate in a water bath at 37 °C for 15 minutes; (2) Add 20 μL of 5 M ammonium acetate, mix well, and place on ice for 10 minutes; (3) Centrifuge at 4 ℃ and 12000 rpm for 15 minutes. The white precipitate is mRNA. (4) Discard the supernatant, wash the precipitate with 75% ethanol, and centrifuge at 7500 rpm for 5 minutes at 4 ℃; (5) Discard the supernatant, air dry the precipitate, and add 10 μL of enzyme-free water to dissolve the precipitate; (6) Take 0.5 μL of RNA, dilute it 20 times, and test its concentration and purity. Then take 10 μL of the dilution solution for agarose gel electrophoresis to test the degree of degradation.

[0098] Example 3 In this embodiment, individuals with complete fads2 deficiency are constructed and screened.

[0099] Experimental methods: 1. The gRNA and Cas9 mRNA obtained in step S4 are mixed and microinjected into single-cell stage zebrafish fertilized eggs, with 1 nL injected into each embryo.

[0100] 2. After the gRNA and Cas9 mRNA are synthesized, prepare the injection sample according to the following system. The injection system is as follows: 3 μL: Table 4. Injection System

[0101] The number of single-cell stage zebrafish fertilized egg embryos injected ranges from 200 to 500. In this embodiment, 500 single-cell stage zebrafish fertilized egg embryos were injected.

[0102] 3. After injection, culture for 24 hours, collect embryos obtained from single-cell stage zebrafish fertilized eggs after microinjection, extract the genome, amplify the target sequence containing the target site by PCR, and sequence it; perform PCR amplification of the target sequence containing the target site according to the following reaction system: Table 5. Injection System

[0103] The PCR program was as follows: 94 ºC for 5 min; 94 ºC for 30 s; 60 ºC for 30 s; 72 ºC for 30 s, 35 cycles; 72 ºC for 10 min. The primer sequences used for sequencing include the forward primer sequence of SEQ ID NO.5 and the reverse primer sequence of SEQ ID NO.6: SEQ ID NO.5: 5'-ATCGAAAATCAACTGTGA-3'; SEQ ID NO.6: 5'-CCAGTCGTTGAAGGCAGA-3'; For example, the primer in SEQ ID NO.5 is also a primer used for Sanger DNA sequencing.

[0104] 4. Embryos with random peaks near the target site in the sequencing results are introduced into the feeding system and raised until sexual maturity. For sexually mature zebrafish, the next generation of embryos are screened again using the above PCR and sequencing methods to detect zebrafish with effective mutation types, thereby obtaining fads2 gene mutant zebrafish, which is the zebrafish model of retinal photoreceptor neuron lesions.

[0105] Example 4 In this embodiment, functional verification and phenotypic analysis were performed on individuals with complete loss of fads2.

[0106] Experimental methods: 1. The fads2 gene mutant zebrafish juveniles prepared in the above examples were subjected to fads2 gene expression analysis; like Figure 2 As shown, the mRNA level of the mutant fads2 was significantly lower than that of the wild type (** indicates P<0.01). This result demonstrates that the method for constructing the zebrafish model of retinal photoreceptor neuron lesions caused by the fads2 gene mutation provided in this embodiment can effectively mutate the gRNA target sequence located on exon 10 of the fads2 gene.

[0107] 2. Take the fads2 gene mutant zebrafish juveniles prepared in the above examples and perform fads2 gene RNA in situ hybridization analysis; like Figure 3 As shown, compared to wild-type zebrafish, the method for constructing a zebrafish model of retinal photoreceptor neuron lesions with fads2 gene mutation provided in this embodiment can effectively inhibit the expression of fads2 mRNA in retinal photoreceptor neurons, causing the constructed zebrafish model to exhibit retinal photoreceptor neuron defects.

[0108] 3. Take the eyeballs of the fads2 deletion mutant zebrafish juveniles prepared in the above examples and perform frozen sections for HE staining and histological observation. like Figure 4 As shown, compared to wild-type zebrafish, the method for constructing a zebrafish model of retinal photoreceptor neuron lesions with a mutation in the fads2 gene provided in this embodiment can effectively reduce the number of cells in the visual cell layer.

[0109] 4. Visual cell-specific immunofluorescence analysis was performed on frozen sections of the eyes of juvenile zebrafish with the fads2 deletion mutation prepared in the above examples. like Figure 5 As shown, compared to wild-type zebrafish, the method for constructing the zebrafish model of retinal photoreceptor neuron lesions caused by the fads2 gene mutation provided in this embodiment can effectively reduce the number of cone cells and rod cells located above the cone cells in the visual cell layer.

[0110] 5. Analyze and describe the visual cell lesions in the fads2 deletion mutant zebrafish by analyzing the data obtained in steps 1 to 4.

[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An sgRNA targeting the zebrafish fads2 gene, characterized in that, The sgRNA targeting the zebrafish fads2 gene contains a guide sequence capable of specifically binding to the nucleotide sequence shown in SEQ ID NO.4 of the fads2 gene.

2. The sgRNA targeting the zebrafish fads2 gene as described in claim 1, characterized in that, The nucleotide sequence shown in SEQ ID NO.4 is located on exon 10 of the zebrafish fads2 gene; and / or, the nucleotide sequence of the sgRNA targeting the zebrafish fads2 gene is as shown in SEQ ID NO.

1.

3. A primer sequence for constructing an sgRNA template targeting the zebrafish fads2 gene as described in claim 1 or 2, characterized in that, This includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

3.

4. A method for constructing a retinal photoreceptor neuron lesion model, characterized in that, include: The sgRNA and Cas9 mRNA targeting the zebrafish fads2 gene as described in claim 1 or 2 were mixed and then microinjected into zebrafish single-cell stage fertilized eggs. The fertilized eggs that have undergone microinjection were cultured, and F0 generation zebrafish with mutations in the fads2 gene were screened by gene sequencing. The offspring of the F0 generation zebrafish were screened to obtain zebrafish with stable heritability of the fads2 gene mutation, thus obtaining the zebrafish model of retinal photoreceptor neuron lesions.

5. The method for constructing the retinal photoreceptor neuron lesion model as described in claim 4, characterized in that, The process of screening the offspring of the F0 generation zebrafish to obtain zebrafish with a stably inherited fads2 gene mutation includes: Genomic DNA was extracted from the embryos of the F0 generation zebrafish offspring; Using the genomic DNA as a template, PCR amplification was performed using the forward primer shown in SEQ ID NO.5 and the reverse primer shown in SEQ ID NO.6; Gene sequencing was performed on the PCR amplification products, and zebrafish with stable heritability of the fads2 gene mutation were screened based on the sequencing results.

6. The method for constructing the retinal photoreceptor neuron lesion model as described in claim 4, characterized in that, The number of embryos microinjected into zebrafish single-cell stage fertilized eggs is 200–500; and / or, Before microinjecting the mixture of the zebrafish fads2 gene-targeting sgRNA and Cas9 mRNA as described in claim 1 or 2 into zebrafish single-cell stage fertilized eggs, the method further includes: A PCR reaction was performed using the primer sequence as described in claim 3 to obtain an sgRNA template for in vitro transcription, and then the sgRNA template was transcribed in vitro to obtain the sgRNA.

7. A retinal photoreceptor neuron lesion model, characterized in that, It was constructed using the method for constructing a retinal photoreceptor neuron lesion model as described in any one of claims 4-6.

8. A method for detecting mutations in the fads2 gene in zebrafish, characterized in that, include: The zebrafish genome to be tested was used as a template; PCR was performed using a forward primer with the nucleotide sequence shown in SEQ ID NO.5 and a reverse primer with the nucleotide sequence shown in SEQ ID NO.6 to obtain PCR products; The PCR product was sequenced, and the presence of a mutation in the fads2 gene was confirmed based on the sequencing results.

9. A reagent kit, characterized in that, Includes the target zebrafish fads2 gene as described in claim 1 or 2; and / or, the primer sequence as described in claim 3; and / or, the forward primer with the nucleotide sequence shown in SEQ ID NO. 5 and the reverse primer with the nucleotide sequence shown in SEQ ID NO.

6.

10. The application of the sgRNA targeting the zebrafish fads2 gene as described in claim 1 or 2 in constructing a zebrafish fads2 mutant model of non-alcoholic fatty liver disease.

Images